PLCE1

Summary

PLCE1 (phospholipase C epsilon 1, HGNC:17175) is a protein-coding gene on chromosome 10q23.33, encoding 1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase epsilon-1 (Q9P212). The production of the second messenger molecules diacylglycerol (DAG) and inositol 1,4,5-trisphosphate (IP3) is mediated by activated phosphatidylinositol-specific phospholipase C enzymes.

This gene encodes a phospholipase enzyme that catalyzes the hydrolysis of phosphatidylinositol-4,5-bisphosphate to generate two second messengers: inositol 1,4,5-triphosphate (IP3) and diacylglycerol (DAG). These second messengers subsequently regulate various processes affecting cell growth, differentiation, and gene expression. This enzyme is regulated by small monomeric GTPases of the Ras and Rho families and by heterotrimeric G proteins. In addition to its phospholipase C catalytic activity, this enzyme has an N-terminal domain with guanine nucleotide exchange (GEF) activity. Mutations in this gene cause early-onset nephrotic syndrome; characterized by proteinuria, edema, and diffuse mesangial sclerosis or focal and segmental glomerulosclerosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms.

Source: NCBI Gene 51196 — RefSeq curated summary.

At a glance

• Gene–disease (curated): nephrotic syndrome, type 3 (Definitive, ClinGen) — +1 more curated relationship
• GWAS associations: 88
• Clinical variants (ClinVar): 922 total — 34 pathogenic, 23 likely-pathogenic
• Phenotypes (HPO): 23
• MANE Select transcript: NM_016341

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:17175
Approved symbol	PLCE1
Name	phospholipase C epsilon 1
Location	10q23.33
Locus type	gene with protein product
Status	Approved
Aliases	KIAA1516, PLCE, NPHS3
Ensembl gene	ENSG00000138193
Ensembl biotype	protein_coding
OMIM	608414
Entrez	51196

Gene structure

Transcript identifiers

Ensembl transcripts: 26 — 12 protein_coding, 7 retained_intron, 5 nonsense_mediated_decay, 2 protein_coding_CDS_not_defined

ENST00000371375, ENST00000371380, ENST00000371385, ENST00000432707, ENST00000674738, ENST00000674827, ENST00000675218, ENST00000675487, ENST00000675718, ENST00000676102, ENST00000685132, ENST00000685253, ENST00000685889, ENST00000686807, ENST00000686954, ENST00000687948, ENST00000688810, ENST00000689233, ENST00000689699, ENST00000689982, ENST00000690340, ENST00000692286, ENST00000692396, ENST00000875450, ENST00000875451, ENST00000875452

RefSeq mRNA: 3 — MANE Select: NM_016341 NM_001165979, NM_001288989, NM_016341

CCDS: CCDS41552, CCDS53555, CCDS91304

Canonical transcript exons

ENST00000371380 — 33 exons

Exon	Start	End
ENSE00000715658	94235915	94236120
ENSE00000715713	94259014	94259150
ENSE00000715716	94262494	94262732
ENSE00000810824	94252316	94252498
ENSE00000932999	94227306	94227451
ENSE00000933000	94234054	94234312
ENSE00000933001	94265647	94265708
ENSE00000933002	94265793	94265958
ENSE00000933003	94268929	94269036
ENSE00000933004	94270486	94270602
ENSE00000933005	94273562	94273720
ENSE00000933008	94284848	94284965
ENSE00000933010	94298379	94298669
ENSE00000933011	94304482	94304645
ENSE00000933012	94306427	94306688
ENSE00000933013	94308581	94308699
ENSE00000933014	94313254	94313382
ENSE00000933015	94316547	94316756
ENSE00000933016	94321901	94322059
ENSE00000933017	94324349	94324567
ENSE00000986533	94132174	94132459
ENSE00000986534	94171180	94171496
ENSE00000986536	94254190	94254307
ENSE00001123760	94283790	94283911
ENSE00001123767	94279782	94279911
ENSE00001123834	94293508	94293639
ENSE00001123911	94258800	94258922
ENSE00001123919	94254893	94255049
ENSE00001123935	94245946	94246621
ENSE00001455103	94030683	94032252
ENSE00001455108	94324892	94325104
ENSE00003711053	94327968	94332823
ENSE00003901571	93993931	93994258

Expression profiles

Bgee: expression breadth ubiquitous, 271 present calls, max score 96.97.

FANTOM5 (CAGE): breadth broad, TPM avg 4.2504 / max 232.1473, expressed in 840 samples.

FANTOM5 promoters (11 alternative TSS)

Promoter ID	TPM avg	Samples expressed
106303	2.3298	734
106310	0.3362	127
106306	0.3174	145
106305	0.2600	128
106309	0.2280	73
106301	0.2201	99
106300	0.1425	57
106307	0.1213	62
106302	0.1208	55
106304	0.1064	42

Top tissues by expression

287 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
renal glomerulus	UBERON:0000074	96.97	gold quality
metanephric glomerulus	UBERON:0004736	96.67	gold quality
ventricular zone	UBERON:0003053	95.94	gold quality
pigmented layer of retina	UBERON:0001782	93.98	gold quality
colonic mucosa	UBERON:0000317	90.27	gold quality
ganglionic eminence	UBERON:0004023	89.86	gold quality
mucosa of sigmoid colon	UBERON:0004993	89.50	gold quality
popliteal artery	UBERON:0002250	88.78	gold quality
tibial artery	UBERON:0007610	88.78	gold quality
blood vessel layer	UBERON:0004797	87.70	gold quality
islet of Langerhans	UBERON:0000006	87.21	gold quality
parotid gland	UBERON:0001831	86.93	gold quality
rectum	UBERON:0001052	86.38	gold quality
cranial nerve II	UBERON:0000941	86.24	gold quality
metanephros	UBERON:0000081	86.20	gold quality
germinal epithelium of ovary	UBERON:0001304	86.02	gold quality
endothelial cell	CL:0000115	85.96	gold quality
aorta	UBERON:0000947	85.90	gold quality
transverse colon	UBERON:0001157	85.66	gold quality
mucosa of transverse colon	UBERON:0004991	85.46	gold quality
choroid plexus epithelium	UBERON:0003911	85.44	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	85.13	gold quality
cardiac muscle of right atrium	UBERON:0003379	84.74	gold quality
cardiac atrium	UBERON:0002081	84.31	gold quality
sural nerve	UBERON:0015488	84.21	gold quality
right atrium auricular region	UBERON:0006631	84.15	gold quality
mucosa of paranasal sinus	UBERON:0005030	84.12	gold quality
apex of heart	UBERON:0002098	83.76	gold quality
large intestine	UBERON:0000059	83.49	gold quality
left coronary artery	UBERON:0001626	83.47	gold quality

Single-cell (SCXA)

Detected in 10 experiment(s), a significant marker in 9.

Experiment	Marker?	Max mean expression
E-ENAD-27	yes	851.33
E-GEOD-81608	yes	783.28
E-CURD-119	yes	34.55
E-MTAB-5061	yes	28.31
E-HCAD-31	yes	25.62
E-GEOD-81547	yes	21.42
E-HCAD-10	yes	17.96
E-ANND-3	yes	10.93
E-HCAD-35	yes	7.63
E-MTAB-6142	no	90.91

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): NR2E1

miRNA regulators (miRDB)

31 targeting PLCE1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-3692-3P	99.98	70.27	2139
HSA-MIR-507	99.97	70.11	1915
HSA-MIR-557	99.96	70.01	1640
HSA-MIR-3912-5P	99.95	66.11	925
HSA-MIR-9718	99.94	68.91	918
HSA-MIR-5195-3P	99.92	70.92	1877
HSA-MIR-145-5P	99.92	71.13	1836
HSA-MIR-3180-5P	99.82	69.12	2422
HSA-MIR-6885-3P	99.75	70.36	3187
HSA-MIR-545-5P	99.66	70.18	2308
HSA-MIR-6762-3P	99.66	66.94	1188
HSA-MIR-4502	99.65	66.99	1021
HSA-MIR-6516-3P	99.65	68.57	1238
HSA-MIR-561-3P	99.64	70.90	3647
HSA-MIR-6733-3P	99.54	67.80	1281
HSA-MIR-4325	99.49	72.20	1342
HSA-MIR-889-5P	99.41	68.75	1025
HSA-MIR-6719-3P	99.29	67.78	1387
HSA-MIR-412-3P	98.86	66.89	712
HSA-MIR-6754-3P	98.84	66.60	889
HSA-MIR-6794-3P	98.76	66.99	894
HSA-MIR-6755-3P	98.61	66.90	834
HSA-MIR-628-5P	98.36	67.74	844
HSA-MIR-93-3P	98.15	66.65	1309
HSA-MIR-18B-3P	98.05	65.55	595
HSA-MIR-1285-5P	98.01	68.71	779
HSA-MIR-6765-3P	97.83	64.59	1165
HSA-MIR-7703	97.64	67.00	965
HSA-MIR-6851-3P	95.73	65.11	688

Literature-anchored findings (GeneRIF, showing 40)

• Stimulation of phospholipase C-epsilon by the M3 muscarinic acetylcholine receptor mediated by cyclic AMP and the GTPase Rap2B (PMID:11877431)
• phospholipase C signal is suggested to be critical for survival and growth of cells (PMID:12444546)
• Gi-coupled receptors can inhibit PLC-epsilon. (PMID:15157671)
• diversity introduced by splice variants could play an important role in PLCepsilon regulation (PMID:15558028)
• R-Ras regulates organization of actin and drives membrane protrusions through the activitiy of PLCE. (PMID:16537651)
• CD44 interaction with LARG and EGFR plays a pivotal role in Rho/Ras co-activation, PLC epsilon-Ca2+ signaling, and Raf/ERK up-regulation required for CaMKII-mediated cytoskeleton function and in head and neck squamous cell carcinoma progression (PMID:16565089)
• Mutations cause early onset nephrotic syndrome. May play a critical role in glomerular development. Review. (PMID:17449496)
• BRAF interacts with PLCepsilon1 in nephrotic syndrome type 3. Both proteins are coexpressed and colocalize in developing and mature glomerular podocytes. (PMID:17942568)
• mutations in PLCE1 may serve as a biomarker for selecting patients with IDMS who may benefit from treatment. (PMID:18065803)
• Discuss the recent identification of autosomal recessive nephrotic syndrome type 3 (NPHS3) caused by mutations in the phospholipase PLCE1 gene has, for the first time, shown steroid responsiveness in childhood nephrotic syndrome. (Editorial) (PMID:18270750)
• PLCE1/NPHS3 mutations are not a cause of focal and segmental glomerulosclerosis in this cohort study (PMID:18975016)
• nonpenetrance may be due to compensatory mutations at a second locus and mutation within PLCE1 is not always sufficient to cause diffuse mesangial sclerosis. (PMID:19037252)
• This study demonstrated that PLCE1 might be a new tumor suppressor gene related to sporadic colorectal cancer. (PMID:19260473)
• Homozygous or compound heterozygous mutations were identified in 33% (8/24) of diffuse mesangial sclerosis (DMS) cases. PLCE1 mutations were found in 8% (6/78) of FSGS cases without NPHS2 mutations. (PMID:20591883)
• Silencing of PLCE1 might downregulate the level of MMP and BCL2 gene expression, decreasing the invasive power of bladder cancer T24 cells and thus inhibiting tumor development. (PMID:20620593)
• Shared susceptibility locus in PLCE1 at 10q23 for gastric adenocarcinoma and esophageal squamous cell carcinoma. (PMID:20729852)
• Suscptibility loci at PLCE1 for esophageal squamous cell carcinoma. (PMID:20729853)
• Case Report: Report respiratory-chain deficiency presenting as diffuse mesangial sclerosis with NPHS3 mutation. (PMID:21365190)
• Loss of PLCE1 is associated with colorectal cancer. (PMID:21667163)
• None of 3 SNPs was alone significantly associated with overall risk of SCCHN, the combined effects of rs2274223G, rs3203713G & rs11599672G were associated with risk of SCCHN in a locus-dose effect manner. (PMID:21689432)
• The knockdown of PLCepsilon by shRNA could inhibit bladder tumor growth and might be an alternative approach for human bladder cancer therapy (PMID:21705050)
• The PLCE1 single nucleotide polymorphism rs2274223 was associated with significantly improved gastric cancer survival in a Chinese population. (PMID:21837401)
• Significantly deregulated pathways in colorectal cancer were identified and repression of PLCD1 and PLCE1 expression, was validated. (PMID:21909432)
• These results suggest that PLCe constitutes a signaling pathway distinct from the NF-jB pathway and that this pathway and the NF-jB pathway exert a synergistic effect on the TNFa-stimulated CCL2 expression in keratinocytes. (PMID:21951843)
• identify two loci associated with susceptibility to DSS in people with dengue, suggesting possible mechanisms for this severe complication of dengue (PMID:22001756)
• Single Nucleotide Polymorphisms in PLCE1 resulting in reduce gene expression are associated with esophageal squamous cell carcinoma. (PMID:22203178)
• genetic variations in PLCE1 may contribute to gastric adenocarcinoma risk in an eastern Chinese population. (PMID:22412849)
• These findings indicated that functional polymorphisms PLCE1 rs2274223 might contribute to esophageal cancer susceptibility. (PMID:22744421)
• rs2274223 polymorphisms in PLCE1 is associated with esophageal squamous cell carcinoma. (PMID:22805490)
• PLCE1 gene variants are associated with esophageal squamous cell carcinoma. (PMID:22865593)
• the PLCepsilon1 rs2274223 SNP might be an effective genetic marker to assess the risk of esophageal squamous cell carcinoma in individuals with a upper gastrointestinal cancer family history from a region of high incidence in northern China (PMID:23079034)
• It is unlikely that the PLCE1 rs2274223 and RFT2 13042395 SNPs play a role in esophageal adenocarcinoma or esophageal squamous cell carcinoma susceptibility in Dutch Caucasians. (PMID:23222411)
• A sequence variant in the phospholipase C epsilon C2 domain is associated with esophageal carcinoma and esophagitis. (PMID:23390063)
• the MICB rs3132468 and PLCE1 rs3740360 genotypes are associated with clinically apparent dengue in both adults and children. (PMID:23536857)
• PLCE1 overexpression correlates with lymph node metastasis and advanced tumor-node-metastasis stages of Kazakh esophageal squamous cell carcinoma. (PMID:23659763)
• Results further confirmed that genetic variations in PLCE1 may contribute to ESCC risk associated with tobacco exposure in a central Chinese population. (PMID:23688607)
• Studies suggest phospholipase C epsilon 1 gene (PLCE1) polymorphism conferred significant risk among Asian (Chinese) but not in Caucasian. (PMID:23797815)
• the PLCE1 rs2274223 polymorphism was confirmed to have a statistically significant association with an increasing risk of squamous cell carcinoma and gastric cancer. (PMID:23826241)
• Meta-analysis results indicated that PLCE1 rs2274223 G allele significantly contributed to the risk of ESCC and GCA, especially in Chinese population. (PMID:23874915)
• PLCvarepsilon and the RASSF family play roles in tumour suppression. [review] (PMID:23958207)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	plce1	ENSDARG00000087921
mus_musculus	Plce1	ENSMUSG00000024998
rattus_norvegicus	Plce1	ENSRNOG00000014276
drosophila_melanogaster	Plc21C	FBGN0004611
caenorhabditis_elegans		WBGENE00004036

Paralogs (14): PLCB4 (ENSG00000101333), PLCH1 (ENSG00000114805), PLCD4 (ENSG00000115556), PLCL1 (ENSG00000115896), PLCG1 (ENSG00000124181), PLCB2 (ENSG00000137841), PLCZ1 (ENSG00000139151), PLCH2 (ENSG00000149527), PLCB3 (ENSG00000149782), PLCL2 (ENSG00000154822), PLCD3 (ENSG00000161714), PLCB1 (ENSG00000182621), PLCD1 (ENSG00000187091), PLCG2 (ENSG00000197943)

Protein

Protein identifiers

1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase epsilon-1 — Q9P212 (reviewed: Q9P212)

Alternative names: Pancreas-enriched phospholipase C, Phosphoinositide phospholipase C-epsilon-1, Phospholipase C-epsilon-1

All UniProt accessions (12): Q9P212, A0A6Q8PFG0, A0A6Q8PGT4, A0A6Q8PH04, A0A6Q8PHN3, A0A6Q8PHP9, A0A7I2PPM5, A0A8I5KQ92, A0A8I5KV08, A0A8I5KVG7, A0A8I5KXT2, B7ZM61

UniProt curated annotations — full annotation on UniProt →

Function. The production of the second messenger molecules diacylglycerol (DAG) and inositol 1,4,5-trisphosphate (IP3) is mediated by activated phosphatidylinositol-specific phospholipase C enzymes. PLCE1 is a bifunctional enzyme which also regulates small GTPases of the Ras superfamily through its Ras guanine-exchange factor (RasGEF) activity. As an effector of heterotrimeric and small G-protein, it may play a role in cell survival, cell growth, actin organization and T-cell activation. In podocytes, is involved in the regulation of lamellipodia formation. Acts downstream of AVIL to allow ARP2/3 complex assembly.

Subunit / interactions. Interacts with RHOA. Interacts with GTP-bound HRAS, RAP1A, RAP2A, RAP2B and RRAS. Interacts with AVIL. Interacts with IQGAP1.

Subcellular location. Cytoplasm. Cytosol. Cell membrane. Golgi apparatus membrane. Cell projection. Lamellipodium.

Tissue specificity. Widely expressed. Expressed in podocytes. Broadly expressed and only absent in peripheral blood leukocytes. Specifically expressed in placenta, lung and spleen.

Disease relevance. Nephrotic syndrome 3 (NPHS3) [MIM:610725] A form of nephrotic syndrome, a renal disease clinically characterized by severe proteinuria, resulting in complications such as hypoalbuminemia, hyperlipidemia and edema. Kidney biopsies show non-specific histologic changes such as focal segmental glomerulosclerosis and diffuse mesangial proliferation. Some affected individuals have an inherited steroid-resistant form and progress to end-stage renal failure. Most patients with NPHS3 show diffuse mesangial sclerosis on renal biopsy, which is a pathologic entity characterized by mesangial matrix expansion with no mesangial hypercellularity, hypertrophy of the podocytes, vacuolized podocytes, thickened basement membranes, and diminished patency of the capillary lumen. The disease is caused by variants affecting the gene represented in this entry.

Activity regulation. Activated by the heterotrimeric G-protein subunits GNA12, GNA13 and GNB1-GNG2. Activated by HRAS, RAP1A, RHOA, RHOB, RHOC, RRAS and RRAS2. Activated by the G(s)-coupled GPCRs ADRB2, PTGER1 and CHRM3 through cyclic-AMP formation and RAP2B activation. Inhibited by G(i)-coupled GPCRs.

Domain organisation. The Ras-associating domain 1 is degenerated and may not bind HRAS. The Ras-associating domain 2 mediates interaction with GTP-bound HRAS, RAP1A, RAP2A and RAP2B and recruitment of HRAS to the cell membrane. The Ras-GEF domain has a GEF activity towards HRAS and RAP1A. Mediates activation of the mitogen-activated protein kinase pathway.

Induction. Overexpressed during heart failure.

Isoforms (2)

UniProt ID	Names	Canonical?
Q9P212-1	1, PLCepsilon1a	yes
Q9P212-2	2, PLCepsilon1b

RefSeq proteins (3): NP_001159451, NP_001275918, NP_057425* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000008	C2_dom	Domain
IPR000159	RA_dom	Domain
IPR000909	PLipase_C_PInositol-sp_X_dom	Domain
IPR001192	PI-PLC_fam	Family
IPR001711	PLipase_C_Pinositol-sp_Y	Domain
IPR001895	RASGEF_cat_dom	Domain
IPR011992	EF-hand-dom_pair	Homologous_superfamily
IPR015359	PLC_EF-hand-like	Domain
IPR017946	PLC-like_Pdiesterase_TIM-brl	Homologous_superfamily
IPR023578	Ras_GEF_dom_sf	Homologous_superfamily
IPR028398	PLC-epsilon1_RA2	Domain
IPR029071	Ubiquitin-like_domsf	Homologous_superfamily
IPR035892	C2_domain_sf	Homologous_superfamily
IPR036964	RASGEF_cat_dom_sf	Homologous_superfamily
IPR046973	PLC-epsilon1_cat	Domain
IPR046974	PLC_epsilon1_EF	Domain

Pfam: PF00168, PF00387, PF00388, PF00617, PF00788, PF09279

Enzyme classification (BRENDA):

• EC 3.1.4.11 — phosphoinositide phospholipase C (BRENDA: 69 organisms, 175 substrates, 159 inhibitors, 27 Km, 0 kcat entries)

Substrate kinetics (BRENDA)

5 substrates with measured Km, best-characterized 5. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
1-PHOSPHATIDYL-1D-MYO-INOSITOL 4,5-BISPHOSPHATE	0.006–0.45	8
PHOSPHATIDYLINOSITOL	0.012–100	7
1-PHOSPHATIDYL-1D-MYO-INOSITOL	0.058–18.7	6
PHOSPHATIDYLINOSITOL 4,5-BISPHOSPHATE	0.031–0.182	3
PHOSPHATIDYLINOSITOL 4-PHOSPHATE	0.031	1

Catalyzed reactions (Rhea), 1 shown:

• a 1,2-diacyl-sn-glycero-3-phospho-(1D-myo-inositol-4,5-bisphosphate) + H2O = 1D-myo-inositol 1,4,5-trisphosphate + a 1,2-diacyl-sn-glycerol + H(+) (RHEA:33179)

UniProt features (75 total): strand 14, sequence conflict 11, compositionally biased region 9, sequence variant 8, mutagenesis site 7, domain 6, helix 6, region of interest 5, turn 3, active site 2, splice variant 2, chain 1, modified residue 1

Structure

Experimental structures (PDB)

3 structures.

PDB	Method	Resolution (Å)
2C5L	X-RAY DIFFRACTION	1.9
2BYE	SOLUTION NMR
2BYF	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9P212-F1	61.01	0.27

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (2): 1407; 1452

Post-translational modifications (1): 1096

Mutagenesis-validated functional residues (7):

Position	Phenotype
1452	loss of the phospholipase c enzymatic activity. still activates hras and the map kinase pathway.
2140	increases 2.8-fold the affinity for hras.
2148	decreases 17.5-fold the affinity for hras.
2148	increases 1.4-fold the affinity for hras.
2150	abolishes interaction with hras.
2171	no effect on hras-binding.
2174	reduces hras-binding.

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-1855204	Synthesis of IP3 and IP4 in the cytosol

MSigDB gene sets: 239 (showing top): GOBP_PHOSPHOLIPID_METABOLIC_PROCESS, GOBP_PHOSPHATIDYLINOSITOL_METABOLIC_PROCESS, DACOSTA_UV_RESPONSE_VIA_ERCC3_XPCS_DN, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, GOBP_ORGANOPHOSPHATE_METABOLIC_PROCESS, GOMF_GTPASE_BINDING, GOBP_REGULATION_OF_CELLULAR_COMPONENT_BIOGENESIS, GOBP_REGULATION_OF_LAMELLIPODIUM_ASSEMBLY, GOBP_MONOATOMIC_CATION_TRANSPORT, SENESE_HDAC1_AND_HDAC2_TARGETS_DN, GOBP_GLYCEROLIPID_METABOLIC_PROCESS, GOBP_POSITIVE_REGULATION_OF_CELLULAR_COMPONENT_BIOGENESIS, GOBP_REGULATION_OF_CELL_PROJECTION_ORGANIZATION, WOO_LIVER_CANCER_RECURRENCE_UP, SENGUPTA_NASOPHARYNGEAL_CARCINOMA_DN

GO Biological Process (16): diacylglycerol biosynthetic process (GO:0006651), epidermal growth factor receptor signaling pathway (GO:0007173), G protein-coupled receptor signaling pathway (GO:0007186), phospholipase C-activating G protein-coupled receptor signaling pathway (GO:0007200), Ras protein signal transduction (GO:0007265), positive regulation of lamellipodium assembly (GO:0010592), lipid catabolic process (GO:0016042), calcium-mediated signaling (GO:0019722), glomerulus development (GO:0032835), intracellular signal transduction (GO:0035556), phosphatidylinositol metabolic process (GO:0046488), phosphatidylinositol-mediated signaling (GO:0048015), release of sequestered calcium ion into cytosol (GO:0051209), lipid metabolic process (GO:0006629), signal transduction (GO:0007165), small GTPase-mediated signal transduction (GO:0007264)

GO Molecular Function (9): phosphatidylinositol-4,5-bisphosphate phospholipase C activity (GO:0004435), C-type glycerophospholipase activity (GO:0004629), guanyl-nucleotide exchange factor activity (GO:0005085), enzyme binding (GO:0019899), small GTPase binding (GO:0031267), metal ion binding (GO:0046872), protein binding (GO:0005515), phosphoric diester hydrolase activity (GO:0008081), hydrolase activity (GO:0016787)

GO Cellular Component (8): Golgi membrane (GO:0000139), cytosol (GO:0005829), plasma membrane (GO:0005886), lamellipodium (GO:0030027), cytoplasm (GO:0005737), Golgi apparatus (GO:0005794), membrane (GO:0016020), cell projection (GO:0042995)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Inositol phosphate metabolism	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	4
signal transduction	2
intracellular signaling cassette	2
intracellular anatomical structure	2
cytoplasm	2
diacylglycerol metabolic process	1
acylglycerol biosynthetic process	1
ERBB signaling pathway	1
G protein-coupled receptor activity	1
G protein-coupled receptor signaling pathway	1
phospholipase C activator activity	1
small GTPase-mediated signal transduction	1
regulation of lamellipodium assembly	1
lamellipodium assembly	1
positive regulation of plasma membrane bounded cell projection assembly	1
positive regulation of lamellipodium organization	1
lipid metabolic process	1
catabolic process	1
anatomical structure development	1
nephron development	1
phosphorus metabolic process	1
intracellular signal transduction	1
intercellular transport	1
calcium ion transmembrane import into cytosol	1
primary metabolic process	1
cell communication	1
cellular process	1
signaling	1
regulation of cellular process	1
cellular response to stimulus	1
C-type glycerophospholipase activity	1
glycerophospholipase activity	1
phosphoric diester hydrolase activity	1
GTP binding	1
GDP binding	1
GTPase regulator activity	1
protein binding	1
GTPase binding	1
cation binding	1
binding	1

Protein interactions and networks

STRING

1520 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
PLCE1	NPHS1	O60500	948
PLCE1	NPHS2	Q9NP85	943
PLCE1	INF2	Q27J81	920
PLCE1	CD2AP	Q9Y5K6	913
PLCE1	TRPC6	Q9Y210	877
PLCE1	SLC52A3	Q9NQ40	855
PLCE1	ACTN4	O43707	824
PLCE1	WT1	P19544	823
PLCE1	APOL1	O14791	775
PLCE1	COQ6	Q9Y2Z9	652
PLCE1	IQGAP1	P46940	605
PLCE1	NOC3L	Q8WTT2	603
PLCE1	COQ2	Q96H96	599
PLCE1	DLEC1	Q9Y238	589
PLCE1	COQ8B	Q96D53	571
PLCE1	PDSS2	Q86YH6	571

IntAct

11 interactions, top by confidence:

A	B	Type	Score
CSNK1A1	FAM83G	psi-mi:“MI:0914”(association)	0.900
FKBP5	IKBKB	psi-mi:“MI:0914”(association)	0.640
HSP90AA1	USP19	psi-mi:“MI:0914”(association)	0.530
PLCE1	H1-0	psi-mi:“MI:0915”(physical association)	0.400
M		psi-mi:“MI:0914”(association)	0.350
HSP90AA1	URI1	psi-mi:“MI:0914”(association)	0.350
CDC37	MAP2K7	psi-mi:“MI:0914”(association)	0.350
LIMS1	PLCE1	psi-mi:“MI:0915”(physical association)	0.000
PLCE1	NRAS	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (29): PLCE1 (Affinity Capture-MS), PLCE1 (Affinity Capture-MS), PLCE1 (Affinity Capture-RNA), PLCE1 (Synthetic Lethality), NRAS (Two-hybrid), PLCE1 (Proximity Label-MS), PLCE1 (Two-hybrid), PLCE1 (Two-hybrid), MDM2 (Affinity Capture-Western), TP53 (Affinity Capture-Western), PLCE1 (Affinity Capture-MS), PLCE1 (Affinity Capture-MS), PLCE1 (Affinity Capture-MS), PLCE1 (Affinity Capture-MS), PLCE1 (Cross-Linking-MS (XL-MS))

ESM2 similar proteins: A0A1L8EYB2, A0JMF7, A2AHC3, A3KMW7, A5D8S0, A5WUN7, B0S6S9, D3Z8E6, D3Z987, F1M5M3, F1MJR8, F1QB81, P70347, P97412, Q0P5X5, Q0VET5, Q15468, Q2M2Z5, Q2T9I9, Q3UEN2, Q3V0M2, Q49A88, Q49AJ0, Q5CZC0, Q5RA75, Q5RHB5, Q5SW75, Q5T5Y3, Q60664, Q6JPI3, Q6NRK3, Q6PUR7, Q71F56, Q76I76, Q7M6U3, Q7TSH4, Q8C753, Q8CCC3, Q8IWB6, Q8K2J4

Diamond homologs: A2AP18, A3KGF7, A5D6R3, G5EBH0, G5EFI8, O75038, O89040, P10687, P10688, P10894, P10895, P21671, P25455, P51178, P51432, Q00722, Q01970, Q07722, Q15111, Q15147, Q1RML2, Q2VRL0, Q32NH8, Q3USB7, Q4KWH5, Q4KWH8, Q4R6L3, Q5FX52, Q5RET0, Q62688, Q62711, Q6NMA7, Q7YRU3, Q86YW0, Q8K2J0, Q8K394, Q8K3R3, Q8K4D7, Q8K4S1, Q8L706

SIGNOR signaling

7 interactions.

A	Effect	B	Mechanism
CXCL1	up-regulates	PLCE1	binding
GNAQ	up-regulates	PLCE1	binding
GNG12	up-regulates	PLCE1	binding
PLCE1	up-regulates	1,2-diacyl-sn-glycerol	“chemical modification”
RAP1A	“up-regulates quantity”	PLCE1	binding
PLCE1	up-regulates	HRAS	“guanine nucleotide exchange factor”
PLCE1	up-regulates	PRKCA

Disease & clinical

Clinical variants and AI predictions

ClinVar

922 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	34
Likely pathogenic	23
Uncertain significance	524
Likely benign	189
Benign	62

Top pathogenic / likely-pathogenic (30)

Variant ID	HGVS	Classification
1073097	NM_016341.4(PLCE1):c.4192dup (p.Leu1398fs)	Pathogenic
1179035	NM_016341.4(PLCE1):c.4363dup (p.Thr1455fs)	Pathogenic
1392260	NM_016341.4(PLCE1):c.1339C>T (p.Arg447Ter)	Pathogenic
1683685	NM_016341.4(PLCE1):c.4477C>T (p.Gln1493Ter)	Pathogenic
1686081	NM_016341.4(PLCE1):c.1148C>A (p.Ser383Ter)	Pathogenic
1686082	NM_016341.4(PLCE1):c.5168-1G>A	Pathogenic
1687166	NM_016341.4(PLCE1):c.5363dup (p.Tyr1788Ter)	Pathogenic
18423	NM_016341.4(PLCE1):c.961C>T (p.Arg321Ter)	Pathogenic
18424	NM_016341.4(PLCE1):c.3736C>T (p.Arg1246Ter)	Pathogenic
1929666	NM_016341.4(PLCE1):c.5979del (p.Gly1994fs)	Pathogenic
2344	NM_016341.4(PLCE1):c.1146del (p.Ser383fs)	Pathogenic
2345	NM_016341.4(PLCE1):c.1477C>T (p.Arg493Ter)	Pathogenic
2346	NM_016341.4(PLCE1):c.3346C>T (p.Arg1116Ter)	Pathogenic
2347	NM_016341.4(PLCE1):c.3846del (p.Leu1283fs)	Pathogenic
2348	NM_016341.4(PLCE1):c.4846C>T (p.Gln1616Ter)	Pathogenic
2349	NM_016341.4(PLCE1):c.5560C>T (p.Gln1854Ter)	Pathogenic
2350	NM_016341.4(PLCE1):c.4451C>T (p.Ser1484Leu)	Pathogenic
2577455	NM_016341.4(PLCE1):c.1350_1353del (p.Cys451fs)	Pathogenic
2579200	GRCh38/hg38 10q23.33(chr10:94131004-94133482)x0	Pathogenic
2582223	NM_016341.4(PLCE1):c.3610C>T (p.Gln1204Ter)	Pathogenic
2681758	NM_016341.4(PLCE1):c.5078_5079insGAGGAAAAGG (p.Ser1696fs)	Pathogenic
2735459	NM_016341.4(PLCE1):c.3169C>T (p.Arg1057Ter)	Pathogenic
3076006	NM_016341.4(PLCE1):c.1845dup (p.Gly616fs)	Pathogenic
3244993	NC_000010.10:g.(?96068318)(96076533_?)del	Pathogenic
3376124	NM_016341.4(PLCE1):c.3768del (p.Asn1257fs)	Pathogenic
3700247	NM_016341.4(PLCE1):c.2872_2873del (p.Val958fs)	Pathogenic
3764576	NM_016341.4(PLCE1):c.3982C>T (p.Gln1328Ter)	Pathogenic
3775222	NM_016341.4(PLCE1):c.5407del (p.Met1803fs)	Pathogenic
4277922	NM_016341.4(PLCE1):c.1115T>A (p.Leu372Ter)	Pathogenic
4293375	NM_016341.4(PLCE1):c.789C>A (p.Tyr263Ter)	Pathogenic

SpliceAI

6840 predictions. Top by Δscore:

Variant	Effect	Δscore
10:94132169:CACA:C	acceptor_loss	1.0000
10:94132171:CAGAT:C	acceptor_loss	1.0000
10:94132172:A:AG	acceptor_gain	1.0000
10:94132172:AG:A	acceptor_loss	1.0000
10:94132173:G:GA	acceptor_loss	1.0000
10:94132173:G:GG	acceptor_gain	1.0000
10:94132173:GAT:G	acceptor_gain	1.0000
10:94132457:AAGG:A	donor_loss	1.0000
10:94132461:T:A	donor_loss	1.0000
10:94171176:TTAG:T	acceptor_loss	1.0000
10:94171177:TAG:T	acceptor_loss	1.0000
10:94171178:A:AC	acceptor_loss	1.0000
10:94171178:A:AG	acceptor_gain	1.0000
10:94171179:G:GG	acceptor_gain	1.0000
10:94171179:GAAC:G	acceptor_gain	1.0000
10:94171495:AGGT:A	donor_loss	1.0000
10:94171496:GGTAA:G	donor_loss	1.0000
10:94171497:G:C	donor_loss	1.0000
10:94171498:T:G	donor_loss	1.0000
10:94227300:TTCCA:T	acceptor_loss	1.0000
10:94227301:TCCA:T	acceptor_loss	1.0000
10:94227302:CCAGG:C	acceptor_loss	1.0000
10:94227303:CAG:C	acceptor_loss	1.0000
10:94227304:AGG:A	acceptor_loss	1.0000
10:94227305:G:A	acceptor_loss	1.0000
10:94227431:G:GT	donor_gain	1.0000
10:94235911:GTAGT:G	acceptor_loss	1.0000
10:94235912:TAG:T	acceptor_loss	1.0000
10:94235913:A:AG	acceptor_gain	1.0000
10:94235913:A:C	acceptor_loss	1.0000

AlphaMissense

15274 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
10:94258907:T:C	L1221P	1.000
10:94262587:C:A	A1303D	1.000
10:94265901:T:A	N1408K	1.000
10:94265901:T:G	N1408K	1.000
10:94265909:T:C	L1411P	1.000
10:94268963:A:C	D1439A	1.000
10:94268963:A:T	D1439V	1.000
10:94268965:T:C	C1440R	1.000
10:94268967:C:G	C1440W	1.000
10:94268968:T:A	W1441R	1.000
10:94268968:T:C	W1441R	1.000
10:94268970:G:C	W1441C	1.000
10:94268970:G:T	W1441C	1.000
10:94269005:G:A	G1453E	1.000
10:94270553:A:T	E1486V	1.000
10:94270557:C:A	N1487K	1.000
10:94270557:C:G	N1487K	1.000
10:94270558:C:G	H1488D	1.000
10:94270561:T:C	C1489R	1.000
10:94270562:G:A	C1489Y	1.000
10:94270563:T:G	C1489W	1.000
10:94270578:A:C	Q1494H	1.000
10:94270578:A:T	Q1494H	1.000
10:94273669:A:C	K1538N	1.000
10:94273669:A:T	K1538N	1.000
10:94273675:G:C	K1540N	1.000
10:94273675:G:T	K1540N	1.000
10:94284924:T:C	L1665P	1.000
10:94321974:T:A	V2139D	1.000
10:94321989:T:A	V2144D	1.000

dbSNP variants (sampled 300 via entrez): RS1000002164 (10:94106063 C>T), RS1000010861 (10:94039029 C>T), RS1000027776 (10:94132506 G>A), RS1000031117 (10:94201529 G>A,T), RS1000033642 (10:94017841 A>G), RS1000033994 (10:94049121 A>G), RS1000034751 (10:94106406 G>T), RS1000036893 (10:94242325 A>G), RS1000039960 (10:94179471 T>C,G), RS1000066778 (10:94052699 T>C), RS1000079453 (10:94032524 C>A), RS1000083032 (10:94141487 G>A), RS1000084378 (10:94223024 T>C), RS1000099142 (10:94228310 TAGGAATCAAATCCTTATCC>T), RS1000099984 (10:94078184 G>A,T)

Disease associations

OMIM: gene MIM:608414 | disease phenotypes: MIM:610725, MIM:173900, MIM:256300

GenCC curated gene-disease

Disease	Classification	Inheritance
nephrotic syndrome, type 3	Definitive	Autosomal recessive
familial idiopathic steroid-resistant nephrotic syndrome	Supportive	Autosomal dominant

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
nephrotic syndrome, type 3	Definitive	AR

Mondo (9): nephrotic syndrome, type 3 (MONDO:0012546), proteinuria (MONDO:0003634), kidney disorder (MONDO:0005240), focal segmental glomerulosclerosis (MONDO:0100313), nephrotic syndrome (MONDO:0005377), polycystic kidney disease (MONDO:0020642), congenital nephrotic syndrome, Finnish type (MONDO:0009732), glomerulonephritis (MONDO:0002462), familial idiopathic steroid-resistant nephrotic syndrome (MONDO:0019006)

Orphanet (2): Hereditary steroid-resistant nephrotic syndrome (Orphanet:656), Congenital nephrotic syndrome, Finnish type (Orphanet:839)

HPO phenotypes

23 total (24 of 23 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000093	Proteinuria
HP:0000097	Focal segmental glomerulosclerosis
HP:0000100	Nephrotic syndrome
HP:0000707	Abnormality of the nervous system
HP:0000737	Irritability
HP:0000969	Edema
HP:0001945	Fever
HP:0001967	Diffuse mesangial sclerosis
HP:0002027	Abdominal pain
HP:0002315	Headache
HP:0002586	Peritonitis
HP:0003073	Hypoalbuminemia
HP:0003593	Infantile onset
HP:0003621	Juvenile onset
HP:0003676	Progressive
HP:0003774	Stage 5 chronic kidney disease
HP:0011463	Childhood onset
HP:0011947	Respiratory tract infection
HP:0012579	Minimal change glomerulonephritis
HP:0012622	Chronic kidney disease
HP:0031504	Foamy urine
HP:0100539	Periorbital edema
HP:0000099	Glomerulonephritis

GWAS associations

88 associations (top):

Study	Trait	p-value
GCST000777_1	Esophageal cancer and gastric cancer	2.000000e-09
GCST000777_3	Esophageal cancer and gastric cancer	4.000000e-09
GCST000995_4	Personality traits in bipolar disorder	4.000000e-08
GCST001089_7	Esophageal cancer	4.000000e-20
GCST001099_31	Sudden cardiac arrest	4.000000e-07
GCST001112_2	Lifetime average cigarettes per day in chronic obstructive pulmonary disease	4.000000e-07
GCST001227_18	Systolic blood pressure	7.000000e-16
GCST001228_14	Diastolic blood pressure	8.000000e-07
GCST001238_2	Hypertension	9.000000e-09
GCST001278_3	Dengue shock syndrome	3.000000e-10
GCST002568_6	Esophageal squamous cell carcinoma	4.000000e-18
GCST002626_7	Vertical cup-disc ratio	1.000000e-09
GCST002726_2	Glucose homeostasis traits	5.000000e-06
GCST002726_29	Glucose homeostasis traits	3.000000e-06
GCST003720_19	Migraine	6.000000e-09
GCST003720_30	Migraine	2.000000e-14
GCST003986_11	Migraine	1.000000e-09
GCST004567_27	Waist-to-hip ratio adjusted for BMI (joint analysis for main effect and physical activity interaction)	1.000000e-08
GCST004567_89	Waist-to-hip ratio adjusted for BMI (joint analysis for main effect and physical activity interaction)	1.000000e-08
GCST004576_141	Waist-to-hip ratio adjusted for body mass index	5.000000e-06
GCST004576_142	Waist-to-hip ratio adjusted for body mass index	2.000000e-08
GCST004576_143	Waist-to-hip ratio adjusted for body mass index	3.000000e-09
GCST004607_120	Plateletcrit	9.000000e-12
GCST004775_29	Pulse pressure	6.000000e-08
GCST004776_54	Systolic blood pressure	1.000000e-07
GCST005194_71	Coronary artery disease	2.000000e-06
GCST006065_38	Glaucoma (primary open-angle)	2.000000e-08
GCST006258_15	Diastolic blood pressure	6.000000e-10
GCST006259_62	Systolic blood pressure	7.000000e-17
GCST007094_130	Diastolic blood pressure	1.000000e-07

EFO canonical traits (23, from GWAS)

EFO ID	Trait name
EFO:0004365	personality trait
EFO:0004278	sudden cardiac arrest
EFO:0006335	systolic blood pressure
EFO:0006336	diastolic blood pressure
EFO:0004471	insulin sensitivity measurement
EFO:0007788	BMI-adjusted waist-hip ratio
EFO:0008002	physical activity measurement
EFO:0007985	platelet crit
EFO:0005763	pulse pressure measurement
EFO:0004341	body fat distribution
EFO:0600040	plasma clozapine-to-N-desmethylclozapine ratio measurement
EFO:0009930	Calcium channel blocker use measurement
EFO:0009931	Agents acting on the renin-angiotensin system use measurement
EFO:0004344	birth weight
EFO:0005939	parental genotype effect measurement
EFO:0007859	response to interferon
EFO:0006939	cup-to-disc ratio measurement
EFO:0004327	electrocardiography
EFO:0004980	appendicular lean mass
EFO:0004587	lymphocyte count
EFO:0005091	monocyte count
EFO:0008039	BMI-adjusted hip circumference
EFO:0007797	language measurement

MeSH disease descriptors (6)

Descriptor	Name	Tree numbers
D005921	Glomerulonephritis	C12.050.351.968.419.570.363; C12.200.777.419.570.363; C12.950.419.570.363
D005923	Glomerulosclerosis, Focal Segmental	C12.050.351.968.419.570.363.640; C12.200.777.419.570.363.660; C12.950.419.570.363.640
D007674	Kidney Diseases	C12.050.351.968.419; C12.200.777.419; C12.950.419
D009404	Nephrotic Syndrome	C12.050.351.968.419.630.643; C12.200.777.419.630.643; C12.950.419.630.643
D007690	Polycystic Kidney Diseases	C12.050.351.968.419.403.875; C12.200.777.419.403.875; C12.950.419.403.875; C16.131.077.717; C16.320.184.625
D011507	Proteinuria	C12.050.351.968.934.734; C12.200.777.934.734; C12.950.934.734; C23.888.942.750

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

PharmGKB clinical annotations

1 annotations.

Variant	Type	Level	Drugs	Phenotypes
rs932764	Efficacy	3	hydrochlorothiazide	Hypertension

PharmGKB variants

1 variants.

Variant	Genes	Level	Score	#Clin annots	Drugs
rs932764	PLCE1	3	3.00	1	hydrochlorothiazide

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: enzyme — Phosphoinositide-specific phospholipase C

CTD chemical–gene interactions

53 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects cotreatment, increases expression	7
sodium arsenite	affects methylation, decreases expression, decreases methylation, affects cotreatment, increases abundance (+1 more)	4
trichostatin A	affects cotreatment, increases expression	3
manganese chloride	decreases expression, increases abundance, increases expression, affects cotreatment	2
potassium chromate(VI)	affects cotreatment, decreases expression	2
mercuric bromide	increases expression, affects cotreatment	2
chromium hexavalent ion	decreases expression, increases abundance	2
Panobinostat	affects cotreatment, increases expression	2
Arsenic	affects methylation, affects cotreatment, decreases expression, increases abundance	2
Benzo(a)pyrene	decreases expression, increases methylation, affects methylation	2
Manganese	increases expression, affects cotreatment, decreases expression, increases abundance	2
Nickel	decreases expression	2
Phenylmercuric Acetate	affects cotreatment, increases expression	2
triphenyl phosphate	affects expression	1
bisphenol A	decreases methylation	1
quercitrin	affects expression	1
sulforaphane	decreases expression	1
perfluorooctanoic acid	increases expression	1
zinc chromate	decreases expression, increases abundance	1
doxifluridine	increases response to substance	1
nickel sulfate	decreases expression	1
1-UFT protocol	increases response to substance	1
epigallocatechin gallate	increases expression, affects cotreatment, decreases expression	1
di-n-butylphosphoric acid	affects expression	1
CGP 52608	affects binding, increases reaction	1
perfluoro-n-nonanoic acid	increases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
belinostat	decreases expression	1
abrine	decreases expression	1
dorsomorphin	affects cotreatment, increases expression	1

Cellosaurus cell lines

3 cell lines: 3 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_TE33	HAP1 PLCE1 (-) 1	Cancer cell line	Male
CVCL_TE34	HAP1 PLCE1 (-) 2	Cancer cell line	Male
CVCL_TE35	HAP1 PLCE1 (-) 3	Cancer cell line	Male

Clinical trials (associated diseases)

296 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00067990	PHASE4	COMPLETED	Angiotensin II Blockade for Chronic Allograft Nephropathy
NCT00234871	PHASE4	COMPLETED	Tarka® vs. Lotrel® in Hypertensive, Diabetic Subjects With Renal Disease (TANDEM)
NCT00241085	PHASE4	COMPLETED	Effect of Valsartan on Proteinuria in Patients With Hypertension and Diabetes Mellitus
NCT00369538	PHASE4	SUSPENDED	Specific Blockage of Angiotensine 2 and Podocyturia in Glomerular Nephropathies With Hypertension and Proteinuria
NCT00508898	PHASE4	WITHDRAWN	The Efficacy and Safety of Calcitriol for the Treatment of Lupus Nephritis and Persistent Proteinuria
NCT00550095	PHASE4	COMPLETED	To Assess the Effects of Valsartan on Albuminuria/Proteinuria in Hypertensive Patients With Type 2 Diabetes Mellitus
NCT00674596	PHASE4	COMPLETED	The Effect of Renin Angiotensin System Blockage (RAS) Blockade On PTX3 Levels In Diabetic Patients With Proteinuria
NCT00858299	PHASE4	UNKNOWN	The Change of Urinary Angiotensinogen Excretion After Valsartan Treatment in Patients With Persistent Proteinuria
NCT00893425	PHASE4	COMPLETED	Effect of Renin Angiotensin System Blockade on the Fas Antigen (CD95) and Asymmetric Dimethylarginine (ADMA) Levels in Type-2 Diabetic Patients With Proteinuria
NCT00921570	PHASE4	COMPLETED	The Effects of Renin Angiotensin System Blockage (RAS), Calcium Channel Blocker and Combined Drugs on TWEAK, PTX3 and FMD Levels in Diabetic Proteinuric Patients With Hypertension
NCT00961207	PHASE4	TERMINATED	Triple Blockade of the Renin Angiotensin Aldosterone System in Diabetic (Type 1&2) Proteinuric Patients
NCT01169857	PHASE4	WITHDRAWN	Velcade for Proliferative Lupus Nephritis
NCT01219413	PHASE4	COMPLETED	Influence of Aliskiren on Proteinuria
NCT01386554	PHASE4	COMPLETED	Acthar for Treatment of Proteinuria in Membranous Nephropathy Patients
NCT01512862	PHASE4	UNKNOWN	Anti-proteinuric Effect of Calcitriol in Non-diabetic Kidney Disease Patients
NCT01541267	PHASE4	COMPLETED	The Effect of Various Types of the Renin-angiotensin-aldosterone System Blockade on Proteinuria
NCT01637259	PHASE4	COMPLETED	MARCH Renal Substudy
NCT01703234	PHASE4	COMPLETED	FGF-23 and Endothelial Dysfunction in Diabetic Proteinuric Patients
NCT01820832	PHASE4	UNKNOWN	Oral Calcitriol for Reduction of Mild Proteinuria in Patients With CKD
NCT01827202	PHASE4	COMPLETED	RAS Quantification in Patients With Aliskiren or Candesartan
NCT02057523	PHASE4	TERMINATED	Acthar as Rescue Therapy for Transplant Glomerulopathy in Kidney Transplant Recipients
NCT02063100	PHASE4	UNKNOWN	Efficacy and Safety of Shenyankangfu Tablets for Primary Glomerulonephritis
NCT02382523	PHASE4	WITHDRAWN	Acthar on Proteinuria in IgA Nephropathy Patients
NCT02522650	PHASE4	UNKNOWN	A Crossover Pilot Study of the Effect of Amiloride on Proteinuria
NCT03195023	PHASE4	UNKNOWN	Effect of RAS Blockers on CKD Progression in Elderly Patients With Non Proteinuric Nephropathies (PROERCAN01)
NCT03550859	PHASE4	UNKNOWN	HMG-CoA Reductase add-on in Chronic Kidney Disease Patients With Proteinuria
NCT03983551	PHASE4	COMPLETED	Comparing the Renal Effect of Dipeptidyl-peptidase 4 Inhibitors and Sulfonylureas
NCT04531397	PHASE4	WITHDRAWN	Efficacy and Safety of Dapagliflozin in Children With Proteinuric Chronic Kidney Disease
NCT04534270	PHASE4	COMPLETED	Efficacy and Safety of Dapagliflozin in Children With Proteinuria
NCT06374043	PHASE4	COMPLETED	Decentralized N=1 Study: A Feasible Approach to Evaluate Individual Therapy Response to Dapagliflozin.
NCT07030894	PHASE4	RECRUITING	Nefecon and Ambrisentan in IgA Nephropathy
NCT07219121	PHASE4	RECRUITING	Sparsentan in Posttransplant Immunoglobulin A Nephropathy or Focal Segmental Glomerulosclerosis
NCT07358520	PHASE4	NOT_YET_RECRUITING	Clinical Study on the Use of Huaier Granules for the Treatment of Proteinuria Related to Bevacizumab and Anlotinib in Lung Cancer Patients
NCT00117078	PHASE4	COMPLETED	Aranesp® Monthly Preference Study - 2
NCT00117130	PHASE4	COMPLETED	Study to Evaluate Effectiveness of Aranesp®
NCT00132431	PHASE4	COMPLETED	START: Sensipar Treatment Algorithm to Reach K/DOQI Targets in Chronic Kidney Disease Subjects With Secondary Hyperparathyroidism
NCT00140985	PHASE4	COMPLETED	Antiproteinuric Efficacy of Losartan Potassium in Patients With Non-Diabetic Proteinuric Renal Diseases (0954-213)
NCT00246129	PHASE4	COMPLETED	CamTac Trial:Campath-Tacrolimus vs IL2R MoAb/Tacrolimus/MMF in Renal Transplantation
NCT00275535	PHASE4	COMPLETED	The Comparison of Tacrolimus and Sirolimus Immunosuppression Based Drug Regimens in Kidney Transplant Recipients
NCT00282217	PHASE4	COMPLETED	Study Evaluating Sirolimus in the Treatment of Kidney Transplant