PIGK

Summary

PIGK (phosphatidylinositol glycan anchor biosynthesis class K, HGNC:8965) is a protein-coding gene on chromosome 1p31.1, encoding GPI-anchor transamidase (Q92643). Catalytic subunit of the glycosylphosphatidylinositol-anchor (GPI-anchor) transamidase (GPI-T) complex that catalyzes the formation of the linkage between a proprotein and a GPI-anchor and participates in GPI anchored protein biosynthesis.

This gene encodes a member of the cysteine protease family C13 that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This protein is a member of the multisubunit enzyme, GPI transamidase and is thought to be its enzymatic component. GPI transamidase mediates GPI anchoring in the endoplasmic reticulum, by catalyzing the transfer of fully assembled GPI units to proteins.

Source: NCBI Gene 10026 — RefSeq curated summary.

At a glance

• Gene–disease (curated): neurodevelopmental disorder with hypotonia and cerebellar atrophy, with or without seizures (Strong, GenCC)
• GWAS associations: 6
• Clinical variants (ClinVar): 97 total — 9 pathogenic, 1 likely-pathogenic
• Phenotypes (HPO): 18
• Druggable target: yes
• MANE Select transcript: NM_005482

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:8965
Approved symbol	PIGK
Name	phosphatidylinositol glycan anchor biosynthesis class K
Location	1p31.1
Locus type	gene with protein product
Status	Approved
Aliases	hGPI8, GPI8, PIG-K
Ensembl gene	ENSG00000142892
Ensembl biotype	protein_coding
OMIM	605087
Entrez	10026

Gene structure

Transcript identifiers

Ensembl transcripts: 16 — 14 protein_coding, 1 protein_coding_CDS_not_defined, 1 nonsense_mediated_decay

ENST00000359130, ENST00000370812, ENST00000445065, ENST00000478391, ENST00000487906, ENST00000858228, ENST00000858229, ENST00000858230, ENST00000858231, ENST00000858232, ENST00000858233, ENST00000858234, ENST00000912752, ENST00000912753, ENST00000912754, ENST00000952588

RefSeq mRNA: 1 — MANE Select: NM_005482 NM_005482

CCDS: CCDS674

Canonical transcript exons

ENST00000370812 — 11 exons

Exon	Start	End
ENSE00001013592	77206640	77206731
ENSE00001294080	77169260	77169395
ENSE00001797334	77219310	77219430
ENSE00003466318	77210436	77210489
ENSE00003493011	77154449	77154621
ENSE00003515278	77163846	77163942
ENSE00003521937	77166719	77166830
ENSE00003544050	77161295	77161405
ENSE00003608354	77122275	77122359
ENSE00003672119	77161594	77161711
ENSE00003843855	77088989	77092490

Expression profiles

Bgee: expression breadth ubiquitous, 279 present calls, max score 94.20.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 29.8941 / max 620.4743, expressed in 1783 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
12879	29.8941	1783

Top tissues by expression

293 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
endothelial cell	CL:0000115	94.20	gold quality
calcaneal tendon	UBERON:0003701	93.51	gold quality
stromal cell of endometrium	CL:0002255	92.52	gold quality
islet of Langerhans	UBERON:0000006	91.68	gold quality
pigmented layer of retina	UBERON:0001782	91.29	gold quality
right coronary artery	UBERON:0001625	91.05	gold quality
heart right ventricle	UBERON:0002080	90.91	gold quality
nephron tubule	UBERON:0001231	90.54	gold quality
renal glomerulus	UBERON:0000074	90.33	gold quality
popliteal artery	UBERON:0002250	89.84	gold quality
tibial artery	UBERON:0007610	89.84	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	89.63	gold quality
metanephric glomerulus	UBERON:0004736	89.59	gold quality
aorta	UBERON:0000947	89.33	gold quality
descending thoracic aorta	UBERON:0002345	89.31	gold quality
left coronary artery	UBERON:0001626	89.20	gold quality
gall bladder	UBERON:0002110	89.03	gold quality
thoracic aorta	UBERON:0001515	88.78	gold quality
ascending aorta	UBERON:0001496	88.70	gold quality
coronary artery	UBERON:0001621	88.45	gold quality
choroid plexus epithelium	UBERON:0003911	88.43	gold quality
cauda epididymis	UBERON:0004360	88.30	gold quality
rectum	UBERON:0001052	88.14	gold quality
spinal cord	UBERON:0002240	87.57	gold quality
corpus callosum	UBERON:0002336	87.51	gold quality
corpus epididymis	UBERON:0004359	87.16	gold quality
tendon	UBERON:0000043	86.98	gold quality
myocardium	UBERON:0002349	86.58	gold quality
kidney epithelium	UBERON:0004819	86.54	gold quality
blood vessel layer	UBERON:0004797	86.52	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	6.54
E-MTAB-2983	no	262.09

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

152 targeting PIGK, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-3646	100.00	73.56	5283
HSA-MIR-450A-1-3P	100.00	69.33	1837
HSA-LET-7A-3P	100.00	74.03	3932
HSA-LET-7B-3P	100.00	74.08	3913
HSA-LET-7F-1-3P	100.00	74.02	3928
HSA-MIR-98-3P	100.00	74.08	3907
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-6833-3P	100.00	70.63	3197
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-4668-3P	100.00	68.74	2635
HSA-MIR-3662	99.99	73.82	5684
HSA-MIR-4282	99.99	75.36	6408
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-485-3P	99.98	70.68	1585
HSA-MIR-539-3P	99.98	70.74	1616
HSA-MIR-12136	99.98	72.81	5713
HSA-MIR-4775	99.98	75.00	6394
HSA-MIR-548P	99.98	72.25	3784
HSA-MIR-4715-3P	99.98	66.03	670
HSA-MIR-607	99.97	73.62	5593
HSA-MIR-302C-5P	99.97	72.56	3642
HSA-MIR-3148	99.97	75.06	6478
HSA-MIR-590-3P	99.96	74.34	6478
HSA-MIR-9-3P	99.96	70.88	2068
HSA-MIR-548AT-5P	99.96	70.83	2666
HSA-MIR-548AA	99.96	70.64	3753
HSA-MIR-548AP-3P	99.96	70.64	3753
HSA-MIR-548T-3P	99.96	70.64	3753

Literature-anchored findings (GeneRIF, showing 8)

• GPI8 and PIG-T form a functionally important intermolecular disulfide bridge (PMID:12582175)
• Our results demonstrate, for the first time, a link between the SNP 1048575 and low PIGK expression in CRC/HCC patients and also suggest a possible association between altered PIGK expression and disease susceptibility. (PMID:22824918)
• Report firstly demonstrated that inadequate protein-glycosylphosphatidylinositol anchoring caused by suppression of PIGK might affect the expression or function of some glycosylphosphatidylinositol-anchored proteins associated with tyrosinase activity. (PMID:27919619)
• The overexpression of wild-type (WT) PIGK in fibroblasts rescued the levels of cell surface GPI-APs. (PMID:32220290)
• Loss of PIGK function causes severe infantile encephalopathy and extensive neuronal apoptosis. (PMID:33392778)
• Subunits of the GPI transamidase complex localize to the endoplasmic reticulum and nuclear envelope in Drosophila. (PMID:33496978)
• Hrd1-dependent Degradation of the Unassembled PIGK Subunit of the GPI Transamidase Complex. (PMID:34193731)
• Functional Analysis of the GPI Transamidase Complex by Screening for Amino Acid Mutations in Each Subunit. (PMID:34576938)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	pigk	ENSDARG00000024479
mus_musculus	Pigk	ENSMUSG00000039047
rattus_norvegicus	Pigk	ENSRNOG00000042359
drosophila_melanogaster	PIG-K	FBGN0023545
caenorhabditis_elegans		WBGENE00011482

Paralogs (1): LGMN (ENSG00000100600)

Protein

Protein identifiers

GPI-anchor transamidase — Q92643 (reviewed: Q92643)

Alternative names: GPI-anchor transamidase component PIGK, catalytic subunit, GPI8 homolog, Phosphatidylinositol-glycan biosynthesis class K protein

All UniProt accessions (4): Q92643, A6NEM5, B1AK81, S4R3M5

UniProt curated annotations — full annotation on UniProt →

Function. Catalytic subunit of the glycosylphosphatidylinositol-anchor (GPI-anchor) transamidase (GPI-T) complex that catalyzes the formation of the linkage between a proprotein and a GPI-anchor and participates in GPI anchored protein biosynthesis. Recognizes diverse proproteins at a C-terminal signal peptide (CSP) region that lacks consensus sequence and replaces it with a GPI-anchor via a transamidation reaction. Transamidation catalysis reaction follows a two-phase mechanism. In the acyl-enzyme phase, the carbonyl group of the proproteins’s omega-site undergoes a nucleophilic attack forming an enzyme-substrate thioester bond. Followed by a general acid catalysis that allows CSP releasing, regenerating the carbonyl, and forming the acyl-enzyme intermediate. In the GPI-anchor attachment phase, the amino group of the GPI-anchor’s ethanolamine phosphate, the one on third mannose (EtNP3), mediates a nucleophilic attack on the carbonyl of the acyl-enzyme intermediate, replacing the CSP, allowing GPI-anchor attachment to the omega-residue, therefore forming the product and freeing the enzyme.

Subunit / interactions. Heteropentamer. Part of the GPI-anchor transamidase complex, consisting of PIGK, PIGT, PIGS, PIGU and GAA1. Interacts with GPAA1. Interacts with PIGT; this interaction, via a disulfide link, stabilizes the expression of GAA1 and PIGK and links them to PIGS.

Subcellular location. Endoplasmic reticulum membrane.

Post-translational modifications. The disulfide bond between PIGK/GPI8 and PIGT is important for normal enzyme activity.

Disease relevance. Neurodevelopmental disorder with hypotonia and cerebellar atrophy, with or without seizures (NEDHCAS) [MIM:618879] An autosomal recessive neurodevelopmental disorder characterized by global developmental delay, intellectual disability, hypotonia, cerebellar ataxia, cerebellar atrophy, delayed motor skills, poor or absent speech, and epilepsy in most patients. Some patients manifest facial dysmorphism. Disease onset is in infancy. The disease is caused by variants affecting the gene represented in this entry.

Activity regulation. In the absence of proproteins substrates, exists in an inactive state with a disrupted catalytic site by an autoinhibitory loop. The binding of proprotein substrates, particularly the CSP region, to GPI-T triggers concerted conformational changes that alleviate the inhibition by the autoinhibitory loop. Meanwhile, proprotein residues near the omega- site induce the formation of a catalytic cleft for catalysis, following which the products are released and GPI-T reverts to the inactive state.

Pathway. Glycolipid biosynthesis; glycosylphosphatidylinositol-anchor biosynthesis.

Similarity. Belongs to the peptidase C13 family.

Isoforms (2)

UniProt ID	Names	Canonical?
Q92643-1	1	yes
Q92643-2	2

RefSeq proteins (1): NP_005473* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001096	Peptidase_C13	Family
IPR028361	GPI_transamidase	Family

Pfam: PF01650

Catalyzed reactions (Rhea), 2 shown:

• a 2-acyl-6-[6-phosphoethanolamine-alpha-D-mannosyl-(1->2)-6-phosphoethanolamine-alpha-D-mannosyl-(1->6)-2-phosphoethanolamine-alpha-D-mannosyl-(1->4)-alpha-D-glucosaminyl]-1-(1-radyl,2-acyl-sn-glycero-3-phospho)-1D-myo-inositol + [protein]-C-terminal L-amino acid = [protein]-C-terminal carboxyl phosphoethanolamide-GPI(H8) + H2O (RHEA:60544)
• a 2-acyl-6-[6-phosphoethanolamine-alpha-D-mannosyl-(1->2)-alpha-D-mannosyl-(1->6)-2-phosphoethanolamine-alpha-D-mannosyl-(1->4)-alpha-D-glucosaminyl]-1-(1-radyl,2-acyl-sn-glycero-3-phospho)-1D-myo-inositol + [protein]-C-terminal L-amino acid = [protein]-C-terminal carboxyl phosphoethanolamide-GPI(H7) + H2O (RHEA:83791)

UniProt features (95 total): mutagenesis site 33, strand 16, helix 12, sequence variant 10, binding site 7, turn 5, disulfide bond 2, topological domain 2, active site 2, signal peptide 1, chain 1, splice variant 1, transmembrane region 1, region of interest 1, sequence conflict 1

Structure

Experimental structures (PDB)

4 structures.

PDB	Method	Resolution (Å)
7WLD	ELECTRON MICROSCOPY	2.53
8IMX	ELECTRON MICROSCOPY	2.85
7W72	ELECTRON MICROSCOPY	3.1
8IMY	ELECTRON MICROSCOPY	3.22

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q92643-F1	85.08	0.65

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (2): 164 (proton donor); 206 (nucleophile; acyl-thioester intermediate)

Ligand- & substrate-binding residues (7): 118; 120; 206; 232; 234; 79; 82

Disulfide bonds (2): 92, 275–280

Mutagenesis-validated functional residues (33):

Position	Phenotype
54	no effect on function in gpi-anchor attachment to protein.
58	decreased function in gpi-anchor attachment to protein. substantially decreases gpi-anchor transamidase activity.
60	decreased function in gpi-anchor attachment to protein. reduces by 25% the gpi-anchor transamidase activity.
60	reduces by 90% the gpi-anchor transamidase activity.
60	reduces by 60% the gpi-anchor transamidase activity.
60	reduces by 40% the gpi-anchor transamidase activity.
61	decreased function in gpi-anchor attachment to protein.
74	no effect on function in gpi-anchor attachment to protein.
79	no effect on function in gpi-anchor attachment to protein.
92	decreased function in gpi-anchor attachment to protein. decreases gpi-anchor transamidase activity by approximately 40%.
92	decreased function in gpi-anchor attachment to protein.
118	no effect on function in gpi-anchor attachment to protein.
120	does not affect gpi-anchor transamidase activity.
125	no effect on function in gpi-anchor attachment to protein.
129	no effect on function in gpi-anchor attachment to protein.
160	no effect on function in gpi-anchor attachment to protein.
164	loss of function in gpi-anchor attachment to protein. abolishes gpi-anchor transamidase activity.
174	no effect on function in gpi-anchor attachment to protein.
198	no effect on function in gpi-anchor attachment to protein.
204	decreased function in gpi-anchor attachment to protein.
204	reduces by 60% the gpi-anchor transamidase activity.
206	loss of function in gpi-anchor attachment to protein. abolishes gpi-anchor transamidase activity.
206	loss of function in gpi-anchor attachment to protein.
230	no effect on function in gpi-anchor attachment to protein.
231	no effect on function in gpi-anchor attachment to protein.

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-162791	Attachment of GPI anchor to uPAR

MSigDB gene sets: 213 (showing top): GOBP_PHOSPHOLIPID_METABOLIC_PROCESS, BUYTAERT_PHOTODYNAMIC_THERAPY_STRESS_DN, GOBP_PHOSPHATIDYLINOSITOL_METABOLIC_PROCESS, GOBP_GLYCOLIPID_BIOSYNTHETIC_PROCESS, GOBP_ORGANOPHOSPHATE_METABOLIC_PROCESS, GOBP_ORGANOPHOSPHATE_BIOSYNTHETIC_PROCESS, GOBP_CARBOHYDRATE_DERIVATIVE_METABOLIC_PROCESS, GOBP_PHOSPHOLIPID_BIOSYNTHETIC_PROCESS, GOBP_GLYCEROLIPID_METABOLIC_PROCESS, GOBP_PROTEIN_MATURATION, GOMF_CYSTEINE_TYPE_PEPTIDASE_ACTIVITY, GOBP_CARBOHYDRATE_DERIVATIVE_BIOSYNTHETIC_PROCESS, KEGG_GLYCOSYLPHOSPHATIDYLINOSITOL_GPI_ANCHOR_BIOSYNTHESIS, GOBP_GLYCEROLIPID_BIOSYNTHETIC_PROCESS, GOBP_GLYCEROPHOSPHOLIPID_METABOLIC_PROCESS

GO Biological Process (4): GPI anchor biosynthetic process (GO:0006506), proteolysis (GO:0006508), attachment of GPI anchor to protein (GO:0016255), GPI anchored protein biosynthesis (GO:0180046)

GO Molecular Function (7): GPI-anchor transamidase activity (GO:0003923), protein binding (GO:0005515), peptidase activity (GO:0008233), cysteine-type peptidase activity (GO:0008234), transferase activity (GO:0016740), hydrolase activity (GO:0016787), GPI anchor binding (GO:0034235)

GO Cellular Component (4): endoplasmic reticulum membrane (GO:0005789), membrane (GO:0016020), GPI-anchor transamidase complex (GO:0042765), endoplasmic reticulum (GO:0005783)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Post-translational modification: synthesis of GPI-anchored proteins	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
GPI anchored protein biosynthesis	2
protein maturation	2
catalytic activity	2
GPI anchor metabolic process	1
glycolipid biosynthetic process	1
glycerophospholipid biosynthetic process	1
protein metabolic process	1
cysteine-type endopeptidase activity	1
transferase activity, transferring nitrogenous groups	1
binding	1
hydrolase activity	1
catalytic activity, acting on a protein	1
peptidase activity	1
phospholipid binding	1
glycolipid binding	1
organelle membrane	1
nuclear outer membrane-endoplasmic reticulum membrane network	1
endoplasmic reticulum subcompartment	1
cellular anatomical structure	1
endoplasmic reticulum membrane	1
caspase complex	1
membrane protein complex	1
endoplasmic reticulum protein-containing complex	1
transferase complex	1
cytoplasm	1
endomembrane system	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

838 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
PIGK	PIGT	Q969N2	999
PIGK	GPAA1	O43292	999
PIGK	PIGU	Q9H490	978
PIGK	PIGS	Q96S52	887
PIGK	PIGL	Q9Y2B2	811
PIGK	PIGO	Q8TEQ8	807
PIGK	PIGB	Q92521	806
PIGK	PIGM	Q9H3S5	806
PIGK	PIGW	Q7Z7B1	794
PIGK	PIGV	Q9NUD9	792
PIGK	PIGA	P37287	776
PIGK	PIGC	Q92535	774
PIGK	PIGN	O95427	767
PIGK	PIGQ	Q9BRB3	765
PIGK	PIGG	Q5H8A4	765

IntAct

95 interactions, top by confidence:

A	B	Type	Score
PIGK	GPAA1	psi-mi:“MI:0914”(association)	0.860
GPAA1	PIGK	psi-mi:“MI:0914”(association)	0.860
PIGK	GPAA1	psi-mi:“MI:0915”(physical association)	0.860
PIGK	PIGT	psi-mi:“MI:0914”(association)	0.820
PIGT	PIGK	psi-mi:“MI:0914”(association)	0.820
PIGK	PIGT	psi-mi:“MI:0915”(physical association)	0.820
PIGT	GPAA1	psi-mi:“MI:0914”(association)	0.790
PIGS	GPAA1	psi-mi:“MI:0914”(association)	0.760
VAPB	FAM83G	psi-mi:“MI:0914”(association)	0.730
CFTR	ESYT2	psi-mi:“MI:2364”(proximity)	0.710
PIGS	PIGK	psi-mi:“MI:0914”(association)	0.690
B3GAT3	GOLIM4	psi-mi:“MI:0914”(association)	0.640
FBXO2	TMEM131L	psi-mi:“MI:0914”(association)	0.530

BioGRID (131): PIGK (Affinity Capture-MS), PIGK (Affinity Capture-MS), PIGK (Affinity Capture-MS), PIGT (Affinity Capture-MS), GPAA1 (Affinity Capture-MS), PIGS (Affinity Capture-MS), PIGU (Affinity Capture-MS), PIGK (Proximity Label-MS), PIGK (Affinity Capture-MS), GPAA1 (Affinity Capture-MS), PIGU (Affinity Capture-MS), PIGT (Affinity Capture-MS), PIGK (Affinity Capture-MS), PIGK (Affinity Capture-MS), PIGK (Affinity Capture-MS)

ESM2 similar proteins: B8ASK4, O24325, O24326, O64481, O89017, P08478, P09841, P10537, P10731, P10743, P12890, P14925, P16098, P19021, P25853, P42665, P49018, P49042, P49043, P49044, P49045, P49046, P49047, P49048, P50282, P82993, P93594, P97467, Q0IZZ8, Q39044, Q39119, Q4R4T8, Q5R5D9, Q5R6L8, Q765H6, Q84LM2, Q84R49, Q8GS39, Q8L7E3, Q8QGP3

Diamond homologs: B8ASK4, O24325, O24326, O89017, P09841, P42665, P49018, P49042, P49043, P49044, P49045, P49046, P49047, P49048, P80527, Q39044, Q39119, Q3MHZ7, Q4KRV1, Q4R4T8, Q5R5D9, Q5R6L8, Q84LM2, Q8GS39, Q8T4E1, Q92643, Q95M12, Q99538, Q9CXY9, Q9LJX8, Q9R0J8, Q9USP5, P80530

SIGNOR signaling

1 interactions.

A	Effect	B	Mechanism
PIGS	“up-regulates activity”	PIGK	binding

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 87 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

GO biological processes:

GO term	Partners	Fold	FDR
ERAD pathway	5	12.2×	5e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

97 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	9
Likely pathogenic	1
Uncertain significance	53
Likely benign	10
Benign	5

Top pathogenic / likely-pathogenic (10)

Variant ID	HGVS	Classification
1272073	NM_005482.3(PIGK):c.610G>C (p.Asp204His)	Pathogenic
1272074	NM_005482.3(PIGK):c.87dup (p.Ile30fs)	Pathogenic
3251832	NM_005482.3(PIGK):c.329_330insTT (p.Leu110_Asn111insTer)	Pathogenic
873117	NM_005482.3(PIGK):c.823T>C (p.Cys275Arg)	Pathogenic
873118	NM_005482.3(PIGK):c.158C>T (p.Ser53Phe)	Pathogenic
873119	NM_005482.3(PIGK):c.260C>T (p.Ala87Val)	Pathogenic
873120	NM_005482.3(PIGK):c.479A>C (p.Tyr160Ser)	Pathogenic
873121	NM_005482.3(PIGK):c.97C>T (p.Gln33Ter)	Pathogenic
873122	NM_005482.3(PIGK):c.94-1G>C	Pathogenic
3373633	NM_005482.3(PIGK):c.746A>G (p.Tyr249Cys)	Likely pathogenic

SpliceAI

2248 predictions. Top by Δscore:

Variant	Effect	Δscore
1:77122270:CAAA:C	donor_loss	1.0000
1:77122271:AAAC:A	donor_loss	1.0000
1:77122272:AACCT:A	donor_loss	1.0000
1:77122273:ACCT:A	donor_loss	1.0000
1:77122274:CC:C	donor_loss	1.0000
1:77122286:T:C	donor_gain	1.0000
1:77122355:TATAG:T	acceptor_gain	1.0000
1:77122357:TAG:T	acceptor_gain	1.0000
1:77124843:T:A	donor_gain	1.0000
1:77124847:T:TA	donor_gain	1.0000
1:77161288:TACTT:T	donor_loss	1.0000
1:77161289:AC:A	donor_loss	1.0000
1:77161290:CT:C	donor_loss	1.0000
1:77161292:TAC:T	donor_loss	1.0000
1:77161293:A:AC	donor_gain	1.0000
1:77161293:ACAAG:A	donor_loss	1.0000
1:77161294:C:CG	donor_gain	1.0000
1:77161294:CA:C	donor_gain	1.0000
1:77161294:CAA:C	donor_gain	1.0000
1:77161294:CAAG:C	donor_gain	1.0000
1:77161294:CAAGG:C	donor_gain	1.0000
1:77161401:TGATG:T	acceptor_gain	1.0000
1:77161402:GATG:G	acceptor_gain	1.0000
1:77161403:ATGC:A	acceptor_loss	1.0000
1:77161404:TG:T	acceptor_gain	1.0000
1:77161404:TGCTA:T	acceptor_loss	1.0000
1:77161405:GCT:G	acceptor_loss	1.0000
1:77161406:C:CA	acceptor_loss	1.0000
1:77161406:C:CC	acceptor_gain	1.0000
1:77161407:T:A	acceptor_loss	1.0000

AlphaMissense

2649 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
1:77161621:A:C	S225R	1.000
1:77161621:A:T	S225R	1.000
1:77161623:T:G	S225R	1.000
1:77163923:G:C	F169L	1.000
1:77163923:G:T	F169L	1.000
1:77163925:A:G	F169L	1.000
1:77163938:A:C	H164Q	1.000
1:77163938:A:T	H164Q	1.000
1:77166719:C:A	G163W	1.000
1:77206664:A:T	V72D	1.000
1:77206674:A:C	Y69D	1.000
1:77206682:A:G	L66P	1.000
1:77206705:A:C	N58K	1.000
1:77206705:A:T	N58K	1.000
1:77206721:G:A	S53F	1.000
1:77154595:A:C	C280W	0.999
1:77161369:C:G	D247H	0.999
1:77161618:A:C	S226R	0.999
1:77161618:A:T	S226R	0.999
1:77161620:T:G	S226R	0.999
1:77161678:G:C	C206W	0.999
1:77161679:C:T	C206Y	0.999
1:77161680:A:G	C206R	0.999
1:77161710:A:C	Y196D	0.999
1:77163846:C:G	R195P	0.999
1:77163910:C:G	D174H	0.999
1:77163915:A:G	F172S	0.999
1:77163917:T:A	K171N	0.999
1:77163917:T:G	K171N	0.999
1:77163919:T:C	K171E	0.999

dbSNP variants (sampled 300 via entrez): RS1000011155 (1:77092427 T>C), RS1000028982 (1:77178773 T>C), RS1000077813 (1:77157392 G>A,C), RS1000103428 (1:77171695 C>T), RS1000110397 (1:77127277 C>A,T), RS1000120914 (1:77135547 C>T), RS1000124910 (1:77208670 C>G), RS1000150509 (1:77110023 G>A), RS1000176363 (1:77128835 T>C), RS1000185222 (1:77110303 T>G), RS1000226940 (1:77215592 C>T), RS1000292830 (1:77147454 T>A,C), RS1000295260 (1:77105257 G>A), RS1000401561 (1:77127504 GCCTGGGTTACATAGTGAGACCC>G), RS1000404976 (1:77188499 T>C)

Disease associations

OMIM: gene MIM:605087 | disease phenotypes: MIM:618879

GenCC curated gene-disease

Disease	Classification	Inheritance
neurodevelopmental disorder with hypotonia and cerebellar atrophy, with or without seizures	Strong	Autosomal recessive

Mondo (1): neurodevelopmental disorder with hypotonia and cerebellar atrophy, with or without seizures (MONDO:0030037)

Orphanet (0):

HPO phenotypes

18 total (18 of 18 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000219	Thin upper lip vermilion
HP:0000276	Long face
HP:0000678	Dental crowding
HP:0001156	Brachydactyly
HP:0001250	Seizure
HP:0001251	Ataxia
HP:0001263	Global developmental delay
HP:0001272	Cerebellar atrophy
HP:0001290	Generalized hypotonia
HP:0003155	Elevated circulating alkaline phosphatase concentration
HP:0003282	Decreased circulating alkaline phosphatase activity
HP:0003593	Infantile onset
HP:0005338	Sparse lateral eyebrow
HP:0008593	Prominent antitragus
HP:0009890	High anterior hairline
HP:0011220	Prominent forehead
HP:0041048	Decreased expression of GPI-anchored proteins on the cell surface

GWAS associations

6 associations (top):

Study	Trait	p-value
GCST003837_2	Chronotype	2.000000e-21
GCST003838_2	Morning vs. evening chronotype	1.000000e-12
GCST004125_10	Type 2 diabetes (age of onset)	8.000000e-06
GCST007565_95	Morning person	6.000000e-20
GCST007565_98	Morning person	5.000000e-45
GCST007576_297	Chronotype	5.000000e-45

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0008328	chronotype measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL6067192 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

ChEMBL bioactivities

4 potent at pChembl≥5 of 4 total, top 4 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
7.08	Kd	83.9	nM	CHEMBL5653589
7.08	ED50	83.9	nM	CHEMBL5653589
5.46	Kd	3434	nM	CHEMBL3752910
5.46	ED50	3434	nM	CHEMBL3752910

PubChem BioAssay actives

2 with measured affinity, of 4 total; 2 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
4-methyl-3-[(2-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2149004: Binding affinity to human PIGK incubated for 45 mins by Kinobead based pull down assay	kd	0.0839	uM
4-methyl-3-[(1-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2149004: Binding affinity to human PIGK incubated for 45 mins by Kinobead based pull down assay	kd	3.4341	uM

CTD chemical–gene interactions

31 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects expression, increases expression	3
Acetaminophen	decreases expression, increases expression	2
Cyclosporine	decreases expression, increases expression	2
aristolochic acid I	decreases expression	1
dicrotophos	decreases expression	1
methylmercuric chloride	decreases expression	1
triphenyl phosphate	affects expression	1
bisphenol A	decreases expression	1
sodium arsenite	decreases expression	1
di-n-butylphosphoric acid	affects expression	1
CGP 52608	affects binding, increases reaction	1
abrine	decreases expression	1
Vorinostat	increases expression	1
Air Pollutants	decreases expression, increases abundance	1
Benzo(a)pyrene	decreases expression	1
Cycloheximide	decreases expression, decreases reaction	1
Doxorubicin	decreases expression	1
Formaldehyde	decreases expression	1
Gold	decreases expression	1
Selenium	decreases expression	1
Tetrachlorodibenzodioxin	decreases expression, decreases reaction	1
Tobacco Smoke Pollution	increases methylation	1
Tretinoin	increases expression	1
Tunicamycin	increases expression	1
7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	decreases expression	1
Aflatoxin M1	decreases expression	1
Cadmium Chloride	decreases expression	1
Thapsigargin	increases expression	1
Copper Sulfate	decreases expression	1
Lactic Acid	decreases expression	1

ChEMBL screening assays

1 unique, capped per target: 1 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL5652046	Binding	Binding affinity to human PIGK incubated for 45 mins by Kinobead based pull down assay	NVP-BHG712: Effects of Regioisomers on the Affinity and Selectivity toward the EPHrin Family. — ChemMedChem

Cellosaurus cell lines

1 cell lines: 1 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_E0KH	Ubigene HeLa PIGK KO	Cancer cell line	Female

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.