PITPNM3

Summary

PITPNM3 (PITPNM family member 3, HGNC:21043) is a protein-coding gene on chromosome 17p13.2-p13.1, encoding Membrane-associated phosphatidylinositol transfer protein 3 (Q9BZ71). Catalyzes the transfer of phosphatidylinositol and phosphatidylcholine between membranes (in vitro).

This gene encodes a member of a family of membrane-associated phosphatidylinositol transfer domain-containing proteins. The calcium-binding protein has phosphatidylinositol (PI) transfer activity and interacts with the protein tyrosine kinase PTK2B (also known as PYK2). The protein is homologous to a Drosophila protein that is implicated in the visual transduction pathway in flies. Mutations in this gene result in autosomal dominant cone dystrophy. Multiple transcript variants encoding different isoforms have been found for this gene.

Source: NCBI Gene 83394 — RefSeq curated summary.

At a glance

• Gene–disease (curated): cone-rod dystrophy 5 (Strong, GenCC) — +1 more curated relationship
• GWAS associations: 6
• Clinical variants (ClinVar): 998 total — 3 pathogenic, 1 likely-pathogenic
• Phenotypes (HPO): 21
• MANE Select transcript: NM_031220

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:21043
Approved symbol	PITPNM3
Name	PITPNM family member 3
Location	17p13.2-p13.1
Locus type	gene with protein product
Status	Approved
Aliases	NIR1, RDGBA3, ACKR6
Ensembl gene	ENSG00000091622
Ensembl biotype	protein_coding
OMIM	608921
Entrez	83394

Gene structure

Transcript identifiers

Ensembl transcripts: 5 — 3 protein_coding, 1 retained_intron, 1 protein_coding_CDS_not_defined

ENST00000262483, ENST00000421306, ENST00000572795, ENST00000575201, ENST00000576664

RefSeq mRNA: 2 — MANE Select: NM_031220 NM_001165966, NM_031220

CCDS: CCDS11076, CCDS54080

Canonical transcript exons

ENST00000262483 — 20 exons

Exon	Start	End
ENSE00000583595	6483517	6483752
ENSE00000887208	6478547	6478736
ENSE00001148854	6484216	6484292
ENSE00001148861	6503527	6503574
ENSE00001148868	6525356	6525463
ENSE00001148886	6451263	6455643
ENSE00001308157	6537987	6538082
ENSE00001487549	6556385	6556555
ENSE00003470656	6477029	6477213
ENSE00003529216	6471161	6471355
ENSE00003553627	6470260	6470408
ENSE00003563085	6463732	6463881
ENSE00003576084	6457594	6457722
ENSE00003586785	6464170	6464318
ENSE00003603882	6472657	6472827
ENSE00003627799	6474432	6474604
ENSE00003633627	6477975	6478097
ENSE00003641862	6461373	6461556
ENSE00003647806	6464655	6464771
ENSE00003673371	6468225	6468341

Expression profiles

Bgee: expression breadth ubiquitous, 222 present calls, max score 95.80.

FANTOM5 (CAGE): breadth broad, TPM avg 1.7824 / max 57.0640, expressed in 504 samples.

FANTOM5 promoters (3 alternative TSS)

Promoter ID	TPM avg	Samples expressed
164054	0.7391	270
164055	0.6181	284
164053	0.4252	147

Top tissues by expression

250 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
pancreatic ductal cell	CL:0002079	95.80	gold quality
endothelial cell	CL:0000115	95.59	gold quality
Brodmann (1909) area 23	UBERON:0013554	94.45	gold quality
spleen	UBERON:0002106	93.67	gold quality
esophagus squamous epithelium	UBERON:0006920	93.59	gold quality
cerebellar vermis	UBERON:0004720	92.83	gold quality
gingival epithelium	UBERON:0001949	92.75	gold quality
right hemisphere of cerebellum	UBERON:0014890	91.68	gold quality
cerebellar cortex	UBERON:0002129	91.27	gold quality
cerebellar hemisphere	UBERON:0002245	91.26	gold quality
cerebellum	UBERON:0002037	91.23	gold quality
gingiva	UBERON:0001828	90.95	gold quality
prefrontal cortex	UBERON:0000451	90.28	gold quality
right frontal lobe	UBERON:0002810	90.11	gold quality
primary visual cortex	UBERON:0002436	89.83	gold quality
anterior cingulate cortex	UBERON:0009835	89.79	gold quality
frontal cortex	UBERON:0001870	89.49	gold quality
Brodmann (1909) area 46	UBERON:0006483	89.38	gold quality
amygdala	UBERON:0001876	89.34	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	89.34	gold quality
occipital lobe	UBERON:0002021	89.32	gold quality
neocortex	UBERON:0001950	88.83	gold quality
temporal lobe	UBERON:0001871	88.28	gold quality
nucleus accumbens	UBERON:0001882	88.13	gold quality
lower esophagus mucosa	UBERON:0035834	87.88	gold quality
left ovary	UBERON:0002119	87.39	gold quality
middle temporal gyrus	UBERON:0002771	87.31	gold quality
Brodmann (1909) area 9	UBERON:0013540	87.14	gold quality
cerebral cortex	UBERON:0000956	86.83	gold quality
germinal epithelium of ovary	UBERON:0001304	86.55	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	4.33
E-ENAD-17	no	41.44

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

189 targeting PITPNM3, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6873-3P	100.00	71.42	2626
HSA-MIR-7110-3P	100.00	73.18	2486
HSA-MIR-200B-3P	100.00	73.31	2693
HSA-MIR-200C-3P	100.00	73.35	2685
HSA-MIR-429	100.00	73.44	2698
HSA-MIR-6876-5P	100.00	67.68	2126
HSA-MIR-4476	100.00	68.18	2030
HSA-MIR-4692	100.00	67.32	2066
HSA-MIR-8485	100.00	77.57	4731
HSA-MIR-4533	100.00	69.48	2758
HSA-MIR-5196-5P	100.00	67.98	2761
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-4514	99.99	67.10	1870
HSA-MIR-6077	99.99	68.04	2299
HSA-MIR-4500	99.99	72.72	2367
HSA-MIR-3148	99.97	75.06	6478
HSA-MIR-4267	99.96	66.53	2368
HSA-MIR-6778-3P	99.96	67.29	2693
HSA-MIR-4487	99.96	64.58	1252
HSA-MIR-548AJ-3P	99.96	73.38	5345
HSA-MIR-548X-3P	99.96	73.38	5345
HSA-MIR-651-3P	99.94	73.48	5177
HSA-MIR-1236-3P	99.94	68.04	1695
HSA-MIR-8063	99.91	69.76	3146
HSA-MIR-652-5P	99.91	67.49	505
HSA-MIR-329-3P	99.91	66.56	1234
HSA-MIR-362-3P	99.91	66.38	1267
HSA-MIR-4731-5P	99.89	67.23	2537
HSA-MIR-548D-3P	99.87	70.67	4362
HSA-MIR-3065-3P	99.87	70.25	1407

Literature-anchored findings (GeneRIF, showing 11)

• Our finding on the first mutation in the human homologue of Drosophila rdgB indicates novel pathways and a potential important role of the PITPNM3 in mammalian phototransduction. (PMID:17377520)
• Mutation in the PYK2-binding domain of PITPNM3 causes autosomal dominant cone dystrophy (CORD5) in two Swedish families. (PMID:18188949)
• Thus, mutations in PITPNM3 do not appear to be a major cause of cone or cone-rod dystrophy. (PMID:20590364)
• CCL18 derived from Tumor-associated macrophages (TAMs) lays a critical role in promoting breast cancer metastasis via its receptor, PITPNM3. (PMID:21481794)
• Our observations of the PITPNM3 p.Q626H mutation carriers confirm that CORD5 is a disease not to mix with other retinal degenerations mapped to 17p13. (PMID:22405330)
• Data indicate that PYK2 N-terminal domain interacting receptor 1 (Nir1) could induce epithelial-mesenchymal transition by stabilising Snail via the PI3K/Akt/GSK3beta/Snail signalling pathway through binding to CCL18. (PMID:24001613)
• CCL18 enhances hepatocellular carcinoma (HCC) cell migration, invasion, and epithelial-mesenchymal transition (EMT) through the expression of PITPNM3 and the activation of the NF-kappaB signaling pathway. (PMID:26449829)
• CCL18 can increase the invasive ability of non-small cell lung cancer cells by binding to its receptor Nir1. (PMID:26756176)
• Mitofusin-2 (Mfn-2) Might Have Anti-Cancer Effect through Interaction with Transcriptional Factor SP1 and Consequent Regulation on Phosphatidylinositol Transfer Protein 3 (PITPNM3) Expression. (PMID:31955176)
• CCL18-NIR1 promotes oral cancer cell growth and metastasis by activating the JAK2/STAT3 signaling pathway. (PMID:32641093)
• Chemokine CCL18 Promotes Phagocytosis Through Its Receptor CCR8 Rather than PITPNM3 in Human Microglial Cells. (PMID:35041514)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	pitpnm3	ENSDARG00000055255
mus_musculus	Pitpnm3	ENSMUSG00000040543
rattus_norvegicus	Pitpnm3	ENSRNOG00000008323

Paralogs (5): PITPNM2 (ENSG00000090975), PITPNM1 (ENSG00000110697), PITPNC1 (ENSG00000154217), PITPNA (ENSG00000174238), PITPNB (ENSG00000180957)

Protein

Protein identifiers

Membrane-associated phosphatidylinositol transfer protein 3 — Q9BZ71 (reviewed: Q9BZ71)

Alternative names: Phosphatidylinositol transfer protein, membrane-associated 3, Pyk2 N-terminal domain-interacting receptor 1

All UniProt accessions (2): Q9BZ71, I3L1K1

UniProt curated annotations — full annotation on UniProt →

Function. Catalyzes the transfer of phosphatidylinositol and phosphatidylcholine between membranes (in vitro). Binds calcium ions.

Subunit / interactions. Interacts with PTK2B via its C-terminus.

Subcellular location. Endomembrane system.

Tissue specificity. Detected in brain and spleen, and at low levels in ovary.

Disease relevance. Cone-rod dystrophy 5 (CORD5) [MIM:600977] An inherited retinal dystrophy characterized by retinal pigment deposits visible on fundus examination, predominantly in the macular region, and initial loss of cone photoreceptors followed by rod degeneration. This leads to decreased visual acuity and sensitivity in the central visual field, followed by loss of peripheral vision. Severe loss of vision occurs earlier than in retinitis pigmentosa, due to cone photoreceptors degenerating at a higher rate than rod photoreceptors. The disease is caused by variants affecting the gene represented in this entry.

Miscellaneous. May be due to an intron retention.

Similarity. Belongs to the PtdIns transfer protein family. PI transfer class IIA subfamily.

Isoforms (3)

UniProt ID	Names	Canonical?
Q9BZ71-1	1	yes
Q9BZ71-2	2
Q9BZ71-3	3

RefSeq proteins (2): NP_001159438, NP_112497* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001666	PI_transfer	Family
IPR004177	DDHD_dom	Domain
IPR023214	HAD_sf	Homologous_superfamily
IPR031315	LNS2/PITP	Domain
IPR036412	HAD-like_sf	Homologous_superfamily

Pfam: PF02862, PF24694, PF24695

UniProt features (26 total): modified residue 12, region of interest 4, sequence variant 3, splice variant 2, compositionally biased region 2, chain 1, domain 1, sequence conflict 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
9C38	X-RAY DIFFRACTION	1.95

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9BZ71-F1	66.73	0.28

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (12): 109, 295, 298, 321, 343, 495, 612, 907, 928, 946, 30, 31

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-1483226	Synthesis of PI

MSigDB gene sets: 158 (showing top): GSE18804_BRAIN_VS_COLON_TUMORAL_MACROPHAGE_UP, GOBP_PHOSPHOLIPID_METABOLIC_PROCESS, GOBP_PHOSPHATIDYLINOSITOL_METABOLIC_PROCESS, GOBP_ORGANOPHOSPHATE_METABOLIC_PROCESS, GOBP_ORGANOPHOSPHATE_BIOSYNTHETIC_PROCESS, GOBP_PHOSPHOLIPID_BIOSYNTHETIC_PROCESS, GOBP_ORGANOPHOSPHATE_ESTER_TRANSPORT, GOBP_GLYCEROLIPID_METABOLIC_PROCESS, RICKMAN_METASTASIS_DN, GOBP_GLYCEROLIPID_BIOSYNTHETIC_PROCESS, GOBP_GLYCEROPHOSPHOLIPID_METABOLIC_PROCESS, GOBP_LIPID_METABOLIC_PROCESS, GOBP_LIPID_BIOSYNTHETIC_PROCESS, GOBP_PHOSPHOLIPID_TRANSPORT, GOBP_MEMBRANE_ORGANIZATION

GO Biological Process (3): phosphatidylinositol biosynthetic process (GO:0006661), phospholipid transport (GO:0015914), intermembrane lipid transfer (GO:0120009)

GO Molecular Function (8): glycerophospholipase activity (GO:0004620), calcium ion binding (GO:0005509), lipid binding (GO:0008289), phosphatidylinositol transfer activity (GO:0008526), receptor tyrosine kinase binding (GO:0030971), protein binding (GO:0005515), obsolete phospholipid transporter activity (GO:0005548), metal ion binding (GO:0046872)

GO Cellular Component (6): cytoplasm (GO:0005737), cytosol (GO:0005829), endomembrane system (GO:0012505), cell projection (GO:0042995), cell body (GO:0044297), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Glycerophospholipid biosynthesis	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	6
lipid transport	2
binding	2
biosynthetic process	1
phosphatidylinositol metabolic process	1
organophosphate ester transport	1
membrane organization	1
phospholipase activity	1
metal ion binding	1
phosphatidylinositol binding	1
lipid transfer activity	1
signaling receptor binding	1
protein tyrosine kinase binding	1
cation binding	1
intracellular anatomical structure	1
cytoplasm	1
vacuole	1
plasma membrane	1

Protein interactions and networks

STRING

776 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
PITPNM3	CCL18	P55774	993
PITPNM3	PTK2B	Q14289	838
PITPNM3	GUCY2D	Q02846	817
PITPNM3	UNC119	Q13432	813
PITPNM3	RAX2	Q96IS3	812
PITPNM3	AIPL1	Q9NZN9	805
PITPNM3	RIMS1	Q86UR5	777
PITPNM3	SEMA4A	Q9H3S1	767
PITPNM3	CDHR1	Q96JP9	727
PITPNM3	RPGRIP1	Q96KN7	716
PITPNM3	ABCA4	P78363	676
PITPNM3	ADAM9	Q13443	629
PITPNM3	PROM1	O43490	587
PITPNM3	CCR8	P51685	560
PITPNM3	GPER1	Q99527	536

IntAct

20 interactions, top by confidence:

A	B	Type	Score
CKAP5	TACC1	psi-mi:“MI:0914”(association)	0.800
VAPB	FAM83G	psi-mi:“MI:0914”(association)	0.730
PITPNM3	VAPB	psi-mi:“MI:0914”(association)	0.640
VAPA	FAM83G	psi-mi:“MI:0914”(association)	0.640
PITPNM3	CCL18	psi-mi:“MI:0915”(physical association)	0.560
CCL18	PITPNM3	psi-mi:“MI:0403”(colocalization)	0.560
CCL18	PITPNM3	psi-mi:“MI:0915”(physical association)	0.560
PITPNM3	ALDH1B1	psi-mi:“MI:0915”(physical association)	0.400
PITPNM3	HNRNPC	psi-mi:“MI:0915”(physical association)	0.400
VAPA		psi-mi:“MI:0914”(association)	0.350
	TNFRSF10B	psi-mi:“MI:0914”(association)	0.350
CKAP5	GAPDHS	psi-mi:“MI:0914”(association)	0.350
CKAP5	SERBP1	psi-mi:“MI:0914”(association)	0.350
PITPNM3	ZFPL1	psi-mi:“MI:0914”(association)	0.350
PITPNM3	ligA	psi-mi:“MI:0915”(physical association)	0.000
	PITPNM3	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (21): PITPNM3 (Affinity Capture-MS), PITPNM3 (Affinity Capture-MS), PITPNM3 (Affinity Capture-MS), PITPNM3 (Synthetic Lethality), PITPNM3 (Proximity Label-MS), PITPNM3 (Proximity Label-MS), PITPNM3 (Two-hybrid), PTK2B (Reconstituted Complex), PITPNM3 (Affinity Capture-Western), PITPNM3 (Affinity Capture-RNA), PITPNM3 (Proximity Label-MS), VAPA (Affinity Capture-MS), VAPB (Affinity Capture-MS), PITPNM3 (Affinity Capture-MS), PITPNM3 (Affinity Capture-MS)

ESM2 similar proteins: A0A4X1TB62, A4VCH4, G3V7Q0, O14795, O35841, O43237, O70585, P23116, P48553, Q0P5J8, Q14152, Q15542, Q1JU68, Q3TLI0, Q3UHE1, Q4R5P6, Q5R660, Q5R7S4, Q5R7U7, Q5RE09, Q5RE70, Q5VSL9, Q5XI83, Q658Y4, Q68E01, Q6IQ26, Q6PAL8, Q6PDL0, Q6TEP1, Q6WKZ8, Q7SYD9, Q7TPD0, Q8BIK4, Q8BWQ6, Q8C079, Q8C092, Q8C9H6, Q8CBY8, Q8IWV8, Q8K400

Diamond homologs: G5EEM9, O00562, O35954, O46606, P16446, P43125, P48738, P48739, P53810, P53811, P53812, Q00169, Q28CA0, Q2HJ54, Q3UHE1, Q54D93, Q54VC7, Q5R6F0, Q5U2N3, Q6NZC7, Q6ZPQ6, Q80YA3, Q8K4R4, Q8NEL9, Q8W5R2, Q9BZ71, Q9BZ72, Q9NCL7, Q9NCL8, Q9TR36, Q9U9P7, Q9UKF7, Q8ET41, O94830, Q12204, Q495M9, Q80T11, Q80Y98, Q8N8V4, Q9Y6Y8

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

998 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	3
Likely pathogenic	1
Uncertain significance	510
Likely benign	355
Benign	86

Top pathogenic / likely-pathogenic (4)

Variant ID	HGVS	Classification
3063486	GRCh37/hg19 17p13.3-11.2(chr17:525-21510992)x3	Pathogenic
545101	NM_031220.4(PITPNM3):c.274C>T (p.Arg92Ter)	Pathogenic
813199	NM_031220.4(PITPNM3):c.1657_1660dup (p.Tyr554Ter)	Pathogenic
2647312	NM_031220.4(PITPNM3):c.61C>T (p.Arg21Ter)	Likely pathogenic

SpliceAI

4088 predictions. Top by Δscore:

Variant	Effect	Δscore
17:6457614:T:TA	donor_gain	1.0000
17:6457718:AAGCA:A	acceptor_gain	1.0000
17:6457719:AGCA:A	acceptor_gain	1.0000
17:6457720:GCA:G	acceptor_gain	1.0000
17:6457721:CA:C	acceptor_gain	1.0000
17:6457721:CAC:C	acceptor_gain	1.0000
17:6457722:AC:A	acceptor_loss	1.0000
17:6457723:C:CC	acceptor_gain	1.0000
17:6457723:C:CG	acceptor_loss	1.0000
17:6457729:C:CT	acceptor_gain	1.0000
17:6461368:CTCA:C	donor_loss	1.0000
17:6461370:CACCT:C	donor_loss	1.0000
17:6461371:ACCT:A	donor_gain	1.0000
17:6461372:C:CA	donor_loss	1.0000
17:6461372:CCT:C	donor_gain	1.0000
17:6461372:CCTC:C	donor_gain	1.0000
17:6461374:T:TA	donor_gain	1.0000
17:6463727:CTCA:C	donor_loss	1.0000
17:6463728:TCA:T	donor_loss	1.0000
17:6463729:CACCG:C	donor_loss	1.0000
17:6463731:C:A	donor_loss	1.0000
17:6464166:TTAC:T	donor_loss	1.0000
17:6464167:TA:T	donor_loss	1.0000
17:6464168:A:AT	donor_loss	1.0000
17:6464767:ACATT:A	acceptor_gain	1.0000
17:6464768:CATT:C	acceptor_gain	1.0000
17:6464768:CATTC:C	acceptor_gain	1.0000
17:6464769:ATT:A	acceptor_gain	1.0000
17:6464770:TT:T	acceptor_gain	1.0000
17:6464770:TTC:T	acceptor_loss	1.0000

AlphaMissense

6406 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
17:6457682:T:A	D844V	1.000
17:6457682:T:G	D844A	1.000
17:6457683:C:G	D844H	1.000
17:6457684:C:A	K843N	1.000
17:6457684:C:G	K843N	1.000
17:6457694:C:T	G840D	1.000
17:6457695:C:G	G840R	1.000
17:6461403:C:A	K820N	1.000
17:6461403:C:G	K820N	1.000
17:6461460:G:C	F801L	1.000
17:6461460:G:T	F801L	1.000
17:6461461:A:G	F801S	1.000
17:6461462:A:G	F801L	1.000
17:6461468:G:C	H799D	1.000
17:6461476:A:G	L796P	1.000
17:6461478:C:A	W795C	1.000
17:6461478:C:G	W795C	1.000
17:6461480:A:G	W795R	1.000
17:6461480:A:T	W795R	1.000
17:6461518:G:T	T782K	1.000
17:6461552:A:G	W771R	1.000
17:6461552:A:T	W771R	1.000
17:6463732:C:G	R769P	1.000
17:6463738:A:T	V767D	1.000
17:6463788:G:C	S750R	1.000
17:6463788:G:T	S750R	1.000
17:6463790:T:G	S750R	1.000
17:6463792:G:T	A749D	1.000
17:6463798:A:G	F747S	1.000
17:6463804:C:T	G745E	1.000

dbSNP variants (sampled 300 via entrez): RS1000007650 (17:6465269 C>T), RS1000041215 (17:6515295 GGCTGAGGTCAGAGAATCGCTTGAACCCGGGTGGCAGAGGTTGCAGTGA>G), RS1000071308 (17:6470683 C>T), RS1000079641 (17:6539394 G>A,T), RS1000089588 (17:6471551 G>A), RS1000090294 (17:6498537 G>A), RS1000157738 (17:6486540 A>C), RS1000187240 (17:6549807 C>G,T), RS1000208979 (17:6505204 A>ATATG), RS1000240079 (17:6522274 T>C), RS1000247369 (17:6533542 C>T), RS1000261459 (17:6504854 G>A), RS1000280211 (17:6520912 A>G), RS1000301183 (17:6556615 A>C,G), RS1000304506 (17:6533185 C>T)

Disease associations

OMIM: gene MIM:608921 | disease phenotypes: MIM:600977, MIM:268000, MIM:604393, MIM:108010

GenCC curated gene-disease

Disease	Classification	Inheritance
cone-rod dystrophy 5	Strong	Autosomal dominant
cone-rod dystrophy	Supportive	Autosomal dominant

Mondo (7): inherited retinal dystrophy (MONDO:0019118), cone-rod dystrophy 5 (MONDO:0010969), retinitis pigmentosa (MONDO:0019200), Leber congenital amaurosis 4 (MONDO:0011458), arteriovenous malformations of the brain (MONDO:0007154), cone dystrophy (MONDO:0000455), cone-rod dystrophy (MONDO:0015993)

Orphanet (5): OBSOLETE: Inherited retinal disorder (Orphanet:71862), Cone rod dystrophy (Orphanet:1872), Retinitis pigmentosa (Orphanet:791), Brain arteriovenous malformation (Orphanet:46724), Progressive cone dystrophy (Orphanet:1871)

HPO phenotypes

21 total (22 of 21 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000505	Visual impairment
HP:0000529	Progressive visual loss
HP:0000543	Optic disc pallor
HP:0000548	Cone/cone-rod dystrophy
HP:0000551	Color vision defect
HP:0000603	Central scotoma
HP:0000608	Macular degeneration
HP:0000613	Photophobia
HP:0000639	Nystagmus
HP:0000662	Nyctalopia
HP:0001105	Retinal atrophy
HP:0007641	Dyschromatopsia
HP:0007663	Reduced visual acuity
HP:0007703	Abnormal retinal pigmentation
HP:0007737	Spicular pigmentation of the retina
HP:0007814	Retinal pigment epithelial mottling
HP:0007843	Attenuation of retinal blood vessels
HP:0011463	Childhood onset
HP:0012508	Metamorphopsia
HP:0030466	Abnormal full-field electroretinogram
HP:0000556	Retinal dystrophy

GWAS associations

6 associations (top):

Study	Trait	p-value
GCST003485_9	Response to fenofibrate (HDL cholesterol levels)	7.000000e-06
GCST007096_3	Pulse pressure	2.000000e-17
GCST007099_148	Systolic blood pressure	1.000000e-07
GCST007268_60	Diastolic blood pressure	6.000000e-10
GCST007432_61	FEV1	7.000000e-09
GCST009617_2	LDL cholesterol levels x thiazide or thiazide-like diuretics use interaction	1.000000e-07

EFO canonical traits (6, from GWAS)

EFO ID	Trait name
EFO:0007805	HDL cholesterol change measurement
EFO:0005763	pulse pressure measurement
EFO:0006335	systolic blood pressure
EFO:0006336	diastolic blood pressure
EFO:0004314	forced expiratory volume
EFO:0004611	low density lipoprotein cholesterol measurement

MeSH disease descriptors (7)

Descriptor	Name	Tree numbers
D000077765	Cone Dystrophy	C11.270.151; C11.768.216
D000071700	Cone-Rod Dystrophies	C11.270.152; C11.768.585.658.250; C16.320.290.152
D002538	Intracranial Arteriovenous Malformations	C10.228.140.300.520; C10.500.190.500; C14.240.850.750.295; C14.240.850.875.500; C14.907.150.295; C14.907.253.560.400; C16.131.240.850.750.295; C16.131.240.850.875.500; C16.131.666.190.500
D058499	Retinal Dystrophies	C11.768.585.658
D012174	Retinitis Pigmentosa	C11.270.684; C11.768.585.658.500; C16.320.290.684
C563415	Cone-Rod Dystrophy 5 (supp.)
C565778	Leber Congenital Amaurosis 4 (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

26 total (human), top 26 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects cotreatment, decreases expression	6
trichostatin A	affects cotreatment, decreases expression	3
Benzo(a)pyrene	affects methylation, decreases methylation, increases expression	3
Nickel	decreases expression	2
Phenylmercuric Acetate	affects cotreatment, decreases expression	2
methylmercuric chloride	decreases expression	1
sodium arsenite	increases expression	1
benzo(e)pyrene	increases methylation	1
aflatoxin B2	increases methylation	1
S-(1,2-dichlorovinyl)cysteine	affects cotreatment, decreases expression, affects response to substance, increases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
dorsomorphin	affects cotreatment, decreases expression	1
jinfukang	affects cotreatment, decreases expression, increases expression	1
NSC 689534	affects binding, increases expression	1
Cisplatin	decreases expression, affects cotreatment	1
Copper	affects binding, increases expression	1
Lead	affects expression	1
Lipopolysaccharides	decreases expression, affects response to substance, increases expression, affects cotreatment	1
Methapyrilene	increases methylation	1
Oxygen	decreases expression	1
Smoke	decreases expression	1
Thiram	increases expression	1
Tobacco Smoke Pollution	increases expression	1
7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	affects expression	1
Aflatoxin B1	affects methylation	1
Okadaic Acid	increases expression	1

Clinical trials (associated diseases)

263 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00717080	PHASE4	COMPLETED	The Role of Capsular Tension Ring (CTR) in Anterior Capsular Contraction
NCT04224207	PHASE3	COMPLETED	Management of Retinitis Pigmentosa by Mesenchymal Stem Cells by Wharton’s Jelly Derived Mesenchymal Stem Cells
NCT07082855	PHASE3	NOT_YET_RECRUITING	A Multicenter, Randomized, Double-Blind, Controlled Clinical Study of Minocycline for the Treatment of Retinitis Pigmentosa
NCT00000114	PHASE3	COMPLETED	Randomized Trial of Vitamin A and Vitamin E Supplementation for Retinitis Pigmentosa
NCT00000116	PHASE3	COMPLETED	Randomized Trial of DHA for Retinitis Pigmentosa Patients Receiving Vitamin A
NCT00346333	PHASE3	COMPLETED	Clinical Trial of Lutein for Patients With Retinitis Pigmentosa Receiving Vitamin A
NCT01786395	PHASE3	TERMINATED	Phase III Efficacy and Safety Clinical Study of UF-021 for Treatment of Retinitis Pigmentosa
NCT04636853	PHASE3	COMPLETED	CB-PRP in Retinitis Pigmentosa and Dry Age-related Macular Degeneration
NCT05537220	PHASE3	ACTIVE_NOT_RECRUITING	Oral N-acetylcysteine for Retinitis Pigmentosa
NCT05800301	PHASE3	COMPLETED	Management of Retinitis Pigmentosa Via Combination of Wharton’s Jelly-derived Mesenchymal Stem Cells and Magnovision
NCT05926583	PHASE3	ACTIVE_NOT_RECRUITING	A Study of AAV5-hRKp.RPGR for the Treatment of Japanese Participants With X-linked Retinitis Pigmentosa
NCT06388200	PHASE3	ACTIVE_NOT_RECRUITING	A Phase 3 Study Of OCU400 Gene Therapy for the Treatment Of Retinitis Pigmentosa
NCT07290530	PHASE3	NOT_YET_RECRUITING	24-Month Trial of NPI-001 for the Preservation of Photoreceptors in Retinitis Pigmentosa Associated With Usher Syndrome
NCT01773278	PHASE2	RECRUITING	Cholesterol and Antioxidant Treatment in Patients With Smith-Lemli-Opitz Syndrome (SLOS)
NCT03763227	PHASE2	COMPLETED	Intravitreal Ranibizumab (Lucentis®) in the Treatment of Non-leaking Macular Cysts in Retinal Dystrophy
NCT04068207	PHASE2	COMPLETED	Minocycline Treatment in Retinitis Pigmentosa
NCT04945772	PHASE2	COMPLETED	Efficacy and Safety of MCO-010 Optogenetic Therapy in Adults With Retinitis Pigmentosa [RESTORE]
NCT00100230	PHASE2	COMPLETED	DHA and X-Linked Retinitis Pigmentosa
NCT00447980	PHASE2	COMPLETED	A Study of Encapsulated Cell Technology (ECT) Implant for Participants With Early Stage Retinitis Pigmentosa
NCT00447993	PHASE2	COMPLETED	A Study of Encapsulated Cell Technology (ECT) Implant for Patients With Late Stage Retinitis Pigmentosa
NCT01233609	PHASE2	COMPLETED	Trial of Oral Valproic Acid for Retinitis Pigmentosa
NCT01399515	PHASE2	COMPLETED	Efficacy and Safety of Oral Valproic Acid for Retinitis Pigmentosa
NCT01530659	PHASE2	COMPLETED	Retinal Imaging in CNTF -Releasing Encapsulated Cell Implant Treated Patients for Early-stage Retinitis Pigmentosa
NCT01560715	PHASE2	COMPLETED	Autologous Bone Marrow-Derived Stem Cells Transplantation For Retinitis Pigmentosa
NCT02609165	PHASE2	COMPLETED	Nerve Growth Factor Eye Drops Treatment in Patients With Retinitis Pigmentosa and Cystoid Macular Edema
NCT02661711	PHASE2	COMPLETED	Aflibercept for Macular Oedema With Underlying Retinitis Pigmentosa (AMOUR) Study
NCT02804360	PHASE2	UNKNOWN	Intravitreal Dexamethasone Implant in Retinitis Pigmentosa-related Macular Edema- a Retrospective Study
NCT02837640	PHASE2	UNKNOWN	Studying a Potential Protective Effect of L-Dopa on Retinitis Pigmentosa
NCT03073733	PHASE2	COMPLETED	Safety and Efficacy of Intravitreal Injection of Human Retinal Progenitor Cells in Adults With Retinitis Pigmentosa
NCT04356716	PHASE2	COMPLETED	Sildenafil for Treatment of Choroidal Ischemia
NCT04604899	PHASE2	COMPLETED	Safety of Repeat Intravitreal Injection of Human Retinal Progenitor Cells (jCell) in Adult Subjects With Retinitis Pigmentosa
NCT04763369	PHASE2	UNKNOWN	Investigation of Therapeutic Efficacy and Safety of UMSCs for the Management of Retinitis Pigmentosa (RP)
NCT04864496	PHASE2	UNKNOWN	Effects of Treatment With N- Acetylcysteine on Visual Outcomes in Patients With Retinitis Pigmentosa
NCT05085964	PHASE2	TERMINATED	An Open-Label Extension Study to Evaluate Safety & Tolerability of QR-421a in Subjects With Retinitis Pigmentosa
NCT05392179	PHASE2	COMPLETED	A Study in Subjects With Retinitis Pigmentosa
NCT06627179	PHASE2	RECRUITING	Study to Evaluate Ultevursen in Subjects With Retinitis Pigmentosa (RP) Due to Mutations in Exon 13 of the USH2A Gene
NCT06628947	PHASE2	RECRUITING	A Phase II Study of Intravitreal KIO-301 in Patients With Late-stage Retinitis Pigmentosa
NCT06912633	PHASE2	RECRUITING	Safety of a Single, Intravitreal Injection of 6.0M jCell (Famzeretcel) in Retinitis Pigmentosa (RP)
NCT05902962	PHASE1	COMPLETED	SAD of IVT VP-001 in PRPF31 Mutation-Associated Retinal Dystrophy Subjects
NCT06319872	PHASE1	RECRUITING	The Effects of Disulfiram (Antabuse®) on Visual Acuity in Patients With Retinal Degeneration