POLL

Summary

POLL (DNA polymerase lambda, HGNC:9184) is a protein-coding gene on chromosome 10q24.32, encoding DNA polymerase lambda (Q9UGP5). DNA polymerase that functions in several pathways of DNA repair.

This gene encodes a DNA polymerase. DNA polymerases catalyze DNA-template-directed extension of the 3’-end of a DNA strand. This particular polymerase, which is a member of the X family of DNA polymerases, likely plays a role in non-homologous end joining and other DNA repair processes. Alternatively spliced transcript variants have been described.

Source: NCBI Gene 27343 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 118 total — 1 pathogenic
• GTEx eGene: eQTL in 24 tissues, sQTL in 40 (q < 0.05)
• Dosage sensitivity (ClinGen): haploinsufficiency no evidence, triplosensitivity no evidence
• Constraint (gnomAD): pLI 0.00 (LoF-tolerant), LOEUF 0.96 (unconstrained)
• MANE Select transcript: NM_001174084
• Notable: 118 clinical variants but no curated precision-oncology (CIViC) evidence yet

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:9184
Approved symbol	POLL
Name	DNA polymerase lambda
Location	10q24.32
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000166169
Ensembl biotype	protein_coding
OMIM	606343
Entrez	27343

Gene structure

Transcript identifiers

Ensembl transcripts: 103 — 73 protein_coding, 26 nonsense_mediated_decay, 4 protein_coding_CDS_not_defined

MANE Select: ENST00000370162

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 6, TSL 2: 1, TSL 3: 3, TSL 5: 7

ENST00000370162, ENST00000299206, ENST00000339310, ENST00000370168, ENST00000370169, ENST00000370172, ENST00000413344, ENST00000415897, ENST00000426919, ENST00000429502, ENST00000430045, ENST00000454524, ENST00000461587, ENST00000463515, ENST00000470140, ENST00000485369, ENST00000628479, ENST00000882355, ENST00000882356, ENST00000882357, ENST00000882358, ENST00000882359, ENST00000882360, ENST00000882361, ENST00000882362, ENST00000882363, ENST00000882364, ENST00000882365, ENST00000882366, ENST00000882367, ENST00000937304, ENST00000937305, ENST00000937306, ENST00000937307, ENST00000937308, ENST00000937309, ENST00000937310, ENST00000937311, ENST00000937312, ENST00000937313, ENST00000937314, ENST00000937315, ENST00000937316, ENST00000937317, ENST00000937318, ENST00000937319, ENST00000937320, ENST00000937321, ENST00000937322, ENST00000942758, ENST00000942759, ENST00000942760, ENST00000942761, ENST00000942762, ENST00001006861, ENST00001006862, ENST00001006863, ENST00001006864, ENST00001006865, ENST00001035435, ENST00001035436, ENST00001035437, ENST00001035438, ENST00001035439, ENST00001035440, ENST00001035442, ENST00001035443, ENST00001035444, ENST00001035445, ENST00001035446, ENST00001035447, ENST00001035448, ENST00001035449, ENST00001035450, ENST00001035451, ENST00001035452, ENST00001035453, ENST00001063475, ENST00001063476, ENST00001063477, ENST00001063478, ENST00001063479, ENST00001063480, ENST00001063481, ENST00001063482, ENST00001063483, ENST00001063484, ENST00001063485, ENST00001063486, ENST00001063487, ENST00001063488, ENST00001112180, ENST00001112181, ENST00001117310, ENST00001117311, ENST00001117312, ENST00001117313, ENST00001122054, ENST00001122055, ENST00001122056, ENST00001128999, ENST00001129000, ENST00001137010

RefSeq mRNA: 4 — MANE Select: NM_001174084 NM_001174084, NM_001174085, NM_001308382, NM_013274

CCDS: CCDS7513, CCDS76332

Canonical transcript exons

ENST00000370162 — 9 exons

Exon	Start	End
ENSE00001424221	101587822	101588257
ENSE00003462420	101582763	101582891
ENSE00003475842	101585316	101585478
ENSE00003503918	101578882	101579817
ENSE00003508364	101583508	101583681
ENSE00003567328	101585862	101586156
ENSE00003626756	101580248	101580416
ENSE00003889827	101584602	101584919
ENSE00003891177	101587246	101587406

Expression profiles

Bgee: expression breadth ubiquitous, 240 present calls, max score 93.15.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 12.9084 / max 231.5970, expressed in 1791 samples.

Highest expression (Bgee): uterine tube, body of pancreas, testis, lobe of thyroid gland, blood.

Genetic regulation across tissues (GTEx eQTL / sQTL)

POLL is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 24 tissues and its splicing (sQTL) in 40 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 64 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Muscle Skeletal	sqtl	1.2e-35	+0.63	10:101589839:A:G
Whole Blood	sqtl	1.1e-21	+0.61	10:101589839:A:G
Artery Tibial	sqtl	5.4e-20	+0.42	10:101578346:G:A
Adipose Subcutaneous	sqtl	9.3e-19	-0.59	10:101589839:A:G
Nerve Tibial	sqtl	7.6e-13	+0.41	10:101578007:G:T
Esophagus Muscularis	sqtl	1.6e-12	+0.47	10:101578007:G:T
Testis	sqtl	2.0e-12	+0.52	10:101603479:T:C
Cells Cultured fibroblasts	sqtl	5.4e-11	+0.47	10:101583776:A:G
Heart Atrial Appendage	sqtl	5.5e-11	+0.49	10:101594178:T:TAGGTTTGGTTTTAGGAAGTGGGG
Thyroid	sqtl	7.8e-11	+0.38	10:101603479:T:C
Brain Nucleus accumbens basal ganglia	sqtl	1.0e-09	+0.70	10:101578007:G:T
Esophagus Gastroesophageal Junction	sqtl	1.1e-09	+0.56	10:101578007:G:T
Brain Frontal Cortex BA9	sqtl	1.2e-09	+0.78	10:101578007:G:T
Breast Mammary Tissue	sqtl	2.0e-08	+0.45	10:101578007:G:T
Skin Sun Exposed Lower leg	sqtl	2.0e-08	+0.36	10:101578007:G:T
Lung	sqtl	4.0e-08	+0.35	10:101592941:G:A
Cells EBV-transformed lymphocytes	sqtl	4.7e-08	+0.62	10:101578346:G:A
Colon Transverse	sqtl	3.4e-07	+0.44	10:101578346:G:A
Artery Aorta	sqtl	4.3e-07	+0.46	10:101578973:C:A
Stomach	sqtl	4.5e-07	+0.49	10:101592941:G:A

FANTOM5 promoters

3 alternative TSS:

Promoter ID	TPM avg	Samples expressed
111090	12.7683	1791
111088	0.0727	13
111089	0.0674	19

Top tissues by expression

showing 100 of 276 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
right uterine tube	UBERON:0001302	93.15	gold quality
body of pancreas	UBERON:0001150	93.02	gold quality
left testis	UBERON:0004533	91.95	gold quality
right testis	UBERON:0004534	91.86	gold quality
right lobe of thyroid gland	UBERON:0001119	90.90	gold quality
blood	UBERON:0000178	90.68	gold quality
body of stomach	UBERON:0001161	90.67	gold quality
granulocyte	CL:0000094	90.55	gold quality
apex of heart	UBERON:0002098	90.23	gold quality
adenohypophysis	UBERON:0002196	90.14	gold quality
left lobe of thyroid gland	UBERON:0001120	90.13	gold quality
pituitary gland	UBERON:0000007	90.02	gold quality
hindlimb stylopod muscle	UBERON:0004252	89.97	gold quality
testis	UBERON:0000473	89.89	gold quality
tendon of biceps brachii	UBERON:0008188	89.72	gold quality
thyroid gland	UBERON:0002046	89.68	gold quality
right adrenal gland	UBERON:0001233	89.63	gold quality
left ovary	UBERON:0002119	89.62	gold quality
gastrocnemius	UBERON:0001388	89.42	gold quality
right adrenal gland cortex	UBERON:0035827	89.35	gold quality
metanephros cortex	UBERON:0010533	89.21	gold quality
muscle of leg	UBERON:0001383	89.05	gold quality
right ovary	UBERON:0002118	89.04	gold quality
stomach	UBERON:0000945	88.96	gold quality
mucosa of stomach	UBERON:0001199	88.82	gold quality
pancreas	UBERON:0001264	88.66	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	88.65	gold quality
lower esophagus	UBERON:0013473	88.59	gold quality
lower esophagus muscularis layer	UBERON:0035833	88.59	gold quality
right lobe of liver	UBERON:0001114	88.53	gold quality
minor salivary gland	UBERON:0001830	88.50	gold quality
muscle layer of sigmoid colon	UBERON:0035805	88.49	gold quality
left adrenal gland cortex	UBERON:0035825	88.42	gold quality
left adrenal gland	UBERON:0001234	88.40	gold quality
mucosa of transverse colon	UBERON:0004991	88.39	gold quality
body of uterus	UBERON:0009853	88.36	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	88.20	gold quality
rectum	UBERON:0001052	87.98	gold quality
adrenal cortex	UBERON:0001235	87.92	gold quality
transverse colon	UBERON:0001157	87.91	gold quality
fundus of stomach	UBERON:0001160	87.85	gold quality
saliva-secreting gland	UBERON:0001044	87.78	gold quality
lower esophagus mucosa	UBERON:0035834	87.72	gold quality
gall bladder	UBERON:0002110	87.60	gold quality
right frontal lobe	UBERON:0002810	87.34	gold quality
nerve	UBERON:0001021	87.27	gold quality
tibial nerve	UBERON:0001323	87.27	gold quality
small intestine Peyer’s patch	UBERON:0003454	87.24	gold quality
right coronary artery	UBERON:0001625	87.17	gold quality
endocervix	UBERON:0000458	87.12	gold quality
skeletal muscle organ	UBERON:0014892	87.06	gold quality
muscle organ	UBERON:0001630	87.05	gold quality
mouth mucosa	UBERON:0003729	86.94	gold quality
monocyte	CL:0000576	86.88	gold quality
descending thoracic aorta	UBERON:0002345	86.86	gold quality
esophagus	UBERON:0001043	86.85	gold quality
left coronary artery	UBERON:0001626	86.84	gold quality
popliteal artery	UBERON:0002250	86.84	gold quality
tibial artery	UBERON:0007610	86.84	gold quality
adrenal gland	UBERON:0002369	86.80	gold quality
spleen	UBERON:0002106	86.79	gold quality
aorta	UBERON:0000947	86.65	gold quality
coronary artery	UBERON:0001621	86.60	gold quality
ascending aorta	UBERON:0001496	86.53	gold quality
thoracic aorta	UBERON:0001515	86.53	gold quality
nucleus accumbens	UBERON:0001882	86.37	gold quality
leukocyte	CL:0000738	86.22	gold quality
stromal cell of endometrium	CL:0002255	86.17	gold quality
mononuclear cell	CL:0000842	86.14	gold quality
heart left ventricle	UBERON:0002084	85.98	gold quality
ovary	UBERON:0000992	85.96	gold quality
cortical plate	UBERON:0005343	85.86	gold quality
right atrium auricular region	UBERON:0006631	85.86	gold quality
small intestine	UBERON:0002108	85.85	gold quality
ectocervix	UBERON:0012249	85.84	gold quality
buccal mucosa cell	CL:0002336	85.83	silver quality
esophagus mucosa	UBERON:0002469	85.69	gold quality
lymph node	UBERON:0000029	85.66	gold quality
right hemisphere of cerebellum	UBERON:0014890	85.63	gold quality
cardiac ventricle	UBERON:0002082	85.60	gold quality
left uterine tube	UBERON:0001303	85.58	gold quality
putamen	UBERON:0001874	85.58	gold quality
smooth muscle tissue	UBERON:0001135	85.57	gold quality
prostate gland	UBERON:0002367	85.54	gold quality
anterior cingulate cortex	UBERON:0009835	85.34	gold quality
cingulate cortex	UBERON:0003027	85.31	gold quality
prefrontal cortex	UBERON:0000451	85.27	gold quality
skin of leg	UBERON:0001511	85.13	gold quality
caudate nucleus	UBERON:0001873	85.00	gold quality
colon	UBERON:0001155	84.92	gold quality
upper lobe of left lung	UBERON:0008952	84.91	gold quality
heart	UBERON:0000948	84.87	gold quality
anatomical system	UBERON:0000467	84.81	gold quality
cardiac atrium	UBERON:0002081	84.80	gold quality
cerebellar hemisphere	UBERON:0002245	84.80	gold quality
intestine	UBERON:0000160	84.76	gold quality
skin of abdomen	UBERON:0001416	84.73	gold quality
omental fat pad	UBERON:0010414	84.71	gold quality
cerebellar cortex	UBERON:0002129	84.70	gold quality
peritoneum	UBERON:0002358	84.68	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	4.97

HPA expression

RNA tissue specificity: Low tissue specificity

showing 60 of 76 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM
Skeletal muscle	tissue	31.7
Choroid plexus	tissue	31.2
Locus coeruleus	tissue	28.2
Nucleus accumbens	tissue	27.9
Pituitary gland	tissue	27.2
Hippocampus	tissue	26.6
Testis	tissue	24.5
Pancreas	tissue	21.8
Ovary	tissue	21.3
Epididymis	tissue	21.3
Postcentral gyrus	tissue	21.3
Parathyroid gland	tissue	20.0
Salivary gland	tissue	19.5
Fallopian tube	tissue	18.8
Thyroid gland	tissue	18.0
Tongue	tissue	17.1
Vagina	tissue	16.9
Stomach 1	tissue	16.5
Retina	tissue	16.2
Rectum	tissue	16.0
Tonsil	tissue	16.0
Lymph node	tissue	15.9
Duodenum	tissue	15.8
Gallbladder	tissue	14.6
Prostate	tissue	14.6
Seminal vesicle	tissue	14.5
Skin 1	tissue	14.4
Breast	tissue	14.3
Endometrium 1	tissue	14.0
Spleen	tissue	13.9
Heart muscle	tissue	13.8
Smooth muscle	tissue	13.3
Lung	tissue	13.0
Adipose tissue	tissue	12.9
Placenta	tissue	12.9
Adrenal gland	tissue	12.8
Small intestine	tissue	12.7
Bone marrow	tissue	12.1
Colon	tissue	11.8
Appendix	tissue	11.7
Esophagus	tissue	11.3
Liver	tissue	11.2
Kidney	tissue	11.2
Cervix	tissue	10.0
Caudate putamen	tissue	9.9
Frontal cortex	tissue	9.5
Urinary bladder	tissue	8.5
Thymus	tissue	6.9
Hippocampal formation	tissue	3.3
Hypothalamus	tissue	3.2
Periaqueductal gray	tissue	3.2
Basal ganglia	tissue	3.1
Midbrain	tissue	3.1
Cerebellum	tissue	3.1
Pons	tissue	3.0
Thalamus	tissue	3.0
Substantia nigra	tissue	3.0
Spinal cord	tissue	3.0
Septum	tissue	3.0
Amygdala	tissue	2.9

Brain sub-regions (HPA Brain Atlas): detected in 189; highest nTPM — Claustrum (30.2), Anterior insular cortex, ventral (29.3), Precentral gyrus (29.3), Hippocampus, CA3 (29.2), Olfactory area (28.8).

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): CREB1, SP1, TP53, VSX2

miRNA regulators (miRDB)

Targeting POLL by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

22 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4500	99.99	72.72	2367
HSA-MIR-548AW	99.99	72.57	3559
HSA-LET-7A-5P	99.98	72.29	1790
HSA-LET-7B-5P	99.98	72.31	1790
HSA-LET-7C-5P	99.98	72.29	1790
HSA-LET-7E-5P	99.98	72.29	1790
HSA-LET-7F-5P	99.98	72.56	1784
HSA-LET-7G-5P	99.98	72.37	1784
HSA-LET-7I-5P	99.98	72.37	1788
HSA-MIR-98-5P	99.98	72.33	1787
HSA-LET-7D-5P	99.96	71.76	1632
HSA-MIR-4458	99.96	71.64	1650
HSA-MIR-6892-3P	99.68	66.40	1178
HSA-MIR-486-3P	99.51	66.82	1901
HSA-MIR-149-5P	99.25	67.16	1315
HSA-MIR-6510-5P	99.14	66.59	1081
HSA-MIR-7977	98.65	66.18	2590
HSA-MIR-4710	98.61	65.96	1048
HSA-MIR-6873-5P	98.45	66.14	1417
HSA-MIR-4456	97.50	64.88	1678
HSA-MIR-3192-5P	96.98	65.76	1926
HSA-MIR-184	94.24	64.40	152

Functional genomics

gnomAD constraint: pLI 9.4e-12, LOEUF 0.963, missense Z 1.62 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD RMC): no regional variation along ENST00000370162 — one region, missense o/e 0.86. ClinGen dosage: haploinsufficiency 0 (no evidence), triplosensitivity 0 (no evidence). ClinGen Gene Dosage Map

Literature-anchored findings (GeneRIF, showing 40)

• role in DNA repair (PMID:11821417)
• role in dna replication and DNA repair (PMID:11974915)
• complex between PCNA and pol lambda may play an important role in the bypass of abasic sites in human cells (PMID:12368291)
• DNA polymerase lambda has an intrinsic terminal deoxyribonucleotidyl transferase activity that preferentially adds pyrimidines onto 3’OH ends of DNA oligonucleotides and elongates an RNA primer hybridized to a DNA template. (PMID:12683997)
• mammalian Pol lambda has a role in non-homologous end-joining (PMID:12829698)
• Polymerase lambda is the primary gap-filling polymerase for accurate nonhomologous end joining (PMID:14561766)
• pol lambda Phe506Arg/Gly mutants possess very low polymerase and terminal transferase activities as well as greatly reduced abilities for processive DNA synthesis (PMID:14627824)
• fills short-patched DNA gaps in base excision repair pathways and participates in mammalian nonhomologous end-joining pathways to repair double-stranded DNA breaks (PMID:15157109)
• Results link p53 status with POLkappa expression and suggest that loss of p53 function may in part contribute to the observed POLkappa upregulation in human lung cancers. (PMID:15202001)
• A molecular mechanism is suggested for the observed high in vivo rate of frameshift generation by pol lambda and the remarkable ability of pol lambda to promote microhomology pairing between two DNA strands. (PMID:15350147)
• A helix-hairpin-helix domain of DNA polymerase lambda is important for primer binding and/or for proliferating cell nuclear antigen interaction. (PMID:15358682)
• determined that Fyn phosphorylated MAP-2c on tyrosine 67 (PMID:15537631)
• crystal structures of Pol lambda representing three steps in filling a single-nucleotide gap (PMID:15608652)
• Human DNA polymerase kappa, an error-prone enzyme that is up-regulated in lung cancers, induces DNA breaks and stimulates DNA exchanges as well as aneuploidy. (PMID:15665310)
• Results suggest that Pol lambda plays a role in the short-patch base excision repair rather than contributes to the long-patch base excision repair pathway. (PMID:15979954)
• DNA polymerase lambda is phosphorylated in vitro by several cyclin-dependent kinase/cyclin complexes, including Cdk2/cyclin A, in its proline-serine-rich domain. (PMID:16174846)
• DNA polymerase lambda has the ability to create base pair mismatches and human replication protein A can suppress this intrinsic in vitro mutator phenotype. (PMID:16522650)
• DNA polymerase fidelity is controlled not by an accessory protein or a proofreading exonuclease domain but by an internal regulatory domain (PMID:16675458)
• DNA polymerase lambda is unable to differentiate between matched and mismatched termini during the DNA binding step, thus accounting for the relatively high efficiency of mismatch extension. (PMID:16807316)
• Kinetic studies on human DNA polymerase lambda reveal roles of a downstream strand and the 5’-terminal moieties (PMID:17005572)
• The erroneous nucleotide incorporations catalyzed by DNA polymerases lambda and beta as well as the subsequent ligation catalyzed by a DNA ligase during base excision repair are a threat to genomic integrity. (PMID:17321545)
• cloning, expression and tissue distribution in normal liver and hepatoma (PMID:17653665)
• DNA pol lambda active site residue tyrosine 505 determined the nucleotide selectivity opposite 1,2-dihydro-2-oxoadenine during error-free bypass of the 1,2-dihydro-2-oxoadenine lesion. (PMID:17666409)
• capacity of Pol lambda either to insert opposite 8oxoG or to extend correct base pairs containing such a damage could be beneficial for its role in NHEJ (PMID:17686665)
• Pol lambda is stabilized during cell cycle progression in late S and G2 phases, most likely allowing Pol lambda to correctly conduct repair of damaged DNA during and after S phase. (PMID:18688254)
• analysis of human DNA polymerase lambda with Mg2+ and Mn2+ from ab initio quantum mechanical/molecular mechanical studies (PMID:18692600)
• RAGE is under genetic selection in the non-African populations. (PMID:19060005)
• replication protein A and proliferating cell nuclear antigen act as molecular switches to activate the DNA pol lambda- dependent highly efficient and faithful repair of A:8-oxo-G mismatches in human cells and to repress DNA pol beta activity. (PMID:19104052)
• dATP was a preferential substrate for DNA polymerase beta and dGMP was the only substrate for DNA polymerase lambda. (PMID:19120024)
• These experiments suggest that polymerase lambda does not undergo major conformational changes during the catalysis in the solution phase. (PMID:19467241)
• when bound to a 2-nucleotide gap, Pol lambda scrunches the template strand and binds the additional uncopied template base in an extrahelical position within a binding pocket that comprises three conserved amino acids. (PMID:19701199)
• a natural mutator variant of human DNA polymerase lambda promotes chromosomal instability by compromising NHEJ (PMID:19806195)
• observe specific recruitment of MUTYH, DNA pol lambda, proliferating cell nuclear antigen (PCNA), flap endonuclease 1 (FEN1) and DNA ligases I and III from human cell extracts to A:8-oxo-G DNA, but not to undamaged DNA. (PMID:19820168)
• DNA polymerase lambda uses a novel sugar selection mechanism to discriminate against ribonucleotides, whereby the ribose 2’-hydroxyl group was excluded mostly by a backbone segment and slightly by the side chain of Y505. (PMID:19900463)
• Both Pol lambda- and (Pol kappa)-positive staining were associated with shorter survival in glioma patients. (PMID:20164241)
• analysis of the interaction between DNA Polymerase lambda and anticancer nucleoside analogs (PMID:20348107)
• DNA polymerase lambda can bypass a thymine glycol lesion on the template strand of gapped DNA substrates. (PMID:20423048)
• The results demonstrate that loop 1 is not essential for catalytic activity, but it is important for the fidelity of DNA synthesis and the accuracy of non-homologous end joining. (PMID:20435673)
• study found expression of PollambdaR438W sensitizes cells to camptothecin by affecting the homologous recombination pathway, whereas overexpression of pollambdaWT did not impact cell survival; this effect depends entirely on its DNA polymerase activity (PMID:20693240)
• both pol lambda and pol beta interact with the upstream DNA glycosylases for repair of alkylated and oxidized DNA bases (PMID:20805875)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	poll	ENSDARG00000039613
mus_musculus	Poll	ENSMUSG00000025218
rattus_norvegicus	Poll	ENSRNOG00000016748

Paralogs (3): POLB (ENSG00000070501), DNTT (ENSG00000107447), POLM (ENSG00000122678)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:1889000) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 2 distinct phenotype terms.

Mouse phenotype (MP)	Records
abnormal immunoglobulin heavy chain V(D)J recombination	1
impaired base-excision repair	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Bos taurus	Q27958	98.2%	Diamond
Macaca fascicularis	Q4R380	96.9%	Diamond
Xenopus laevis	O57383	83.9%	Diamond
Oryza sativa Japonica Group	Q67VC8	61.1%	Diamond
Arabidopsis thaliana	Q9FNY4	60.2%	Diamond
Acanthamoeba polyphaga mimivirus	Q7T6Y4	33.4%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
MIR3158-2	ncRNA	100423033
LINC03046	ncRNA	125775240
DPCD	protein-coding	25911
FBXW4	protein-coding	6468
BTRC	protein-coding	8945
MIR3158-1	ncRNA	100422900
LINC03191	ncRNA	105378453

Protein

Protein identifiers

DNA polymerase lambda — Q9UGP5 (reviewed: Q9UGP5)

Alternative names: DNA polymerase beta-2, DNA polymerase kappa

All UniProt accessions (11): A8K860, Q9UGP5, Q5JQN9, Q5JQP0, Q5JQP1, Q5JQP2, Q5JQP3, Q5JQP4, Q5JQP7, Q5JQP8, Q9HBN3

UniProt curated annotations — full annotation on UniProt →

Function. DNA polymerase that functions in several pathways of DNA repair. Involved in base excision repair (BER) responsible for repair of lesions that give rise to abasic (AP) sites in DNA. Also contributes to DNA double-strand break repair by non-homologous end joining and homologous recombination. Has both template-dependent and template-independent (terminal transferase) DNA polymerase activities. Also has a 5’-deoxyribose-5-phosphate lyase (dRP lyase) activity.

Subunit / interactions. Interacts with PCNA. Interacts with PAXX; promoting POLL recruitment to double-strand breaks (DSBs) and stimulation of the end-filling activity of POLL. Interacts with XRCC4; promoting POLL recruitment to double-strand breaks (DSBs) and stimulation of the end-filling activity of POLL. Interacts with NHEJ1/XLF; promoting POLL recruitment to double-strand breaks (DSBs) and stimulation of the end-filling activity of POLL.

Subcellular location. Nucleus. Chromosome.

Tissue specificity. Expressed in a number of tissues. Abundant in testis.

Similarity. Belongs to the DNA polymerase type-X family.

Isoforms (2)

UniProt ID	Names	Canonical?
Q9UGP5-1	1	yes
Q9UGP5-2	2

RefSeq proteins (4): NP_001167555, NP_001167556, NP_001295311, NP_037406 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001357	BRCT_dom	Domain
IPR002008	DNA_pol_X_beta-like	Family
IPR002054	DNA-dir_DNA_pol_X	Domain
IPR010996	HHH_MUS81	Domain
IPR018944	DNA_pol_lambd_fingers_domain	Domain
IPR019843	DNA_pol-X_BS	Binding_site
IPR022312	DNA_pol_X	Family
IPR027421	DNA_pol_lamdba_lyase_dom_sf	Homologous_superfamily
IPR028207	DNA_pol_B_palm_palm	Domain
IPR029398	PolB_thumb	Domain
IPR036420	BRCT_dom_sf	Homologous_superfamily
IPR037160	DNA_Pol_thumb_sf	Homologous_superfamily
IPR043519	NT_sf	Homologous_superfamily

Pfam: PF10391, PF14716, PF14791, PF14792

Enzyme classification (BRENDA)

• EC 4.2.99.B1 — (BRENDA: organisms, substrates, inhibitors, Km, kcat entries)

Catalyzed reactions (Rhea)

• DNA(n) + a 2’-deoxyribonucleoside 5’-triphosphate = DNA(n+1) + diphosphate (RHEA:22508)

UniProt features (78 total): helix 30, strand 18, binding site 7, region of interest 5, mutagenesis site 5, splice variant 2, sequence variant 2, sequence conflict 2, turn 2, compositionally biased region 2, chain 1, domain 1, active site 1

Structure

Experimental structures (PDB)

showing 30 of 97 structures by resolution:

PDB	Title	Method	Resolution (Å)
7M07	Pre-catalytic ternary complex of DNA Polymerase Lambda with bound 1-nt gapped SSB …	X-RAY DIFFRACTION	1.57
7M49	DNA Polymerase Lambda, TTP:At Mn2+ Reaction State Ternary Complex, 5 min	X-RAY DIFFRACTION	1.6
9NPU	Pre-catalytic ternary complex of DNA Polymerase Lambda with bound 1-nt gapped SSB …	X-RAY DIFFRACTION	1.63
7M47	DNA Polymerase Lambda, TTP:At Mg2+ Product State Ternary Complex, 60 min	X-RAY DIFFRACTION	1.65
2BCQ	DNA polymerase lambda in complex with a DNA duplex containing an unpaired Dtmp	X-RAY DIFFRACTION	1.65
7M09	Pre-catalytic quaternary complex of DNA Polymerase Lambda with blunt-ended DSB substrate …	X-RAY DIFFRACTION	1.65
7M4B	DNA Polymerase Lambda, TTP:At Mn2+ Product State Ternary Complex, 60 min	X-RAY DIFFRACTION	1.66
7M08	Post-catalytic nicked complex of DNA Polymerase Lambda with bound 1-nt gapped SSB …	X-RAY DIFFRACTION	1.7
7M4L	DNA Polymerase Lambda, TTPaS:At Mn2+ Product State Ternary Complex, 60 min	X-RAY DIFFRACTION	1.7
7M4K	DNA Polymerase Lambda, TTPaS:At Ca2+ Ground State Ternary Complex	X-RAY DIFFRACTION	1.72
5IIJ	Crystal structure of the pre-catalytic ternary complex of DNA polymerase lambda with a …	X-RAY DIFFRACTION	1.72
2BCR	DNA polymerase lambda in complex with a DNA duplex containing an unpaired Damp	X-RAY DIFFRACTION	1.75
5III	Crystal structure of the pre-catalytic ternary complex of DNA polymerase lambda with a …	X-RAY DIFFRACTION	1.8
7M0D	Pre-catalytic quaternary complex of DNA Polymerase Lambda with bound complementary DSB …	X-RAY DIFFRACTION	1.8
7M4D	DNA Polymerase Lambda, dCTP:At Ca2+ Ground State Ternary Complex	X-RAY DIFFRACTION	1.82
7M0A	Incomplete in crystallo incorporation by DNA Polymerase Lambda bound to blunt-ended DSB …	X-RAY DIFFRACTION	1.83
7M4A	DNA Polymerase Lambda, TTP:At Mn2+ Product State Ternary Complex, 20 min	X-RAY DIFFRACTION	1.87
7M4G	DNA Polymerase Lambda, dCTP:At Mg2+ Product State Ternary Complex, 960 min	X-RAY DIFFRACTION	1.88
7M45	DNA Polymerase Lambda, TTP:At Mg2+ Reaction State Ternary Complex, 120 sec	X-RAY DIFFRACTION	1.89
2PFN	Na in the active site of DNA Polymerase lambda	X-RAY DIFFRACTION	1.9
4XA5	Crystal structure of the pre-catalytic ternary complex of DNA polymerase lambda with a …	X-RAY DIFFRACTION	1.9
8U0P	Synaptic complex of human DNA polymerase Lambda DL variant engaged on a noncomplementary …	X-RAY DIFFRACTION	1.9
7M44	DNA Polymerase Lambda, TTP:At Mg2+ Reaction State Ternary Complex, 90 sec	X-RAY DIFFRACTION	1.9
7M4E	DNA Polymerase Lambda, dCTP:At Mg2+ Reaction State Ternary Complex, 120 min	X-RAY DIFFRACTION	1.9
7M46	DNA Polymerase Lambda, TTP:At Mg2+ Product State Ternary Complex, 5 min	X-RAY DIFFRACTION	1.92
7M4H	DNA Polymerase Lambda, dCTP:At Mn2+ Reaction State Ternary Complex, 225 min	X-RAY DIFFRACTION	1.92
7M48	DNA Polymerase Lambda, TTP:At Mg2+ Product State Ternary Complex, 960 min	X-RAY DIFFRACTION	1.93
5IIM	Crystal structure of the pre-catalytic ternary extension complex of DNA polymerase lambda …	X-RAY DIFFRACTION	1.94
7M4F	DNA Polymerase Lambda, dCTP:At Mg2+ Product State Ternary Complex, 300 min	X-RAY DIFFRACTION	1.95
1XSN	Crystal Structure of human DNA polymerase lambda in complex with a one nucleotide DNA gap …	X-RAY DIFFRACTION	1.95

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9UGP5-F1	80.90	0.59

Human Protein Atlas

Protein class: Enzymes, ENZYME proteins, Transferases, Metabolic proteins, Predicted intracellular proteins

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): nucleoplasm

Antibody reliability (HPA): IF supported

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1)

Position	Role
312	schiff-base intermediate with dna

Ligand- & substrate-binding residues (7)

Position	Role
386	dCTP
417–420	dCTP
426–429	dCTP
427	Mn(2+)
429	Mn(2+)
490	Mn(2+)
513	dCTP

Mutagenesis-validated functional residues (5)

Position	Phenotype
312	reduces drp lyase activity by over 90%.
427	loss of polymerase activity; when associated with a-429.
429	loss of polymerase activity; when associated with a-427.
505	no effect on polymerase activity. reduces terminal transferase activities.
506	strongly reduces polymerase and terminal transferase activities.

Function

Pathways and Gene Ontology

Reactome pathways

1 curated (TAS) of 3; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

3 pathways:

ID	Pathway	Evidence
R-HSA-5693571	Nonhomologous End-Joining (NHEJ)	curated
R-HSA-5693532	DNA Double-Strand Break Repair	—
R-HSA-73894	DNA Repair	—

MSigDB gene sets: 123 (showing top): KAUFFMANN_DNA_REPAIR_GENES, CAGCTG_AP4_Q5, IRF7_01, GOBP_NUCLEOTIDE_EXCISION_REPAIR, GOMF_DNA_POLYMERASE_ACTIVITY, GOBP_IMMUNOGLOBULIN_PRODUCTION, GOBP_DNA_DAMAGE_RESPONSE, GOBP_SOMATIC_DIVERSIFICATION_OF_IMMUNE_RECEPTORS, GOBP_DNA_BIOSYNTHETIC_PROCESS, RFX1_02, GOBP_SOMATIC_DIVERSIFICATION_OF_IMMUNE_RECEPTORS_VIA_SOMATIC_MUTATION, REACTOME_DNA_REPAIR, GOBP_RECOMBINATIONAL_REPAIR, GOBP_DNA_REPLICATION, CETS1P54_01

GO Biological Process (10): double-strand break repair via homologous recombination (GO:0000724), DNA replication (GO:0006260), base-excision repair, gap-filling (GO:0006287), nucleotide-excision repair (GO:0006289), double-strand break repair via nonhomologous end joining (GO:0006303), somatic hypermutation of immunoglobulin genes (GO:0016446), DNA biosynthetic process (GO:0071897), DNA metabolic process (GO:0006259), DNA repair (GO:0006281), DNA damage response (GO:0006974)

GO Molecular Function (9): DNA binding (GO:0003677), DNA-directed DNA polymerase activity (GO:0003887), metal ion binding (GO:0046872), 5’-deoxyribose-5-phosphate lyase activity (GO:0051575), protein binding (GO:0005515), transferase activity (GO:0016740), nucleotidyltransferase activity (GO:0016779), lyase activity (GO:0016829), DNA polymerase activity (GO:0034061)

GO Cellular Component (4): nucleus (GO:0005634), nucleoplasm (GO:0005654), site of double-strand break (GO:0035861), chromosome (GO:0005694)

Reactome top-level categories

2 top-level categories:

Category	Pathways
DNA Double-Strand Break Repair	1
DNA Repair	1

GO top-level categories

26 GO namespaces:

Category	Terms
DNA metabolic process	4
double-strand break repair	2
DNA biosynthetic process	2
catalytic activity, acting on DNA	2
catalytic activity	2
recombinational repair	1
base-excision repair	1
DNA repair	1
somatic diversification of immune receptors via somatic mutation	1
somatic diversification of immunoglobulins	1
nucleic acid biosynthetic process	1
nucleic acid metabolic process	1
DNA damage response	1
cellular response to stress	1
nucleic acid binding	1
DNA polymerase activity	1
cation binding	1
carbon-oxygen lyase activity	1
binding	1
transferase activity, transferring phosphorus-containing groups	1
nucleotidyltransferase activity	1
intracellular membrane-bounded organelle	1
nuclear lumen	1
cellular anatomical structure	1
site of DNA damage	1
intracellular membraneless organelle	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 9 of 23 annotations. The rest are phylogenetic / computational / electronic (IEA).

9 experimentally-supported GO terms:

GO term	NS	Evidence
DNA biosynthetic process	BP	direct assay
base-excision repair, gap-filling	BP	direct assay
double-strand break repair via homologous recombination	BP	mutant phenotype
double-strand break repair via nonhomologous end joining	BP	direct assay
nucleotide-excision repair	BP	direct assay
nucleoplasm	CC	direct assay
site of double-strand break	CC	direct assay
5’-deoxyribose-5-phosphate lyase activity	MF	direct assay
DNA-directed DNA polymerase activity	MF	direct assay

Protein interactions and networks

STRING

showing 15 of 1,112 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
POLL	TENT4A	Q5XG87	930
POLL	REV1	Q9UBZ9	897
POLL	DPCD	Q9BVM2	888
POLL	FBXW4	P57775	860
POLL	PCNA	P12004	842
POLL	LBX1	P52954	840
POLL	RAD18	Q9NS91	821
POLL	REV3L	O60673	791
POLL	POLI	Q9UNA4	751
POLL	XRCC4	Q13426	737
POLL	MAD2L2	Q9UI95	717
POLL	POLK	Q9UBT6	715
POLL	POLH	Q9Y253	711
POLL	LIG1	P18858	707
POLL	NHEJ1	Q9H9Q4	706

IntAct

Human interaction partners of POLL in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

18 partners by confidence:

Partner	Interaction type	MIscore	Records
LDOC1	physical association	0.550	2
BCKDHA	association	0.510	2
MUTYH	direct interaction	0.440	1
H2BC13	physical association	0.400	1
H2BC21	physical association	0.400	1
UBC	physical association	0.400	1
XRCC1	physical association	0.400	1
FAM9B	physical association	0.370	1
TFIP11	physical association	0.370	1
PGK2	association	0.350	1
SULT1C2	association	0.350	1
BCKDHB	physical association	0.000	1
RPA1	physical association	0.000	1
RPA2	physical association	0.000	1
RPA3	physical association	0.000	1
SSRP1	physical association	0.000	1
SUPT16H	physical association	0.000	1
WRN	physical association	0.000	1

BioGRID (107 interactions; top human partners by supporting records): CDK2 (Biochemical Activity; 4 records), C9orf64 (Affinity Capture-MS; 3 records), CST4 (Affinity Capture-MS; 3 records), LACRT (Affinity Capture-MS; 3 records), LTF (Affinity Capture-MS; 3 records), MED1 (Affinity Capture-MS; 3 records), MINA (Affinity Capture-MS; 3 records), NOSIP (Affinity Capture-MS; 3 records), PCNA (Reconstituted Complex; 3 records), SEMG1 (Affinity Capture-MS; 3 records), SEMG2 (Affinity Capture-MS; 3 records), SULT1C2 (Affinity Capture-MS; 3 records), SYN2 (Affinity Capture-MS; 3 records), APP (Reconstituted Complex; 2 records), IGHA1 (Affinity Capture-MS; 2 records)

SIGNOR signaling

showing 6 of 9 signaling interactions:

A	Effect	B	Mechanism
HUWE1	“down-regulates quantity by destabilization”	POLL	polyubiquitination
ATM	“up-regulates activity”	POLL	phosphorylation
CyclinA2/CDK2	“up-regulates quantity by stabilization”	POLL	phosphorylation
PRKDC	“up-regulates activity”	POLL	phosphorylation
CDK2	“up-regulates quantity by stabilization”	POLL	phosphorylation
CDK2	“up-regulates activity”	POLL	phosphorylation

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 18 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Gap-filling DNA repair synthesis and ligation in GG-NER	5	137.3×	2e-08
HDR through Homologous Recombination (HRR)	5	59.5×	5e-07
Gap-filling DNA repair synthesis and ligation in TC-NER	5	55.8×	6e-07
Regulation of TP53 Activity through Phosphorylation	7	51.5×	6e-09
Processing of DNA double-strand break ends	7	50.0×	6e-09
G2/M DNA damage checkpoint	6	45.1×	2e-07
Meiotic recombination	5	40.5×	2e-06

GO biological processes:

GO term	Partners	Fold	FDR
mismatch repair	5	180.0×	2e-09
base-excision repair	6	156.0×	1e-10
DNA replication	6	55.1×	2e-08
DNA repair	5	17.7×	8e-05

Disease & clinical

Genetic variants

Variant evidence for POLL: 118 ClinVar records (1 pathogenic / likely pathogenic). Per-variant detail is on Sugi Variant.

ClinVar

118 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	0
Uncertain significance	83
Likely benign	11
Benign	12

Top pathogenic / likely-pathogenic (1)

Showing all 1 pathogenic / likely-pathogenic ClinVar records, ranked by ClinVar review status (expert panel → multiple submitters → single submitter), then by number of submitting labs.

Variant ID	HGVS	Classification	Review	Submitters
815374	GRCh37/hg19 10q24.31-24.32(chr10:102925257-103401586)x3	Pathogenic	no assertion criteria provided	1

Per-variant reference — Sugi Variant

Explore POLL’s pathogenic and likely-pathogenic variants individually — each with its ClinVar classification and conditions, applied ACMG criteria (ClinGen expert panel, where curated), the calibrated in-silico predictors (AlphaMissense, REVEL, SaProt, conservation), gnomAD frequency, and the predictor-disagreement QC signal — on Sugi Variant.

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 19 predictions of 1,010):

Position(s)	Effect	Δscore	Sites
10:101580417–101580418	acceptor_loss	1.0000	5
10:101582789	donor_gain	1.0000
10:101582803	donor_gain	1.0000
10:101582892–101582893	acceptor_loss	1.0000	6
10:101583522	donor_gain	1.0000
10:101583546	donor_gain	1.0000
10:101584921	acceptor_gain	1.0000
10:101580250	donor_gain	0.9900
10:101580417	acceptor_loss	0.9900
10:101582619	donor_gain	0.9900

AlphaMissense

861 missense substitutions predicted likely pathogenic (of 3,734 scored), across 261 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
D429	8	0.974	0.990
D490	8	0.974	0.987
D427	8	0.963	0.986
F512	8	0.921	0.986
F560	8	0.917	0.975
F338	8	0.872	0.982
F506	7	0.971	0.994
C241	7	0.943	0.984
W114	7	0.939	0.991
E556	7	0.936	0.973
W274	7	0.925	0.978
W352	7	0.919	0.995
W342	7	0.911	0.976
R275	7	0.910	0.993
E315	7	0.906	0.950
W239	7	0.904	0.973
N253	7	0.899	0.988
N513	7	0.885	0.985
D272	7	0.849	0.943
F61	7	0.837	0.913

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

2 prognostic cancer types:

Cancer	Prognostic	p-value
Kidney Renal Clear Cell Carcinoma (TCGA)	favorable	0.000137
Glioblastoma Multiforme (validation)	favorable	0.000215

Disease associations

OMIM: gene MIM:606343 | disease phenotypes:

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL5367 (SINGLE PROTEIN)

PharmGKB: 1 entry (CPIC guideline: no)

Binding affinities (BindingDB)

12 measured of 39 human assays (55 total across all organisms); most potent 12 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value
6,13-di(hydroxymethyl)-2,6-dimethyl-(1S,2S,5R,6R,7R,10S,12R,13R)-tetracyclo[10.3.1.01,10.02,7]hexadecane-5,13-diol (Aphidicolin)	EC50	2000 nM
CHEMBL3978947	IC50	5000 nM
Oblongifolin C	IC50	5200 nM
Guttiferone K	IC50	5400 nM
CHEMBL3889506	IC50	5600 nM
CHEMBL3976184	IC50	5700 nM
CHEMBL3917534	IC50	5800 nM
CHEMBL3907489	IC50	6200 nM
CHEMBL3898463	IC50	6900 nM
CHEMBL3926514	IC50	7400 nM
CHEMBL3935433	IC50	8800 nM
CHEBI:41846	IC50	19000 nM

ChEMBL bioactivities

11 potent at pChembl≥5 of 15 total, top 11 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
5.30	IC50	5000	nM	CHEMBL3978947
5.28	IC50	5200	nM	OBLONGIFOLIN C
5.27	IC50	5400	nM	GUTTIFERONE K
5.25	IC50	5600	nM	CHEMBL3889506
5.24	IC50	5800	nM	CHEMBL3917534
5.24	IC50	5700	nM	CHEMBL3976184
5.21	IC50	6200	nM	CHEMBL3907489
5.16	IC50	6900	nM	CHEMBL3898463
5.16	IC50	7000	nM	CHEMBL1917196
5.13	IC50	7400	nM	CHEMBL3926514
5.06	IC50	8800	nM	CHEMBL3935433

PubChem BioAssay actives

35 with measured affinity, of 211 total; 35 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
(5Z)-5-[[4-(2-methylphenyl)sulfanyl-3-nitrophenyl]methylidene]-2-sulfanylidene-1,3-thiazolidin-4-one	1800107: DNA Pol λ PEX Assay from Article 10.1021/cb4007562: “Expanding the Scope of Human DNA Polymerase ¿ and ß Inhibitors.”	ic50	3.9000	uM
(5Z)-5-[[3-bromo-4-(3-fluoro-4-methylphenyl)sulfanylphenyl]methylidene]-2-sulfanylidene-1,3-thiazolidin-4-one	1800107: DNA Pol λ PEX Assay from Article 10.1021/cb4007562: “Expanding the Scope of Human DNA Polymerase ¿ and ß Inhibitors.”	ic50	4.0000	uM
(5Z)-5-[[2,4-bis[(4-methylphenyl)sulfanyl]phenyl]methylidene]-2-sulfanylidene-1,3-thiazolidin-4-one	1800107: DNA Pol λ PEX Assay from Article 10.1021/cb4007562: “Expanding the Scope of Human DNA Polymerase ¿ and ß Inhibitors.”	ic50	4.0000	uM
(1R,3E,5S,6S,7R)-3-[(3,4-dihydroxyphenyl)-hydroxymethylidene]-7-[(2E,6R)-6-hydroxy-3,7-dimethylocta-2,7-dienyl]-6-methyl-1,5-bis(3-methylbut-2-enyl)-6-(4-methylpent-3-enyl)bicyclo[3.3.1]nonane-2,4,9-trione	1323393: Inhibition of recombinant human His-tagged DNA polymerase lambda assessed as reduction in [3H]dTTP incorporation using poly(dA)/oligo(dT)18 as template/primer preincubated for 10 mins followed by template/primer addition measured after 60 mins	ic50	5.0000	uM
(1R,3E,5S,6S,7R)-3-[(3,4-dihydroxyphenyl)-hydroxymethylidene]-7-[(2E)-3,7-dimethylocta-2,6-dienyl]-6-methyl-1,5-bis(3-methylbut-2-enyl)-6-(4-methylpent-3-enyl)bicyclo[3.3.1]nonane-2,4,9-trione	1323393: Inhibition of recombinant human His-tagged DNA polymerase lambda assessed as reduction in [3H]dTTP incorporation using poly(dA)/oligo(dT)18 as template/primer preincubated for 10 mins followed by template/primer addition measured after 60 mins	ic50	5.2000	uM
(1R,3E,5S,6S,7R)-3-[(3,4-dihydroxyphenyl)-hydroxymethylidene]-6-methyl-1,5,7-tris(3-methylbut-2-enyl)-6-(4-methylpent-3-enyl)bicyclo[3.3.1]nonane-2,4,9-trione	1323393: Inhibition of recombinant human His-tagged DNA polymerase lambda assessed as reduction in [3H]dTTP incorporation using poly(dA)/oligo(dT)18 as template/primer preincubated for 10 mins followed by template/primer addition measured after 60 mins	ic50	5.4000	uM
(1R,3E,5S,6S,7R)-3-[(3,4-dihydroxyphenyl)-hydroxymethylidene]-7-[(2E,5E)-7-hydroxy-3,7-dimethylocta-2,5-dienyl]-6-methyl-1,5-bis(3-methylbut-2-enyl)-6-(4-methylpent-3-enyl)bicyclo[3.3.1]nonane-2,4,9-trione	1323393: Inhibition of recombinant human His-tagged DNA polymerase lambda assessed as reduction in [3H]dTTP incorporation using poly(dA)/oligo(dT)18 as template/primer preincubated for 10 mins followed by template/primer addition measured after 60 mins	ic50	5.6000	uM
(1R,3E,5S,6S,7R)-3-[hydroxy-(3-hydroxyphenyl)methylidene]-6-methyl-1,5,7-tris(3-methylbut-2-enyl)-6-(4-methylpent-3-enyl)bicyclo[3.3.1]nonane-2,4,9-trione	1323393: Inhibition of recombinant human His-tagged DNA polymerase lambda assessed as reduction in [3H]dTTP incorporation using poly(dA)/oligo(dT)18 as template/primer preincubated for 10 mins followed by template/primer addition measured after 60 mins	ic50	5.7000	uM
(5Z)-5-[[3-chloro-4-(4-methylphenyl)sulfanylphenyl]methylidene]-2-sulfanylidene-1,3-thiazolidin-4-one	1800107: DNA Pol λ PEX Assay from Article 10.1021/cb4007562: “Expanding the Scope of Human DNA Polymerase ¿ and ß Inhibitors.”	ic50	5.7000	uM
(1R,3E,5S,6S,7R)-3-[(3,4-dihydroxyphenyl)-hydroxymethylidene]-7-[(2E,6S)-6-hydroxy-3,7-dimethylocta-2,7-dienyl]-6-methyl-1,5-bis(3-methylbut-2-enyl)-6-(4-methylpent-3-enyl)bicyclo[3.3.1]nonane-2,4,9-trione	1323393: Inhibition of recombinant human His-tagged DNA polymerase lambda assessed as reduction in [3H]dTTP incorporation using poly(dA)/oligo(dT)18 as template/primer preincubated for 10 mins followed by template/primer addition measured after 60 mins	ic50	5.8000	uM
(5Z)-5-[[4-(4-methylphenyl)sulfanyl-3-nitrophenyl]methylidene]-2-sulfanylidene-1,3-thiazolidin-4-one	1800107: DNA Pol λ PEX Assay from Article 10.1021/cb4007562: “Expanding the Scope of Human DNA Polymerase ¿ and ß Inhibitors.”	ic50	5.9000	uM
(5Z)-5-[[4-(3-methylphenyl)sulfanyl-3-nitrophenyl]methylidene]-2-sulfanylidene-1,3-thiazolidin-4-one	1800107: DNA Pol λ PEX Assay from Article 10.1021/cb4007562: “Expanding the Scope of Human DNA Polymerase ¿ and ß Inhibitors.”	ic50	6.0000	uM
(6E)-6-[(3,4-dihydroxyphenyl)-hydroxymethylidene]-8-[(2E)-3,7-dimethylocta-2,6-dienyl]-2,2-dimethyl-8-(3-methylbut-2-enyl)chromene-5,7-dione	1323393: Inhibition of recombinant human His-tagged DNA polymerase lambda assessed as reduction in [3H]dTTP incorporation using poly(dA)/oligo(dT)18 as template/primer preincubated for 10 mins followed by template/primer addition measured after 60 mins	ic50	6.2000	uM
(1R,3Z,6R,9S,10R,13R)-3-[(3,4-dihydroxyphenyl)-hydroxymethylidene]-13-[(2E)-3,7-dimethylocta-2,6-dienyl]-6-(2-hydroxypropan-2-yl)-9-methyl-1,10-bis(3-methylbut-2-enyl)-5-oxatricyclo[7.2.2.04,10]tridecane-2,11-dione	1323393: Inhibition of recombinant human His-tagged DNA polymerase lambda assessed as reduction in [3H]dTTP incorporation using poly(dA)/oligo(dT)18 as template/primer preincubated for 10 mins followed by template/primer addition measured after 60 mins	ic50	6.9000	uM
(5,8-dioxonaphthalen-1-yl) dodecanoate	627886: Inhibition of His-tagged human DNA polymerase lambda using poly(dA)/oligo(dT)18 (A/T = 2/1) and dTTP as the DNA template-primer and nucleotide substrate after 60 mins	ic50	7.0000	uM
(1R,3Z,6R,9S,10R,13R)-3-[(3,4-dihydroxyphenyl)-hydroxymethylidene]-6-(2-hydroxypropan-2-yl)-9-methyl-1,10,13-tris(3-methylbut-2-enyl)-5-oxatricyclo[7.2.2.04,10]tridecane-2,11-dione	1323393: Inhibition of recombinant human His-tagged DNA polymerase lambda assessed as reduction in [3H]dTTP incorporation using poly(dA)/oligo(dT)18 as template/primer preincubated for 10 mins followed by template/primer addition measured after 60 mins	ic50	7.4000	uM
(1R,3E,5S,6S,7S)-3-[(3,4-dihydroxyphenyl)-hydroxymethylidene]-7-(2-hydroxy-3-methylbut-3-enyl)-6-methyl-1,5-bis(3-methylbut-2-enyl)-6-(4-methylpent-3-enyl)bicyclo[3.3.1]nonane-2,4,9-trione	1323393: Inhibition of recombinant human His-tagged DNA polymerase lambda assessed as reduction in [3H]dTTP incorporation using poly(dA)/oligo(dT)18 as template/primer preincubated for 10 mins followed by template/primer addition measured after 60 mins	ic50	8.8000	uM
(5Z)-5-[[4-(4-methylphenyl)sulfanyl-3-nitrophenyl]methylidene]-1,3-thiazolidine-2,4-dione	1800107: DNA Pol λ PEX Assay from Article 10.1021/cb4007562: “Expanding the Scope of Human DNA Polymerase ¿ and ß Inhibitors.”	ic50	10.0000	uM
(5Z)-5-[(4-cyclohexylsulfanyl-3-nitrophenyl)methylidene]-2-sulfanylidene-1,3-thiazolidin-4-one	1800107: DNA Pol λ PEX Assay from Article 10.1021/cb4007562: “Expanding the Scope of Human DNA Polymerase ¿ and ß Inhibitors.”	ic50	10.0000	uM
(5Z)-5-[[4-(4-methylphenyl)sulfanylphenyl]methylidene]-2-sulfanylidene-1,3-thiazolidin-4-one	1800107: DNA Pol λ PEX Assay from Article 10.1021/cb4007562: “Expanding the Scope of Human DNA Polymerase ¿ and ß Inhibitors.”	ic50	10.0000	uM
(5Z)-5-[[3-fluoro-4-(4-methylphenyl)sulfanylphenyl]methylidene]-2-sulfanylidene-1,3-thiazolidin-4-one	1800107: DNA Pol λ PEX Assay from Article 10.1021/cb4007562: “Expanding the Scope of Human DNA Polymerase ¿ and ß Inhibitors.”	ic50	10.0000	uM
(5Z)-5-[[3-bromo-4-(4-methylphenyl)sulfanylphenyl]methylidene]-2-sulfanylidene-1,3-thiazolidin-4-one	1800107: DNA Pol λ PEX Assay from Article 10.1021/cb4007562: “Expanding the Scope of Human DNA Polymerase ¿ and ß Inhibitors.”	ic50	10.0000	uM
(5Z)-5-[[4-(4-methylphenyl)sulfanyl-3-(trifluoromethyl)phenyl]methylidene]-2-sulfanylidene-1,3-thiazolidin-4-one	1800107: DNA Pol λ PEX Assay from Article 10.1021/cb4007562: “Expanding the Scope of Human DNA Polymerase ¿ and ß Inhibitors.”	ic50	10.0000	uM
2-(4-methylphenyl)sulfanyl-5-[(Z)-(4-oxo-2-sulfanylidene-1,3-thiazolidin-5-ylidene)methyl]benzonitrile	1800107: DNA Pol λ PEX Assay from Article 10.1021/cb4007562: “Expanding the Scope of Human DNA Polymerase ¿ and ß Inhibitors.”	ic50	10.0000	uM
(5Z)-5-[[4-(4-ethylphenyl)sulfanyl-3-nitrophenyl]methylidene]-2-sulfanylidene-1,3-thiazolidin-4-one	1800107: DNA Pol λ PEX Assay from Article 10.1021/cb4007562: “Expanding the Scope of Human DNA Polymerase ¿ and ß Inhibitors.”	ic50	10.0000	uM
(5Z)-5-[[3-nitro-4-[4-(trifluoromethyl)phenyl]sulfanylphenyl]methylidene]-2-sulfanylidene-1,3-thiazolidin-4-one	1800107: DNA Pol λ PEX Assay from Article 10.1021/cb4007562: “Expanding the Scope of Human DNA Polymerase ¿ and ß Inhibitors.”	ic50	10.0000	uM
(5Z)-5-[[4-(3-fluoro-4-methylphenyl)sulfanyl-3-nitrophenyl]methylidene]-2-sulfanylidene-1,3-thiazolidin-4-one	1800107: DNA Pol λ PEX Assay from Article 10.1021/cb4007562: “Expanding the Scope of Human DNA Polymerase ¿ and ß Inhibitors.”	ic50	10.0000	uM
(5Z)-5-[[3-nitro-4-[2,3,5,6-tetrafluoro-4-(trifluoromethyl)phenyl]sulfanylphenyl]methylidene]-2-sulfanylidene-1,3-thiazolidin-4-one	1800107: DNA Pol λ PEX Assay from Article 10.1021/cb4007562: “Expanding the Scope of Human DNA Polymerase ¿ and ß Inhibitors.”	ic50	10.0000	uM
(5Z)-5-[[4-(3,5-dimethylphenyl)sulfanyl-3-nitrophenyl]methylidene]-2-sulfanylidene-1,3-thiazolidin-4-one	1800107: DNA Pol λ PEX Assay from Article 10.1021/cb4007562: “Expanding the Scope of Human DNA Polymerase ¿ and ß Inhibitors.”	ic50	10.0000	uM
(5Z)-5-[(4-naphthalen-2-ylsulfanyl-3-nitrophenyl)methylidene]-2-sulfanylidene-1,3-thiazolidin-4-one	1800107: DNA Pol λ PEX Assay from Article 10.1021/cb4007562: “Expanding the Scope of Human DNA Polymerase ¿ and ß Inhibitors.”	ic50	10.0000	uM
(5Z)-5-[[4-(2-methylphenyl)sulfanylphenyl]methylidene]-2-sulfanylidene-1,3-thiazolidin-4-one	1800107: DNA Pol λ PEX Assay from Article 10.1021/cb4007562: “Expanding the Scope of Human DNA Polymerase ¿ and ß Inhibitors.”	ic50	10.0000	uM
(5Z)-5-[[3-fluoro-4-(2-methylphenyl)sulfanylphenyl]methylidene]-2-sulfanylidene-1,3-thiazolidin-4-one	1800107: DNA Pol λ PEX Assay from Article 10.1021/cb4007562: “Expanding the Scope of Human DNA Polymerase ¿ and ß Inhibitors.”	ic50	10.0000	uM
(5Z)-5-[[4-(2-methylphenyl)sulfanyl-3-(trifluoromethyl)phenyl]methylidene]-2-sulfanylidene-1,3-thiazolidin-4-one	1800107: DNA Pol λ PEX Assay from Article 10.1021/cb4007562: “Expanding the Scope of Human DNA Polymerase ¿ and ß Inhibitors.”	ic50	10.0000	uM
(5Z)-5-[[4-bromo-5-(4-methylphenyl)sulfanylthiophen-2-yl]methylidene]-2-sulfanylidene-1,3-thiazolidin-4-one	1800107: DNA Pol λ PEX Assay from Article 10.1021/cb4007562: “Expanding the Scope of Human DNA Polymerase ¿ and ß Inhibitors.”	ic50	10.0000	uM
4-hydroxy-5-[1-[4-(4-methylphenyl)sulfanyl-3-nitrophenyl]ethenyl]-3H-1,3-thiazole-2-thione	1800107: DNA Pol λ PEX Assay from Article 10.1021/cb4007562: “Expanding the Scope of Human DNA Polymerase ¿ and ß Inhibitors.”	ic50	10.0000	uM

CTD chemical–gene interactions

27 total (human), top 27 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Benzo(a)pyrene	increases expression, increases methylation	2
Estradiol	decreases expression	2
alpha-pinene	affects cotreatment, increases oxidation, increases abundance	1
honokiol	decreases activity	1
methacrylaldehyde	increases abundance, affects cotreatment, increases oxidation	1
benzo(a)pyrene diolepoxide I	increases expression	1
perfluorooctane sulfonic acid	increases expression	1
abrine	increases expression	1
Decitabine	decreases expression, decreases reaction	1
Glyphosate	increases expression	1
Acrolein	affects cotreatment, increases oxidation, increases abundance	1
Air Pollutants	affects cotreatment, increases abundance, increases oxidation	1
Amiodarone	increases expression	1
Caffeine	increases phosphorylation	1
Doxorubicin	decreases expression	1
Ozone	affects cotreatment, increases oxidation, increases abundance	1
Phthalic Acids	decreases methylation	1
Selenium	affects cotreatment, increases expression	1
Selenomethionine	affects expression	1
Smoke	decreases expression	1
Thiram	decreases expression	1
Tobacco Smoke Pollution	decreases expression	1
Vitamin E	affects cotreatment, increases expression	1
Aflatoxin B1	decreases expression, increases methylation, decreases reaction	1
Okadaic Acid	decreases expression	1
Acrylamide	decreases expression	1
Volatile Organic Compounds	affects cotreatment, increases oxidation	1

ChEMBL screening assays

21 unique, capped per target: 21 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1023129	Binding	Inhibition of human DNA polymerase lambda at 100 uM	Penicilliols A and B, novel inhibitors specific to mammalian Y-family DNA polymerases. — *Bioorg Med Chem*

Cellosaurus cell lines

4 cell lines: 4 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B2BG	Abcam HeLa POLL KO	Cancer cell line	Female
CVCL_TF03	HAP1 POLL (-) 1	Cancer cell line	Male
CVCL_TF04	HAP1 POLL (-) 2	Cancer cell line	Male
CVCL_TF05	HAP1 POLL (-) 3	Cancer cell line	Male

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

Predicted chemistry — Sugi Predict

The predicted patent-compound landscape for POLL across ~30M SureChEMBL compounds — explore on Sugi Predict.