PHTF2
geneOn this page
Also known as DKFZp434D166
Summary
PHTF2 (putative homeodomain transcription factor 2, HGNC:13411) is a protein-coding gene on chromosome 7q11.23-q21.11, encoding Protein PHTF2 (Q8N3S3).
Located in endoplasmic reticulum.
Source: NCBI Gene 57157 — RefSeq curated summary.
At a glance
- GWAS associations: 25
- Clinical variants (ClinVar): 124 total
- MANE Select transcript:
NM_001395272
Identifiers
Gene identifiers
| Field | Value |
|---|---|
| HGNC ID | HGNC:13411 |
| Approved symbol | PHTF2 |
| Name | putative homeodomain transcription factor 2 |
| Location | 7q11.23-q21.11 |
| Locus type | gene with protein product |
| Status | Approved |
| Aliases | DKFZp434D166 |
| Ensembl gene | ENSG00000006576 |
| Ensembl biotype | protein_coding |
| OMIM | 616785 |
| Entrez | 57157 |
Gene structure
Transcript identifiers
Ensembl transcripts: 26 — 22 protein_coding, 2 protein_coding_CDS_not_defined, 2 retained_intron
ENST00000248550, ENST00000275575, ENST00000307305, ENST00000415251, ENST00000416283, ENST00000422959, ENST00000424760, ENST00000450574, ENST00000454592, ENST00000468351, ENST00000470215, ENST00000479515, ENST00000888882, ENST00000888883, ENST00000888884, ENST00000888885, ENST00000888886, ENST00000888887, ENST00000888888, ENST00000888889, ENST00000937835, ENST00000968114, ENST00000968115, ENST00000968116, ENST00000968117, ENST00000968118
RefSeq mRNA: 17 — MANE Select: NM_001395272
NM_001127357, NM_001127358, NM_001127359, NM_001127360, NM_001366081, NM_001366082, NM_001366083, NM_001366084, NM_001366085, NM_001366086, NM_001366087, NM_001366088, NM_001366089, NM_001395270, NM_001395271, NM_001395272, NM_020432
CCDS: CCDS47621, CCDS47622, CCDS47623, CCDS47624, CCDS94132, CCDS94133, CCDS94134
Canonical transcript exons
ENST00000422959 — 19 exons
| Exon | Start | End |
|---|---|---|
| ENSE00000698133 | 77900711 | 77900780 |
| ENSE00000698225 | 77937710 | 77937838 |
| ENSE00000877019 | 77901762 | 77901920 |
| ENSE00000877026 | 77940528 | 77940659 |
| ENSE00000918860 | 77893608 | 77893664 |
| ENSE00001127284 | 77940030 | 77940302 |
| ENSE00001532681 | 77840221 | 77840300 |
| ENSE00001816675 | 77798773 | 77798971 |
| ENSE00001936525 | 77954858 | 77957225 |
| ENSE00002485682 | 77893982 | 77893993 |
| ENSE00003542745 | 77953769 | 77953894 |
| ENSE00003543678 | 77922623 | 77922778 |
| ENSE00003562534 | 77908793 | 77908958 |
| ENSE00003570885 | 77951617 | 77951712 |
| ENSE00003586568 | 77949678 | 77949833 |
| ENSE00003590903 | 77920279 | 77920465 |
| ENSE00003610428 | 77929109 | 77929327 |
| ENSE00003642422 | 77942700 | 77942786 |
| ENSE00003690241 | 77910245 | 77910409 |
Expression profiles
Bgee: expression breadth ubiquitous, 289 present calls, max score 99.13.
FANTOM5 (CAGE): breadth ubiquitous, TPM avg 20.2534 / max 227.7866, expressed in 1802 samples.
FANTOM5 promoters (6 alternative TSS)
| Promoter ID | TPM avg | Samples expressed |
|---|---|---|
| 79223 | 10.2439 | 1746 |
| 79222 | 8.2903 | 1627 |
| 79224 | 0.8101 | 506 |
| 79226 | 0.3725 | 188 |
| 79225 | 0.2963 | 121 |
| 79227 | 0.2403 | 35 |
Top tissues by expression
295 total, by Bgee expression score (0-100, higher = more expressed):
| Tissue | Anatomy ID | Expression score | Quality |
|---|---|---|---|
| tibia | UBERON:0000979 | 99.13 | gold quality |
| skeletal muscle tissue of rectus abdominis | UBERON:0004511 | 98.88 | gold quality |
| biceps brachii | UBERON:0001507 | 98.77 | gold quality |
| skeletal muscle tissue of biceps brachii | UBERON:0004502 | 98.46 | gold quality |
| triceps brachii | UBERON:0001509 | 97.82 | gold quality |
| gluteal muscle | UBERON:0002000 | 97.79 | gold quality |
| diaphragm | UBERON:0001103 | 97.77 | gold quality |
| amniotic fluid | UBERON:0000173 | 97.45 | gold quality |
| skeletal muscle tissue | UBERON:0001134 | 97.41 | gold quality |
| vastus lateralis | UBERON:0001379 | 97.34 | gold quality |
| deltoid | UBERON:0001476 | 96.96 | gold quality |
| quadriceps femoris | UBERON:0001377 | 96.86 | gold quality |
| muscle organ | UBERON:0001630 | 95.36 | gold quality |
| skeletal muscle organ | UBERON:0014892 | 95.36 | gold quality |
| tendon of biceps brachii | UBERON:0008188 | 95.26 | gold quality |
| tibialis anterior | UBERON:0001385 | 95.23 | gold quality |
| body of tongue | UBERON:0011876 | 95.16 | gold quality |
| cartilage tissue | UBERON:0002418 | 95.14 | gold quality |
| muscle tissue | UBERON:0002385 | 94.86 | gold quality |
| parietal pleura | UBERON:0002400 | 94.64 | gold quality |
| muscle of leg | UBERON:0001383 | 94.62 | gold quality |
| gastrocnemius | UBERON:0001388 | 94.52 | gold quality |
| hindlimb stylopod muscle | UBERON:0004252 | 94.41 | gold quality |
| visceral pleura | UBERON:0002401 | 94.35 | gold quality |
| pleura | UBERON:0000977 | 94.18 | gold quality |
| germinal epithelium of ovary | UBERON:0001304 | 93.44 | gold quality |
| primordial germ cell in gonad | CL:0000670 ∩ UBERON:0000991 | 93.22 | gold quality |
| tongue | UBERON:0001723 | 92.92 | gold quality |
| secondary oocyte | CL:0000655 | 92.86 | gold quality |
| endothelial cell | CL:0000115 | 92.75 | silver quality |
Single-cell (SCXA)
Detected in 3 experiment(s), a significant marker in 3.
| Experiment | Marker? | Max mean expression |
|---|---|---|
| E-CURD-89 | yes | 664.39 |
| E-GEOD-83139 | yes | 8.44 |
| E-ANND-3 | yes | 5.66 |
Regulation
Is transcription factor: no
miRNA regulators (miRDB)
202 targeting PHTF2, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):
| miRNA | Max score | Avg score | miRNA target_count |
|---|---|---|---|
| HSA-MIR-30A-5P | 100.00 | 76.31 | 3233 |
| HSA-MIR-30B-5P | 100.00 | 76.29 | 3248 |
| HSA-MIR-30C-5P | 100.00 | 76.29 | 3248 |
| HSA-MIR-30D-5P | 100.00 | 76.32 | 3233 |
| HSA-MIR-30E-5P | 100.00 | 76.32 | 3242 |
| HSA-MIR-340-5P | 100.00 | 72.50 | 4437 |
| HSA-MIR-4262 | 100.00 | 73.26 | 3931 |
| HSA-MIR-200B-3P | 100.00 | 73.31 | 2693 |
| HSA-MIR-200C-3P | 100.00 | 73.35 | 2685 |
| HSA-MIR-429 | 100.00 | 73.44 | 2698 |
| HSA-MIR-3613-3P | 100.00 | 76.36 | 7965 |
| HSA-MIR-3163 | 100.00 | 77.23 | 8605 |
| HSA-MIR-4692 | 100.00 | 67.32 | 2066 |
| HSA-MIR-5692A | 100.00 | 74.40 | 6850 |
| HSA-MIR-656-3P | 100.00 | 72.15 | 2788 |
| HSA-MIR-1277-5P | 100.00 | 73.95 | 5056 |
| HSA-MIR-190A-3P | 100.00 | 80.35 | 5520 |
| HSA-MIR-371B-5P | 99.99 | 75.34 | 4759 |
| HSA-MIR-181A-5P | 99.99 | 72.96 | 2995 |
| HSA-MIR-181B-5P | 99.99 | 72.97 | 2996 |
| HSA-MIR-181C-5P | 99.99 | 72.95 | 2996 |
| HSA-MIR-181D-5P | 99.99 | 73.04 | 2997 |
| HSA-MIR-4534 | 99.99 | 66.58 | 1907 |
| HSA-MIR-548C-3P | 99.99 | 74.01 | 7587 |
| HSA-MIR-4514 | 99.99 | 67.10 | 1870 |
| HSA-MIR-4282 | 99.99 | 75.36 | 6408 |
| HSA-MIR-548AW | 99.99 | 72.57 | 3559 |
| HSA-MIR-186-5P | 99.99 | 70.83 | 3707 |
| HSA-MIR-373-5P | 99.98 | 75.36 | 4753 |
| HSA-MIR-616-5P | 99.98 | 75.58 | 4775 |
Cross-species orthologs
4 orthologs
| Organism | Symbol | Gene ID |
|---|---|---|
| danio_rerio | phtf2 | ENSDARG00000102123 |
| mus_musculus | Phtf2 | ENSMUSG00000039987 |
| rattus_norvegicus | Phtf2 | ENSRNOG00000013517 |
| drosophila_melanogaster | phtf | FBGN0028579 |
Paralogs (1): PHTF1 (ENSG00000116793)
Protein
Protein identifiers
Protein PHTF2 — Q8N3S3 (reviewed: Q8N3S3)
All UniProt accessions (1): Q8N3S3
UniProt curated annotations — full annotation on UniProt →
Subcellular location. Membrane.
Isoforms (7)
| UniProt ID | Names | Canonical? |
|---|---|---|
| Q8N3S3-1 | 1 | yes |
| Q8N3S3-2 | 2 | |
| Q8N3S3-3 | 3 | |
| Q8N3S3-4 | 4 | |
| Q8N3S3-5 | 5 | |
| Q8N3S3-6 | 6 | |
| Q8N3S3-7 | 7 |
RefSeq proteins (17): NP_001120829, NP_001120830, NP_001120831, NP_001120832, NP_001353010, NP_001353011, NP_001353012, NP_001353013, NP_001353014, NP_001353015, NP_001353016, NP_001353017, NP_001353018, NP_001382199, NP_001382200, NP_001382201, NP_065165 (=MANE)
Domains & families (InterPro)
| ID | Name | Type |
|---|---|---|
| IPR021980 | PHTF1/2_N | Domain |
| IPR039775 | PHTF1/2 | Family |
Pfam: PF12129
UniProt features (31 total): transmembrane region 7, compositionally biased region 7, splice variant 7, glycosylation site 3, sequence conflict 3, region of interest 2, chain 1, domain 1
Structure
Experimental structures (PDB)
0 structures.
Predicted structure (AlphaFold)
| Model | pLDDT | Fraction very-high |
|---|---|---|
| AF-Q8N3S3-F1 | 60.23 | 0.07 |
Functional residue map
Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.
Glycosylation sites (3): 329, 697, 756
Function
Pathways and Gene Ontology
Reactome pathways
0 pathways
MSigDB gene sets: 374 (showing top):
GSE18804_SPLEEN_MACROPHAGE_VS_COLON_TUMORAL_MACROPHAGE_DN, RODRIGUES_THYROID_CARCINOMA_POORLY_DIFFERENTIATED_UP, TGCACTT_MIR519C_MIR519B_MIR519A, AAGCCAT_MIR135A_MIR135B, TACAATC_MIR508, BILD_E2F3_ONCOGENIC_SIGNATURE, FOXJ2_01, ATTACAT_MIR3803P, HFH4_01, GENTILE_UV_HIGH_DOSE_DN, HFH3_01, TCCAGAT_MIR5165P, FREAC4_01, TGTTTAC_MIR30A5P_MIR30C_MIR30D_MIR30B_MIR30E5P, FISCHER_DREAM_TARGETS
GO Biological Process (0):
GO Molecular Function (0):
GO Cellular Component (2): endoplasmic reticulum (GO:0005783), membrane (GO:0016020)
GO top-level categories
Rollup of top GO terms by namespace:
| Category | Terms |
|---|---|
| cytoplasm | 1 |
| endomembrane system | 1 |
| intracellular membrane-bounded organelle | 1 |
| cellular anatomical structure | 1 |
Protein interactions and networks
STRING
1378 interactions, top by confidence (×1000):
| Protein A | Protein B | Partner UniProt | Score |
|---|---|---|---|
| PHTF2 | POLR3D | P05423 | 443 |
| PHTF2 | TMEM60 | Q9H2L4 | 433 |
| PHTF2 | FUNDC2 | Q9BWH2 | 411 |
| PHTF2 | SHPRH | Q149N8 | 406 |
| PHTF2 | OTOP1 | Q7RTM1 | 395 |
| PHTF2 | CLMP | Q9H6B4 | 394 |
| PHTF2 | ARID3B | Q8IVW6 | 385 |
| PHTF2 | ZFYVE26 | Q68DK2 | 384 |
| PHTF2 | YOD1 | Q5VVQ6 | 361 |
| PHTF2 | ZNF41 | P51814 | 360 |
| PHTF2 | ZNF846 | Q147U1 | 358 |
| PHTF2 | LRRIQ4 | A6NIV6 | 355 |
| PHTF2 | AIRIM | Q9NX04 | 348 |
| PHTF2 | CFAP95 | Q5VTT2 | 348 |
| PHTF2 | SLC35D4 | Q24JQ0 | 347 |
IntAct
17 interactions, top by confidence:
| A | B | Type | Score |
|---|---|---|---|
| CSNK2B | NMT2 | psi-mi:“MI:0914”(association) | 0.660 |
| GPR156 | PLD2 | psi-mi:“MI:0914”(association) | 0.640 |
| B3GAT3 | GOLIM4 | psi-mi:“MI:0914”(association) | 0.640 |
| LYPD3 | SCAMP1 | psi-mi:“MI:0914”(association) | 0.640 |
| PHTF2 | DHRS2 | psi-mi:“MI:0915”(physical association) | 0.400 |
| TTYH1 | TMEM223 | psi-mi:“MI:0914”(association) | 0.350 |
| LYPD3 | TNPO2 | psi-mi:“MI:0914”(association) | 0.350 |
| PHTF2 | STXBP1 | psi-mi:“MI:0914”(association) | 0.350 |
| PHTF2 | OSBPL3 | psi-mi:“MI:0914”(association) | 0.350 |
| CXCR4 | ESYT2 | psi-mi:“MI:0914”(association) | 0.350 |
| FBXW11 | HNRNPDL | psi-mi:“MI:0914”(association) | 0.350 |
| PACC1 | IPO5 | psi-mi:“MI:0914”(association) | 0.350 |
| SSMEM1 | psi-mi:“MI:0914”(association) | 0.350 | |
| SLC27A6 | NBAS | psi-mi:“MI:0914”(association) | 0.350 |
| PHTF2 | uxuA | psi-mi:“MI:0915”(physical association) | 0.000 |
| PHTF2 | psi-mi:“MI:0915”(physical association) | 0.000 |
BioGRID (21): PHTF2 (Affinity Capture-MS), PHTF2 (Affinity Capture-MS), PHTF2 (Affinity Capture-MS), PHTF2 (Affinity Capture-RNA), PHTF2 (Affinity Capture-RNA), PHTF2 (Proximity Label-MS), OSBPL6 (Affinity Capture-MS), PHTF2 (Affinity Capture-MS), STXBP2 (Affinity Capture-MS), STXBP1 (Affinity Capture-MS), OSBPL3 (Affinity Capture-MS), VAPA (Affinity Capture-MS), PHTF1 (Affinity Capture-MS), PHTF2 (Affinity Capture-MS), PHTF2 (Affinity Capture-MS)
ESM2 similar proteins: A0JPH4, A3KFU9, A6H7H1, A7UA95, B9U3F2, D3ZWZ9, D4A6L0, E1BBQ2, F1M8G0, O15040, O54828, O75129, O88974, P49805, P97260, Q00M95, Q12770, Q13370, Q14432, Q15047, Q3B7M3, Q3B7T1, Q4ZIN3, Q5MNU5, Q5R9R1, Q5T848, Q5VW38, Q5ZKN3, Q61409, Q62865, Q63085, Q6A0A9, Q6F6B3, Q6GQV7, Q6L8S8, Q6P6V6, Q6PJF5, Q80WQ6, Q80Z10, Q86XL3
Diamond homologs: F1M8G0, Q08DA4, Q5ZKN3, Q8CB19, Q8N3S3, Q9QZ09, Q9UMS5, Q9V9A8
SIGNOR signaling
0 interactions.
Disease & clinical
Clinical variants and AI predictions
ClinVar
124 variants total. Per-class counts are floors (≥ shown; pagination cap):
| Classification | Count (floor) |
|---|---|
| Pathogenic | 0 |
| Likely pathogenic | 0 |
| Uncertain significance | 85 |
| Likely benign | 5 |
| Benign | 0 |
Top pathogenic / likely-pathogenic (0)
SpliceAI
3221 predictions. Top by Δscore:
| Variant | Effect | Δscore |
|---|---|---|
| 7:77840216:CACAG:C | acceptor_loss | 1.0000 |
| 7:77840217:A:AG | acceptor_gain | 1.0000 |
| 7:77840218:C:G | acceptor_gain | 1.0000 |
| 7:77840218:CAGC:C | acceptor_loss | 1.0000 |
| 7:77840219:A:AG | acceptor_gain | 1.0000 |
| 7:77840220:G:GG | acceptor_gain | 1.0000 |
| 7:77840220:GCC:G | acceptor_gain | 1.0000 |
| 7:77840220:GCCT:G | acceptor_gain | 1.0000 |
| 7:77840220:GCCTA:G | acceptor_gain | 1.0000 |
| 7:77840297:GAAG:G | donor_gain | 1.0000 |
| 7:77840298:AAGG:A | donor_loss | 1.0000 |
| 7:77840300:GGTA:G | donor_loss | 1.0000 |
| 7:77840301:G:GG | donor_gain | 1.0000 |
| 7:77840301:GTA:G | donor_loss | 1.0000 |
| 7:77840302:T:G | donor_loss | 1.0000 |
| 7:77893602:TCATA:T | acceptor_loss | 1.0000 |
| 7:77893605:T:G | acceptor_gain | 1.0000 |
| 7:77893605:TAG:T | acceptor_loss | 1.0000 |
| 7:77893606:A:AG | acceptor_gain | 1.0000 |
| 7:77893606:AGAT:A | acceptor_loss | 1.0000 |
| 7:77893606:AGATT:A | acceptor_gain | 1.0000 |
| 7:77893607:G:GG | acceptor_gain | 1.0000 |
| 7:77893607:GA:G | acceptor_gain | 1.0000 |
| 7:77893607:GATT:G | acceptor_gain | 1.0000 |
| 7:77893607:GATTG:G | acceptor_gain | 1.0000 |
| 7:77893661:CAAGG:C | donor_loss | 1.0000 |
| 7:77893663:AG:A | donor_gain | 1.0000 |
| 7:77893663:AGGTA:A | donor_loss | 1.0000 |
| 7:77893664:GG:G | donor_gain | 1.0000 |
| 7:77893664:GGTAA:G | donor_loss | 1.0000 |
AlphaMissense
4909 scored. Top likely-pathogenic:
| Variant | Protein change | am_pathogenicity |
|---|---|---|
| 7:77893632:T:A | W58R | 1.000 |
| 7:77893632:T:C | W58R | 1.000 |
| 7:77893634:G:C | W58C | 1.000 |
| 7:77893634:G:T | W58C | 1.000 |
| 7:77900772:T:C | L93P | 1.000 |
| 7:77901770:T:C | F99L | 1.000 |
| 7:77901772:T:A | F99L | 1.000 |
| 7:77901772:T:G | F99L | 1.000 |
| 7:77901818:G:A | G115R | 1.000 |
| 7:77901818:G:C | G115R | 1.000 |
| 7:77901819:G:A | G115E | 1.000 |
| 7:77908885:G:A | G180R | 1.000 |
| 7:77908885:G:C | G180R | 1.000 |
| 7:77937762:C:A | A464D | 1.000 |
| 7:77937770:T:A | W467R | 1.000 |
| 7:77937770:T:C | W467R | 1.000 |
| 7:77937771:G:C | W467S | 1.000 |
| 7:77937772:G:C | W467C | 1.000 |
| 7:77937772:G:T | W467C | 1.000 |
| 7:77937828:T:A | I486K | 1.000 |
| 7:77937828:T:G | I486R | 1.000 |
| 7:77940549:T:C | F588L | 1.000 |
| 7:77940551:T:A | F588L | 1.000 |
| 7:77940551:T:G | F588L | 1.000 |
| 7:77940564:T:C | S593P | 1.000 |
| 7:77940571:G:T | R595M | 1.000 |
| 7:77940572:G:C | R595S | 1.000 |
| 7:77940572:G:T | R595S | 1.000 |
| 7:77940576:G:C | A597P | 1.000 |
| 7:77940577:C:A | A597D | 1.000 |
dbSNP variants (sampled 300 via entrez): RS1000012720 (7:77876570 A>G), RS1000043950 (7:77916977 A>G), RS1000067081 (7:77843467 T>C), RS1000071578 (7:77867060 A>G), RS1000078084 (7:77888974 G>A,C), RS1000089989 (7:77836365 G>A), RS1000098284 (7:77948525 A>G), RS1000112619 (7:77878444 TGTAGGAGCAACTGGGGA>T,TGTAGGAGCAACTGGGGAGTAGGAGCAACTGGGGA), RS1000134253 (7:77862766 A>G), RS1000159390 (7:77886212 C>T), RS1000176592 (7:77837030 A>G), RS1000203735 (7:77930371 G>T), RS1000223176 (7:77812840 T>C), RS1000270443 (7:77863086 A>C,G), RS1000279691 (7:77834161 A>G)
Disease associations
OMIM: gene MIM:616785 | disease phenotypes:
GenCC curated gene-disease
Mondo (0):
Orphanet (0):
HPO phenotypes
0 total (0 of 0 shown, HPO-id order):
GWAS associations
25 associations (top):
| Study | Trait | p-value |
|---|---|---|
| GCST000649_15 | Chronic kidney disease | 2.000000e-09 |
| GCST001713_10 | Dental caries | 2.000000e-06 |
| GCST001762_549 | Obesity-related traits | 6.000000e-06 |
| GCST003542_193 | Night sleep phenotypes | 8.000000e-06 |
| GCST003790_25 | Glomerular filtration rate | 2.000000e-08 |
| GCST005982_3 | Calcium levels | 4.000000e-08 |
| GCST006624_55 | Systolic blood pressure | 7.000000e-13 |
| GCST007267_43 | Systolic blood pressure | 4.000000e-15 |
| GCST007269_271 | Pulse pressure | 2.000000e-11 |
| GCST007876_54 | Estimated glomerular filtration rate | 1.000000e-15 |
| GCST008059_126 | Estimated glomerular filtration rate | 5.000000e-36 |
| GCST008747_103 | Estimated glomerular filtration rate | 1.000000e-23 |
| GCST009391_1129 | Metabolite levels | 8.000000e-06 |
| GCST009391_1723 | Metabolite levels | 9.000000e-06 |
| GCST90020024_104 | A body shape index | 2.000000e-11 |
| GCST90020024_105 | A body shape index | 3.000000e-11 |
| GCST90020025_1121 | Waist-to-hip ratio adjusted for BMI | 5.000000e-15 |
| GCST90020025_1123 | Waist-to-hip ratio adjusted for BMI | 1.000000e-15 |
| GCST90020025_351 | Waist-to-hip ratio adjusted for BMI | 2.000000e-09 |
| GCST90020025_356 | Waist-to-hip ratio adjusted for BMI | 4.000000e-09 |
| GCST90020027_1403 | Waist-hip index | 4.000000e-15 |
| GCST90020027_1405 | Waist-hip index | 8.000000e-16 |
| GCST90020027_1408 | Waist-hip index | 4.000000e-09 |
| GCST90020027_1410 | Waist-hip index | 1.000000e-09 |
| GCST90020029_878 | Waist circumference adjusted for body mass index | 1.000000e-08 |
EFO canonical traits (8, from GWAS)
| EFO ID | Trait name |
|---|---|
| EFO:0003939 | energy intake |
| EFO:0004838 | calcium measurement |
| EFO:0006335 | systolic blood pressure |
| EFO:0005763 | pulse pressure measurement |
| EFO:0010456 | allantoin measurement |
| EFO:0010341 | cholesteryl ester 16:0 measurement |
| EFO:0007789 | BMI-adjusted waist circumference |
| EFO:0007788 | BMI-adjusted waist-hip ratio |
Drugs & pharmacology
Drug and pharmacology data
Is drug target: no
PharmGKB: 1 entry (VIP=true, CPIC=false)
CTD chemical–gene interactions
57 total (human), top 30 by PubMed support.
| Chemical | Actions (top 5) | PubMed papers |
|---|---|---|
| Valproic Acid | affects cotreatment, decreases expression | 7 |
| bisphenol A | affects cotreatment, decreases methylation, increases expression | 2 |
| entinostat | decreases expression, affects cotreatment | 2 |
| Resveratrol | affects cotreatment, increases expression | 2 |
| Benzo(a)pyrene | increases methylation, increases expression | 2 |
| Phenylmercuric Acetate | affects cotreatment, decreases expression | 2 |
| Testosterone | affects cotreatment, decreases expression | 2 |
| Aflatoxin B1 | decreases methylation, increases methylation | 2 |
| aristolochic acid I | decreases expression | 1 |
| FR900359 | affects phosphorylation | 1 |
| dicrotophos | decreases expression | 1 |
| geldanamycin | increases expression | 1 |
| methylmercuric chloride | decreases expression, increases expression | 1 |
| triphenyl phosphate | affects expression | 1 |
| trichostatin A | decreases expression | 1 |
| arsenite | affects binding, decreases reaction | 1 |
| mono-(2-ethylhexyl)phthalate | decreases expression | 1 |
| tris(1,3-dichloro-2-propyl)phosphate | decreases expression | 1 |
| cobaltous chloride | decreases expression | 1 |
| pentanal | decreases expression | 1 |
| avobenzone | increases expression | 1 |
| CGP 52608 | affects binding, increases reaction | 1 |
| monomethylarsonous acid | increases expression | 1 |
| motexafin gadolinium | affects reaction, increases expression | 1 |
| 4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide | affects cotreatment, decreases expression | 1 |
| ICG 001 | decreases expression | 1 |
| Grape Seed Proanthocyanidins | decreases expression, affects cotreatment | 1 |
| dorsomorphin | affects cotreatment, decreases expression | 1 |
| jinfukang | decreases expression | 1 |
| 4-(4-((5-(4,5-dimethyl-2-nitrophenyl)-2-furanyl)methylene)-4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)benzoic acid | decreases expression | 1 |
Clinical trials (associated diseases)
0 trials via MONDO — disease-level, not drug-specific.
Related Atlas pages
- Disease cohort memberships (association, not causation — diseases whose associated-gene cohort lists this gene; a subset are also under Associated diseases): chronic kidney disease, dental caries