PLEKHN1

Summary

PLEKHN1 (pleckstrin homology domain containing N1, HGNC:25284) is a protein-coding gene on chromosome 1p36.33, encoding Pleckstrin homology domain-containing family N member 1 (Q494U1). Controls the stability of the leptin mRNA harboring an AU-rich element (ARE) in its 3’ UTR, in cooperation with the RNA stabilizer ELAVL1.

Enables phospholipid binding activity. Involved in 3’-UTR-mediated mRNA destabilization; positive regulation of apoptotic process; and response to hypoxia. Located in several cellular components, including cytoskeleton; cytosol; and mitochondrial membrane.

Source: NCBI Gene 84069 — RefSeq curated summary.

At a glance

• Gene–disease (curated): hereditary sensory and autonomic neuropathy (Limited, GenCC)
• GWAS associations: 2
• Clinical variants (ClinVar): 191 total
• MANE Select transcript: NM_032129

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:25284
Approved symbol	PLEKHN1
Name	pleckstrin homology domain containing N1
Location	1p36.33
Locus type	gene with protein product
Status	Approved
Aliases	DKFZP434H2010
Ensembl gene	ENSG00000187583
Ensembl biotype	protein_coding
OMIM	621052
Entrez	84069

Gene structure

Transcript identifiers

Ensembl transcripts: 12 — 11 protein_coding, 1 retained_intron

ENST00000379407, ENST00000379409, ENST00000379410, ENST00000480267, ENST00000491024, ENST00000880608, ENST00000880609, ENST00000880610, ENST00000880611, ENST00000880612, ENST00000959612, ENST00000959613

RefSeq mRNA: 4 — MANE Select: NM_032129 NM_001160184, NM_001367552, NM_001410697, NM_032129

CCDS: CCDS4, CCDS53256, CCDS90835

Canonical transcript exons

ENST00000379410 — 16 exons

Exon	Start	End
ENSE00001363936	966482	966614
ENSE00001364180	966704	966803
ENSE00001365628	972288	972424
ENSE00001368630	971113	971208
ENSE00001370044	974316	974364
ENSE00001371226	973833	974051
ENSE00001371278	973500	973640
ENSE00001373621	970277	970423
ENSE00001374286	970521	970601
ENSE00001374990	970879	971006
ENSE00001375540	972075	972150
ENSE00001377573	973186	973326
ENSE00001380204	971324	971404
ENSE00001385460	970686	970758
ENSE00001386720	972861	973010
ENSE00001919329	974442	975865

Expression profiles

Bgee: expression breadth ubiquitous, 146 present calls, max score 97.50.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 3.1607 / max 115.3227, expressed in 1048 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
42	3.1607	1048

Top tissues by expression

221 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
lower esophagus mucosa	UBERON:0035834	97.50	gold quality
esophagus mucosa	UBERON:0002469	93.07	gold quality
skin of abdomen	UBERON:0001416	92.21	gold quality
skin of leg	UBERON:0001511	91.67	gold quality
tendon of biceps brachii	UBERON:0008188	91.06	silver quality
buccal mucosa cell	CL:0002336	89.16	silver quality
zone of skin	UBERON:0000014	88.98	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	86.72	gold quality
nipple	UBERON:0002030	85.23	silver quality
upper arm skin	UBERON:0004263	84.72	gold quality
pancreatic ductal cell	CL:0002079	84.24	silver quality
vena cava	UBERON:0004087	83.61	silver quality
pharyngeal mucosa	UBERON:0000355	83.50	silver quality
biceps brachii	UBERON:0001507	81.57	gold quality
vagina	UBERON:0000996	81.53	gold quality
trabecular bone tissue	UBERON:0002483	81.07	silver quality
cerebellar vermis	UBERON:0004720	80.20	silver quality
kidney epithelium	UBERON:0004819	80.20	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	78.92	gold quality
heart right ventricle	UBERON:0002080	78.67	gold quality
epithelial cell of pancreas	CL:0000083	78.26	gold quality
middle temporal gyrus	UBERON:0002771	78.14	gold quality
vastus lateralis	UBERON:0001379	78.12	gold quality
medial globus pallidus	UBERON:0002477	77.84	gold quality
cartilage tissue	UBERON:0002418	77.80	gold quality
sperm	CL:0000019	77.79	gold quality
quadriceps femoris	UBERON:0001377	77.67	gold quality
pons	UBERON:0000988	77.33	silver quality
globus pallidus	UBERON:0001875	77.23	gold quality
gingival epithelium	UBERON:0001949	77.19	silver quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	4.48

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

5 targeting PLEKHN1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6793-5P	99.97	65.95	758
HSA-MIR-4795-5P	99.11	66.90	876
HSA-MIR-4725-5P	98.67	65.42	628
HSA-MIR-504-5P	98.67	65.40	631
HSA-MIR-4732-3P	97.15	65.45	881

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Plekhn1	ENSMUSG00000078485
rattus_norvegicus	Plekhn1	ENSRNOG00000020295

Paralogs (22): TRIO (ENSG00000038382), MCF2L2 (ENSG00000053524), PLEKHG2 (ENSG00000090924), MCF2 (ENSG00000101977), ARHGEF7 (ENSG00000102606), PLEKHG1 (ENSG00000120278), MCF2L (ENSG00000126217), ARHGEF6 (ENSG00000129675), ARHGEF9 (ENSG00000131089), VAV3 (ENSG00000134215), VAV1 (ENSG00000141968), TIAM2 (ENSG00000146426), KIAA1755 (ENSG00000149633), PLEKHG4B (ENSG00000153404), TIAM1 (ENSG00000156299), KALRN (ENSG00000160145), VAV2 (ENSG00000160293), ARHGEF40 (ENSG00000165801), SPATA13 (ENSG00000182957), SESTD1 (ENSG00000187231), PLEKHG4 (ENSG00000196155), ARHGEF25 (ENSG00000240771)

Protein

Protein identifiers

Pleckstrin homology domain-containing family N member 1 — Q494U1 (reviewed: Q494U1)

Alternative names: Cardiolipin and phosphatidic acid-binding protein

All UniProt accessions (2): Q494U1, J3KSM5

UniProt curated annotations — full annotation on UniProt →

Function. Controls the stability of the leptin mRNA harboring an AU-rich element (ARE) in its 3’ UTR, in cooperation with the RNA stabilizer ELAVL1. Decreases the stability of the leptin mRNA by antagonizing the function of ELAVL1 by inducing its atypical recruitment from the nucleus to the cytosol. Binds to cardiolipin (CL), phosphatidic acid (PA), phosphatidylinositol 4-phosphate (PtdIns(4)P) and phosphatidylserine (PS). Promotes apoptosis by enhancing BAX-BAK hetero-oligomerization via interaction with BID in colon cancer cells.

Subunit / interactions. Found in a complex with cytochrome c mRNA and various ribosomal proteins. Interacts with C1QBP. Interacts with ELAVL1. Interacts with BID.

Subcellular location. Cell membrane. Mitochondrion. Mitochondrion membrane.

Tissue specificity. Ubiquitous. Epressed in several cancer cell lines of differing origin.

Post-translational modifications. Phosphorylation is essential for its mitochondrial localization and regulates its interaction with C1QBP.

Domain organisation. Both PH domains are essential for its mitochondrial localization.

Induction. Up-regulated by hypoxia.

Isoforms (3)

UniProt ID	Names	Canonical?
Q494U1-1	1	yes
Q494U1-2	2
Q494U1-3	3

RefSeq proteins (4): NP_001153656, NP_001354481, NP_001397626, NP_115505* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001849	PH_domain	Domain
IPR011993	PH-like_dom_sf	Homologous_superfamily
IPR037839	PLEKHN1_PH	Domain
IPR042835	PLEKHN1	Family

UniProt features (25 total): region of interest 5, compositionally biased region 4, modified residue 3, splice variant 3, mutagenesis site 3, domain 2, initiator methionine 1, chain 1, lipid moiety-binding region 1, sequence variant 1, sequence conflict 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q494U1-F1	54.31	0.06

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (4): 302, 456, 559, 2

Mutagenesis-validated functional residues (3):

Position	Phenotype
2	loss of myristoylation, reduced protein stability, morphological alterations in mitochondria but no effect on its mitoch
302	loss of phosphorylation and interaction with c1qbp; when associated with f-456.
456	loss of phosphorylation and interaction with c1qbp; when associated with f-302.

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 95 (showing top): GOBP_REGULATION_OF_MRNA_CATABOLIC_PROCESS, GOBP_MACROMOLECULE_CATABOLIC_PROCESS, GGGTGGRR_PAX4_03, GOBP_POST_TRANSCRIPTIONAL_REGULATION_OF_GENE_EXPRESSION, GOBP_REGULATION_OF_CATABOLIC_PROCESS, GOBP_POSITIVE_REGULATION_OF_CATABOLIC_PROCESS, GOBP_RESPONSE_TO_OXYGEN_LEVELS, GOCC_MITOCHONDRIAL_ENVELOPE, GOBP_RESPONSE_TO_ABIOTIC_STIMULUS, TGGAAA_NFAT_Q4_01, CP2_01, GOMF_PHOSPHATIDYLINOSITOL_PHOSPHATE_BINDING, GOMF_PHOSPHATIDYLINOSITOL_BINDING, GOMF_PHOSPHATIDYLSERINE_BINDING, GOMF_MODIFIED_AMINO_ACID_BINDING

GO Biological Process (3): response to hypoxia (GO:0001666), positive regulation of apoptotic process (GO:0043065), 3’-UTR-mediated mRNA destabilization (GO:0061158)

GO Molecular Function (5): phosphatidylserine binding (GO:0001786), phosphatidic acid binding (GO:0070300), cardiolipin binding (GO:1901612), phosphatidylinositol phosphate binding (GO:1901981), protein binding (GO:0005515)

GO Cellular Component (6): mitochondrion (GO:0005739), cytosol (GO:0005829), cytoskeleton (GO:0005856), plasma membrane (GO:0005886), mitochondrial membrane (GO:0031966), membrane (GO:0016020)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
phospholipid binding	3
anion binding	2
cytoplasm	2
cellular anatomical structure	2
response to stress	1
response to decreased oxygen levels	1
apoptotic process	1
regulation of apoptotic process	1
positive regulation of programmed cell death	1
mRNA destabilization	1
modified amino acid binding	1
phosphatidylglycerol binding	1
binding	1
intracellular membrane-bounded organelle	1
intracellular membraneless organelle	1
membrane	1
cell periphery	1
mitochondrion	1
mitochondrial envelope	1
organelle membrane	1

Protein interactions and networks

STRING

600 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
PLEKHN1	CFAP20DC	Q6ZVT6	512
PLEKHN1	ZNF396	Q96N95	480
PLEKHN1	PTPDC1	A2A3K4	449
PLEKHN1	OR4F5	Q8NH21	447
PLEKHN1	OR4F17	Q8NGA8	447
PLEKHN1	TMEM212	A6NML5	435
PLEKHN1	NAA11	Q9BSU3	431
PLEKHN1	DPH6	Q7L8W6	430
PLEKHN1	ZFP64	Q9NTW7	396
PLEKHN1	MANEA	Q5SRI9	396
PLEKHN1	ACER2	Q5QJU3	378
PLEKHN1	INTS6L	Q5JSJ4	377
PLEKHN1	K7ENP7	K7ENP7	370
PLEKHN1	INO80C	Q6PI98	369
PLEKHN1	PLEK2	Q9NYT0	366

IntAct

55 interactions, top by confidence:

A	B	Type	Score
PLEKHN1	TCF4	psi-mi:“MI:0915”(physical association)	0.670
PLEKHN1	REL	psi-mi:“MI:0915”(physical association)	0.670
TRAF1	PLEKHN1	psi-mi:“MI:0915”(physical association)	0.670
TAX1BP1	PLEKHN1	psi-mi:“MI:0915”(physical association)	0.670
TCF4	PLEKHN1	psi-mi:“MI:0915”(physical association)	0.670
REL	PLEKHN1	psi-mi:“MI:0915”(physical association)	0.670
PLEKHN1	TAX1BP1	psi-mi:“MI:0915”(physical association)	0.670
PLEKHN1	TRAF1	psi-mi:“MI:0915”(physical association)	0.670
ankX	PLEKHN1	psi-mi:“MI:0915”(physical association)	0.650
ankX	PLEKHN1	psi-mi:“MI:0407”(direct interaction)	0.650
ankX	PLEKHN1	psi-mi:“MI:0403”(colocalization)	0.650
LPXN	PLEKHN1	psi-mi:“MI:0915”(physical association)	0.560
TRIM27	PLEKHN1	psi-mi:“MI:0915”(physical association)	0.560
PLEKHN1	TP53BP2	psi-mi:“MI:0915”(physical association)	0.560
PLEKHN1	RFX6	psi-mi:“MI:0915”(physical association)	0.560
CBY2	PLEKHN1	psi-mi:“MI:0915”(physical association)	0.560
LZTS2	PLEKHN1	psi-mi:“MI:0915”(physical association)	0.560

BioGRID (65): PLEKHN1 (Two-hybrid), PLEKHN1 (Two-hybrid), PLEKHN1 (Two-hybrid), PLEKHN1 (Two-hybrid), PLEKHN1 (Two-hybrid), PLEKHN1 (Two-hybrid), PLEKHN1 (Two-hybrid), LZTS2 (Two-hybrid), SPERT (Two-hybrid), RFX6 (Two-hybrid), PLEKHN1 (Proximity Label-MS), PLEKHN1 (Two-hybrid), PLEKHN1 (Two-hybrid), PLEKHN1 (Two-hybrid), PLEKHN1 (Two-hybrid)

ESM2 similar proteins: A2AKB4, A2APT9, O54824, P49796, Q0V8R5, Q14005, Q32LQ1, Q3B7M3, Q3TYG6, Q494U1, Q4FZU8, Q4V7B1, Q5BJM5, Q5JV73, Q5RA50, Q5SYB0, Q5T7N3, Q68FE6, Q6P1H6, Q6P9J5, Q6PCP7, Q6PG95, Q6ZPF3, Q6ZUX3, Q7TNY7, Q7TP65, Q80TI1, Q80UZ0, Q80XI1, Q80YE4, Q86V42, Q86XL3, Q8BLK9, Q8C886, Q8IVF5, Q8K124, Q8K3I4, Q8K451, Q8N5H7, Q8N878

Diamond homologs: A1CEK6, A1DFN5, A2QW93, A3LXQ8, A4FU49, A4RF61, D3YZU1, E9Q634, F1LRS8, O35179, O35180, O43639, O55033, O55043, O94868, P08487, P10569, P10686, P10911, P15498, P16333, P16885, P19174, P19706, P24135, P27870, P29355, P52735, P54100, P62484, P62993, P62994, P91620, Q07883, Q08DN7, Q09822, Q0CJU8, Q0U6X7, Q12965, Q14155

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

191 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	145
Likely benign	29
Benign	2

Top pathogenic / likely-pathogenic (0)

SpliceAI

2334 predictions. Top by Δscore:

Variant	Effect	Δscore
1:970276:GGA:G	acceptor_gain	1.0000
1:970276:GGAC:G	acceptor_gain	1.0000
1:970403:C:G	donor_gain	1.0000
1:970518:CAGGA:C	acceptor_loss	1.0000
1:970519:A:AC	acceptor_loss	1.0000
1:970519:A:AG	acceptor_gain	1.0000
1:970520:G:GG	acceptor_gain	1.0000
1:970520:GGAT:G	acceptor_gain	1.0000
1:970584:G:GT	donor_gain	1.0000
1:970601:GGTG:G	donor_loss	1.0000
1:970603:T:G	donor_loss	1.0000
1:971318:A:AG	acceptor_gain	1.0000
1:971323:G:A	acceptor_loss	1.0000
1:972070:C:CA	acceptor_gain	1.0000
1:972070:CGCAG:C	acceptor_loss	1.0000
1:972071:GCAGG:G	acceptor_loss	1.0000
1:972072:CA:C	acceptor_loss	1.0000
1:972073:A:AG	acceptor_gain	1.0000
1:972073:AG:A	acceptor_gain	1.0000
1:972073:AGG:A	acceptor_gain	1.0000
1:972073:AGGG:A	acceptor_gain	1.0000
1:972073:AGGGG:A	acceptor_gain	1.0000
1:972074:G:GT	acceptor_gain	1.0000
1:972074:GG:G	acceptor_gain	1.0000
1:972074:GGG:G	acceptor_gain	1.0000
1:972074:GGGG:G	acceptor_gain	1.0000
1:972074:GGGGG:G	acceptor_gain	1.0000
1:972147:GAAG:G	donor_gain	1.0000
1:974048:GCTT:G	donor_gain	1.0000
1:974052:G:GG	donor_gain	1.0000

AlphaMissense

3888 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
1:972139:T:C	F285S	0.997
1:970935:T:A	W181R	0.995
1:970935:T:C	W181R	0.995
1:971343:T:C	L243S	0.995
1:972145:T:A	I287N	0.995
1:970747:T:C	F158S	0.992
1:972150:G:C	G289R	0.992
1:972318:G:A	C299Y	0.992
1:972319:C:G	C299W	0.992
1:972346:G:C	W308C	0.992
1:972346:G:T	W308C	0.992
1:971364:T:C	L250S	0.991
1:971370:T:A	I252N	0.991
1:972138:T:C	F285L	0.991
1:972140:C:A	F285L	0.991
1:972140:C:G	F285L	0.991
1:971183:T:A	V228D	0.990
1:971404:G:C	K263N	0.990
1:971404:G:T	K263N	0.990
1:972317:T:C	C299R	0.990
1:972344:T:A	W308R	0.990
1:972344:T:C	W308R	0.990
1:970546:T:C	L119P	0.989
1:971189:T:C	L230P	0.989
1:970567:T:C	F126S	0.988
1:972306:T:A	I295N	0.988
1:972139:T:G	F285C	0.986
1:970548:T:C	F120L	0.985
1:970550:C:A	F120L	0.985
1:970550:C:G	F120L	0.985

dbSNP variants (sampled 300 via entrez): RS1000168116 (1:968192 C>T), RS1000735520 (1:969321 CTGTGTGTGCG>C,CTGTGTGTGCGTGTGTGTGCG), RS1000799220 (1:967290 G>C), RS1000817414 (1:971316 C>T), RS1000830967 (1:971269 C>T), RS1000907328 (1:967500 C>A), RS1001580358 (1:966301 G>T), RS1001739527 (1:969649 C>T), RS1001804580 (1:966758 C>A,G,T), RS1001961150 (1:972754 A>C), RS1002517738 (1:965403 C>T), RS1002753897 (1:967380 C>CA,CT), RS1002788268 (1:969879 G>A,T), RS1003092153 (1:969784 T>A,C,G), RS1003434578 (1:969351 A>G)

Disease associations

OMIM: gene MIM:621052 | disease phenotypes:

GenCC curated gene-disease

Disease	Classification	Inheritance
hereditary sensory and autonomic neuropathy	Limited	Autosomal recessive

Mondo (1): hereditary sensory and autonomic neuropathy (MONDO:0015364)

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST003059_3	Parkinson’s disease	1.000000e-06
GCST008839_404	Height	9.000000e-08

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D009477	Hereditary Sensory and Autonomic Neuropathies	C10.500.250; C10.574.500.493; C10.668.829.800.175; C16.131.666.310; C16.320.400.415

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

PharmGKB variants

1 variants.

Variant	Genes	Level	Score	#Clin annots	Drugs
rs7414551	KLHL17, PLEKHN1		0.00	0

CTD chemical–gene interactions

23 total (human), top 23 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	increases abundance, increases expression	3
Air Pollutants	affects expression, increases abundance, increases expression	2
Benzo(a)pyrene	affects methylation, increases expression	2
Estradiol	affects expression, affects cotreatment, increases expression	2
Smoke	decreases expression, affects expression, increases abundance	2
aristolochic acid I	decreases expression	1
FR900359	increases phosphorylation	1
TL8-506	affects cotreatment, increases expression	1
methyleugenol	increases expression	1
ethyl-p-hydroxybenzoate	increases expression	1
beta-lapachone	increases expression	1
11-nor-delta(9)-tetrahydrocannabinol-9-carboxylic acid	affects methylation, increases abundance	1
tris(1,3-dichloro-2-propyl)phosphate	increases expression	1
cupric chloride	increases expression	1
abrine	increases expression	1
Arsenic	increases abundance, increases expression	1
Cannabinoids	affects methylation, increases abundance	1
Tobacco Smoke Pollution	affects expression	1
Urethane	decreases expression	1
Valproic Acid	increases methylation	1
Asbestos, Crocidolite	decreases expression	1
Copper Sulfate	increases expression	1
Particulate Matter	increases abundance, increases expression	1

Clinical trials (associated diseases)

4 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT02624310	PHASE2	WITHDRAWN	A Study of Norepinephrine in Patients With Congenital Insensitivity to Pain and Anhidrosis
NCT02696746	Not specified	UNKNOWN	Painful Channelopathies Study
NCT03920774	Not specified	RECRUITING	The Natural History of Familial Dysautonomia
NCT05527379	Not specified	COMPLETED	Interest of Virtual Reality to Reduce Patient Anxiety During the Placement of a Percutaneous Implantable Port Catheter