PICSAR

Summary

PICSAR (P38 inhibited cutaneous squamous cell carcinoma associated lincRNA, HGNC:19725) is a long non-coding RNA gene on chromosome 21q22.3.

At a glance

• Gene type: non-coding (lncRNA) — no protein product.
• GTEx eGene: eQTL in 19 tissues, sQTL in 1 (q < 0.05)

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:19725
Approved symbol	PICSAR
Name	P38 inhibited cutaneous squamous cell carcinoma associated lincRNA
Location	21q22.3
Locus type	RNA, long non-coding
Status	Approved
Aliases	NLC1-C, PRED74, lnc-NLC1-C
Ensembl gene	ENSG00000275874
Ensembl biotype	lncRNA
OMIM	617191
Entrez	378825
RNAcentral	URS000075EA8F — lncRNA, 749 nt, 1 organism(s)

Gene structure

Transcript identifiers

Ensembl transcripts: 9 — 9 lncRNA

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 1

ENST00000615826, ENST00000758108, ENST00000758109, ENST00000758110, ENST00000758111, ENST00000758112, ENST00000758113, ENST00000758114, ENST00000758115

RefSeq mRNA: 0

Canonical transcript exons

ENST00000615826 — 2 exons

Exon	Start	End
ENSE00004109850	44999140	44999656
ENSE00004109852	45004444	45004753

Expression profiles

Bgee: expression breadth ubiquitous, 124 present calls, max score 74.77.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 0.5864 / max 54.2742, expressed in 113 samples.

Highest expression (Bgee): C1 segment of cervical spinal cord, skin of leg, skin of abdomen, spinal cord, lung.

Genetic regulation across tissues (GTEx eQTL / sQTL)

PICSAR is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 19 tissues and its splicing (sQTL) in 1 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

20 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Adipose Visceral Omentum	eqtl	2.3e-20	-0.53	21:45008193:C:G
Testis	eqtl	1.4e-17	-0.62	21:45008193:C:G
Spleen	eqtl	2.7e-14	-0.84	21:45008193:C:G
Brain Spinal cord cervical c-1	eqtl	4.2e-14	-0.92	21:45008433:C:A
Lung	eqtl	2.8e-13	-0.39	21:44997056:A:G
Brain Substantia nigra	eqtl	3.9e-11	-0.88	21:45008193:C:G
Brain Caudate basal ganglia	eqtl	5.8e-08	-0.47	21:45004654:C:T
Skin Sun Exposed Lower leg	eqtl	6.8e-07	-0.26	21:45018967:C:G
Brain Hypothalamus	eqtl	9.1e-07	-0.53	21:45008433:C:A
Brain Putamen basal ganglia	eqtl	1.4e-06	-0.50	21:45004654:C:T
Artery Tibial	eqtl	1.7e-06	-0.31	21:45008046:C:T
Esophagus Muscularis	eqtl	2.2e-06	+0.29	21:45043170:C:T
Skin Not Sun Exposed Suprapubic	eqtl	3.7e-06	-0.28	21:45018967:C:G
Artery Aorta	eqtl	7.7e-06	-0.38	21:45008046:C:T
Brain Hippocampus	eqtl	7.7e-06	-0.53	21:45008193:C:G
Esophagus Mucosa	eqtl	3.8e-05	+0.35	21:45000840:C:A
Artery Coronary	eqtl	5.8e-05	-0.46	21:45008193:C:G
Breast Mammary Tissue	eqtl	2.3e-03	-0.18	21:44990923:T:C
Artery Aorta	sqtl	3.1e-02	-1.04	21:44997153:TGGGGAGGAAGGTGGGTACCCC:T
Brain Nucleus accumbens basal ganglia	eqtl	4.9e-02	-0.31	21:45000109:C:T

FANTOM5 promoters

4 alternative TSS:

Promoter ID	TPM avg	Samples expressed
190815	0.3047	83
190813	0.1210	51
190814	0.0984	49
190816	0.0623	36

Top tissues by expression

showing 100 of 219 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
C1 segment of cervical spinal cord	UBERON:0006469	74.77	gold quality
skin of leg	UBERON:0001511	73.03	gold quality
skin of abdomen	UBERON:0001416	72.43	gold quality
spinal cord	UBERON:0002240	71.66	gold quality
right lung	UBERON:0002167	70.14	gold quality
zone of skin	UBERON:0000014	69.00	gold quality
left testis	UBERON:0004533	66.80	gold quality
descending thoracic aorta	UBERON:0002345	66.07	gold quality
popliteal artery	UBERON:0002250	65.60	gold quality
tibial artery	UBERON:0007610	65.56	gold quality
aorta	UBERON:0000947	65.33	gold quality
thoracic aorta	UBERON:0001515	65.30	gold quality
ascending aorta	UBERON:0001496	65.18	gold quality
testis	UBERON:0000473	64.14	gold quality
left coronary artery	UBERON:0001626	63.76	gold quality
mucosa of stomach	UBERON:0001199	63.24	gold quality
lower esophagus	UBERON:0013473	62.93	gold quality
upper lobe of left lung	UBERON:0008952	62.92	gold quality
lower esophagus muscularis layer	UBERON:0035833	62.89	gold quality
right coronary artery	UBERON:0001625	62.78	gold quality
coronary artery	UBERON:0001621	62.28	gold quality
right testis	UBERON:0004534	61.54	gold quality
upper lobe of lung	UBERON:0008948	61.08	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	60.56	gold quality
calcaneal tendon	UBERON:0003701	57.08	gold quality
gall bladder	UBERON:0002110	56.89	gold quality
hindlimb stylopod muscle	UBERON:0004252	56.88	gold quality
esophagus	UBERON:0001043	56.42	gold quality
left uterine tube	UBERON:0001303	56.22	gold quality
lung	UBERON:0002048	55.51	gold quality
omental fat pad	UBERON:0010414	55.48	gold quality
peritoneum	UBERON:0002358	55.42	gold quality
prefrontal cortex	UBERON:0000451	54.78	gold quality
adipose tissue of abdominal region	UBERON:0007808	54.33	gold quality
substantia nigra	UBERON:0002038	53.61	gold quality
Brodmann (1909) area 9	UBERON:0013540	53.47	gold quality
corpus callosum	UBERON:0002336	53.34	gold quality
vermiform appendix	UBERON:0001154	52.97	gold quality
anatomical system	UBERON:0000467	52.44	gold quality
minor salivary gland	UBERON:0001830	52.24	gold quality
multicellular organism	UBERON:0000468	52.05	gold quality
material anatomical entity	UBERON:0000465	52.03	gold quality
midbrain	UBERON:0001891	51.86	gold quality
muscle of leg	UBERON:0001383	50.72	gold quality
mouth mucosa	UBERON:0003729	50.54	gold quality
saliva-secreting gland	UBERON:0001044	50.44	gold quality
hypothalamus	UBERON:0001898	50.28	gold quality
skin of hip	UBERON:0001554	50.23	silver quality
heart	UBERON:0000948	49.96	gold quality
gastrocnemius	UBERON:0001388	49.76	gold quality
islet of Langerhans	UBERON:0000006	49.47	gold quality
esophagus mucosa	UBERON:0002469	49.19	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	49.18	gold quality
tendon	UBERON:0000043	49.08	gold quality
right atrium auricular region	UBERON:0006631	48.81	gold quality
caecum	UBERON:0001153	48.23	gold quality
cardiac atrium	UBERON:0002081	48.18	gold quality
monocyte	CL:0000576	48.01	silver quality
caudate nucleus	UBERON:0001873	47.75	gold quality
right ovary	UBERON:0002118	47.42	gold quality
Ammon’s horn	UBERON:0001954	47.39	gold quality
anterior cingulate cortex	UBERON:0009835	47.10	gold quality
adipose tissue	UBERON:0001013	46.91	gold quality
body of stomach	UBERON:0001161	46.78	gold quality
muscle layer of sigmoid colon	UBERON:0035805	46.66	gold quality
stomach	UBERON:0000945	46.64	gold quality
ectocervix	UBERON:0012249	46.42	gold quality
urinary bladder	UBERON:0001255	46.14	gold quality
frontal cortex	UBERON:0001870	45.40	gold quality
transverse colon	UBERON:0001157	45.35	gold quality
brain	UBERON:0000955	45.34	gold quality
mucosa of transverse colon	UBERON:0004991	45.25	gold quality
neocortex	UBERON:0001950	45.24	gold quality
fundus of stomach	UBERON:0001160	45.11	gold quality
left ovary	UBERON:0002119	45.02	gold quality
endocervix	UBERON:0000458	45.00	gold quality
nucleus accumbens	UBERON:0001882	44.94	gold quality
forebrain	UBERON:0001890	44.90	gold quality
pancreas	UBERON:0001264	44.81	silver quality
colon	UBERON:0001155	44.80	gold quality
uterine cervix	UBERON:0000002	44.72	gold quality
sperm	CL:0000019	44.55	gold quality
cerebellar cortex	UBERON:0002129	44.54	silver quality
cerebellar hemisphere	UBERON:0002245	44.53	silver quality
large intestine	UBERON:0000059	44.49	gold quality
amygdala	UBERON:0001876	44.49	gold quality
cerebral cortex	UBERON:0000956	44.45	gold quality
heart left ventricle	UBERON:0002084	44.29	gold quality
spleen	UBERON:0002106	44.23	silver quality
subcutaneous adipose tissue	UBERON:0002190	43.99	gold quality
right hemisphere of cerebellum	UBERON:0014890	43.98	silver quality
vagina	UBERON:0000996	43.94	gold quality
putamen	UBERON:0001874	43.91	gold quality
cardiac ventricle	UBERON:0002082	43.59	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	43.41	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	43.37	gold quality
small intestine	UBERON:0002108	43.20	gold quality
blood	UBERON:0000178	42.79	gold quality
placenta	UBERON:0001987	42.77	gold quality
tonsil	UBERON:0002372	42.73	silver quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	1.96

Regulation

Is transcription factor: no

Literature-anchored findings (GeneRIF, showing 8)

• The accumulation of NLC1-C in the nucleus repressed miR-320a and miR-383 transcript and promoted testicular embryonal carcinoma cell proliferation by binding to Nucleolin. (PMID:26539909)
• PICSAR has a role in promoting cSCC progression via activation of extracellular signal-regulated kinase 1/2 signaling pathway by downregulating DUSP6 expression (PMID:27049681)
• LINC00162 overexpression increased the sensitivity, enhanced cell cycle arrest and apoptosis induced by 5-aza-dC, but did not affect its DNA demethylation effect. Mechanistically, LINC00162 interacted with an RNA splicing protein, HNRNPH1, and decreased splicing of an anti-apoptotic splicing variant, BCL-XL. LINC00162 may have translational value to predict patients who will respond to 5-aza-dC. (PMID:30914798)
• Our results reveal PICSAR may exert an essential role in promoting synovial invasion and joint destruction by sponging miR-4701-5p in RA and that lncRNA PICSAR may act as a biomarker of RA. (PMID:31791845)
• Long non-coding RNA PICSAR knockdown inhibits the progression of cutaneous squamous cell carcinoma by regulating miR-125b/YAP1 axis. (PMID:32841663)
• LncRNA PICSAR binds to miR-485-5p and activates TGF-beta1/Smad to promote abnormal proliferation of hypertrophic scar fibroblasts (HSFs) and excessive deposition of extracellular matrix (ECM). (PMID:34255190)
• LINC00162 regulates cell proliferation and apoptosis by sponging PAQR4-targeting miR-485-5p. (PMID:35491694)
• Long Intergenic Non-Coding 00162 as Diagnostic Biomarker for Early-Stage Pancreatic Cancer. (PMID:36197769)

Cross-species orthologs

0 orthologs

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
LINC00334	ncRNA	114042
POFUT2	protein-coding	23275
ADARB1	protein-coding	104
LINC00165	ncRNA	727701
LINC00163	ncRNA	727699
ITGB2-AS1	ncRNA	100505746
ITGB2	protein-coding	3689
LINC01547	ncRNA	84536
SLX9	protein-coding	85395

Protein

Non-coding RNA — no protein product.

Function

Gene-set membership (MSigDB)

This non-coding RNA is a member of 7 curated MSigDB gene sets — regulatory-target and signature collections that include it (it has no protein-based pathway / GO / interaction data).

chr21q22, HMGA1_TARGET_GENES, TFEB_TARGET_GENES, GSE13485_CTRL_VS_DAY1_YF17D_VACCINE_PBMC_DN, ZNF320_TARGET_GENES, GSE26928_EFF_MEM_VS_CENTR_MEM_CD4_TCELL_DN, GSE16385_IFNG_TNF_VS_ROSIGLITAZONE_STIM_MACROPHAGE_DN

ncRNA interactions

Experimentally supported non-coding-RNA interaction partners (NPInter).

showing 8 of 14 interaction partners:

Partner	Partner type	Level	Source
LINC00162	lncRNA	RNA-Protein	GSE111188
ICP27	protein	RNA-Protein	High-throughput data
EWSR1	protein	RNA-Protein	High-throughput data
IGF2BP3	protein	RNA-Protein	High-throughput data
IGF2BP1	protein	RNA-Protein	High-throughput data
DHX36	protein	RNA-Protein	High-throughput data
miR-125b	miRNA	RNA-RNA	Literature mining
miR-485-5p	miRNA	RNA-RNA	Literature mining

Disease & clinical

ncRNA disease associations

Curated non-coding-RNA → disease associations (LncRNADisease, HMDD) — these are RNA-level associations for this gene, not the positional variant data omitted above.

6 ncRNA–disease associations:

Disease	Causal?	Validated by
Carcinoma, Hepatocellular	Yes	IHC, Western Blot, Flow Cytometry, qRT-PCR, RIP, Luciferase Report Assay, Colony Formation Assay, EdU Staining
Skin Neoplasms	No	qRT-PCR
Glioma	Yes	Western Blot, Transfection, Migration Assay, qRT-PCR, Cell Proliferation Assay, Cell Cycle Assay, Invasion Assay
Urinary Bladder Neoplasms	Yes	Flow Cytometry, qRT-PCR, RNA Pull-Down, RIP
pancreatic ductal adenocarcinoma	Yes	qRT-PCR, RNA-seq
Skin Neoplasms	Yes	Western Blot, CCK8, qRT-PCR, Flow Cytometry, RIP, Luciferase Report Assay, Transwell Assay

Drugs & pharmacology

ncRNA–drug associations

Curated non-coding-RNA → drug associations (drug response / resistance / target).

2 ncRNA–drug associations:

Drug	Relation	Effect	Condition
Decitabine	drug_resistance	sensitive	“cell line (HSC41, HSC44)”
Temozolomide	drug_resistance	sensitive	cell line (U251)