POTEJ

Summary

POTEJ (POTE ankyrin domain family member J, HGNC:37094) is a protein-coding gene on chromosome 2q21.1, encoding POTE ankyrin domain family member J (P0CG39).

Predicted to enable protein kinase binding activity. Predicted to be a structural constituent of postsynaptic actin cytoskeleton. Predicted to be involved in axonogenesis and cell motility. Located in extracellular exosome.

Source: NCBI Gene 653781 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 12 total
• MANE Select transcript: NM_001277083

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:37094
Approved symbol	POTEJ
Name	POTE ankyrin domain family member J
Location	2q21.1
Locus type	gene with protein product
Status	Approved
Aliases	POTE2beta
Ensembl gene	ENSG00000222038
Ensembl biotype	protein_coding
Entrez	653781

Gene structure

Transcript identifiers

Ensembl transcripts: 1 — 1 protein_coding

ENST00000409602

RefSeq mRNA: 1 — MANE Select: NM_001277083 NM_001277083

CCDS: CCDS59432

Canonical transcript exons

ENST00000409602 — 15 exons

Exon	Start	End
ENSE00001723108	130611440	130611942
ENSE00002434805	130617065	130617238
ENSE00002442943	130616790	130616904
ENSE00002453749	130629949	130630019
ENSE00002457441	130645737	130645781
ENSE00002461380	130654921	130655041
ENSE00002468159	130631409	130631453
ENSE00002470102	130621466	130621603
ENSE00002472997	130620045	130620151
ENSE00002496629	130638619	130638689
ENSE00002499512	130624064	130624134
ENSE00002501018	130632490	130632656
ENSE00002508231	130646129	130646310
ENSE00002509853	130643983	130644053
ENSE00002513344	130656549	130658037

Expression profiles

Bgee: expression breadth broad, 18 present calls, max score 81.19.

Top tissues by expression

119 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	81.19	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	49.57	silver quality
cortical plate	UBERON:0005343	45.27	gold quality
ganglionic eminence	UBERON:0004023	44.07	gold quality
prostate gland	UBERON:0002367	38.53	gold quality
bone marrow cell	CL:0002092	38.21	gold quality
colonic epithelium	UBERON:0000397	37.20	gold quality
right atrium auricular region	UBERON:0006631	36.69	gold quality
hindlimb stylopod muscle	UBERON:0004252	36.10	silver quality
sural nerve	UBERON:0015488	35.27	gold quality
right uterine tube	UBERON:0001302	34.93	gold quality
testis	UBERON:0000473	34.52	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	33.96	silver quality
bone marrow	UBERON:0002371	33.83	gold quality
tonsil	UBERON:0002372	33.80	gold quality
fundus of stomach	UBERON:0001160	32.91	gold quality
duodenum	UBERON:0002114	32.48	gold quality
endometrium	UBERON:0001295	32.09	gold quality
stomach	UBERON:0000945	31.74	silver quality
urinary bladder	UBERON:0001255	31.71	gold quality
left testis	UBERON:0004533	31.59	silver quality
blood	UBERON:0000178	31.58	gold quality
mucosa of stomach	UBERON:0001199	31.56	gold quality
lymph node	UBERON:0000029	30.93	gold quality
right testis	UBERON:0004534	30.89	gold quality
prefrontal cortex	UBERON:0000451	30.70	gold quality
body of stomach	UBERON:0001161	30.54	gold quality
stromal cell of endometrium	CL:0002255	29.87	gold quality
liver	UBERON:0002107	29.79	gold quality
superior frontal gyrus	UBERON:0002661	29.37	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	2.90

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

19 targeting POTEJ, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3646	100.00	73.56	5283
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-3662	99.99	73.82	5684
HSA-MIR-570-3P	99.96	72.41	4910
HSA-MIR-6772-5P	99.94	67.01	577
HSA-MIR-7-1-3P	99.91	71.53	4384
HSA-MIR-7-2-3P	99.91	71.40	4394
HSA-MIR-12119	99.87	68.35	1653
HSA-MIR-4762-3P	99.43	69.72	2363
HSA-MIR-4251	99.40	69.19	3363
HSA-MIR-1253	99.12	67.08	1688
HSA-MIR-6770-5P	98.97	66.76	1853
HSA-MIR-412-3P	98.86	66.89	712
HSA-MIR-6754-3P	98.84	66.60	889
HSA-MIR-4303	98.01	68.13	2304
HSA-MIR-192-3P	97.52	67.66	1001
HSA-MIR-937-5P	97.43	68.39	667
HSA-MIR-6872-3P	97.08	66.99	750
HSA-MIR-4664-3P	88.57	63.79	80

Cross-species orthologs

0 orthologs

Paralogs (16): BCL3 (ENSG00000069399), NFKBIE (ENSG00000146232), POTED (ENSG00000166351), POTEC (ENSG00000183206), POTEG (ENSG00000187537), POTEE (ENSG00000188219), POTEA (ENSG00000188877), POTEF (ENSG00000196604), POTEI (ENSG00000196834), POTEH (ENSG00000198062), POTEM (ENSG00000222036), POTEB2 (ENSG00000230031), POTEB (ENSG00000233917), (ENSG00000276760), (ENSG00000277630), POTEB3 (ENSG00000278522)

Protein

Protein identifiers

POTE ankyrin domain family member J — P0CG39 (reviewed: P0CG39)

All UniProt accessions (1): P0CG39

UniProt curated annotations — full annotation on UniProt →

Similarity. In the N-terminal section; belongs to the POTE family. In the C-terminal section; belongs to the actin family.

RefSeq proteins (1): NP_001264012* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR002110	Ankyrin_rpt	Repeat
IPR004000	Actin	Family
IPR004001	Actin_CS	Conserved_site
IPR020902	Actin/actin-like_CS	Conserved_site
IPR036770	Ankyrin_rpt-contain_sf	Homologous_superfamily
IPR039497	CC144C-like_CC_dom	Domain
IPR043129	ATPase_NBD	Homologous_superfamily

Pfam: PF00022, PF12796, PF14915

UniProt features (15 total): repeat 5, compositionally biased region 5, region of interest 3, chain 1, coiled-coil region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P0CG39-F1	72.20	0.46

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 42 (showing top): GOBP_NEUROGENESIS, GOBP_CELL_JUNCTION_ORGANIZATION, GOCC_NEURON_PROJECTION, GOBP_CELL_PROJECTION_ORGANIZATION, GOCC_H4_HISTONE_ACETYLTRANSFERASE_COMPLEX, GOCC_TRANSFERASE_COMPLEX, GOCC_SYNAPSE, GOCC_AXON, GOMF_KINASE_BINDING, GOMF_STRUCTURAL_CONSTITUENT_OF_CYTOSKELETON, GOMF_STRUCTURAL_MOLECULE_ACTIVITY, GOBP_SYNAPSE_ORGANIZATION, GOBP_AXON_DEVELOPMENT, GOBP_POSTSYNAPSE_ORGANIZATION, GOBP_POSTSYNAPTIC_CYTOSKELETON_ORGANIZATION

GO Biological Process (3): axonogenesis (GO:0007409), cell motility (GO:0048870), postsynaptic actin cytoskeleton organization (GO:0098974)

GO Molecular Function (3): protein kinase binding (GO:0019901), structural constituent of postsynaptic actin cytoskeleton (GO:0098973), protein binding (GO:0005515)

GO Cellular Component (9): obsolete extracellular space (GO:0005615), cytoplasm (GO:0005737), actin filament (GO:0005884), actin cytoskeleton (GO:0015629), membrane (GO:0016020), axon (GO:0030424), NuA4 histone acetyltransferase complex (GO:0035267), synapse (GO:0045202), extracellular exosome (GO:0070062)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	2
cell morphogenesis involved in neuron differentiation	1
neuron projection morphogenesis	1
axon development	1
cellular process	1
actin cytoskeleton organization	1
postsynaptic cytoskeleton organization	1
kinase binding	1
structural constituent of cytoskeleton	1
postsynaptic actin cytoskeleton	1
postsynaptic actin cytoskeleton organization	1
structural constituent of postsynapse	1
binding	1
intracellular anatomical structure	1
actin cytoskeleton	1
polymeric cytoskeletal fiber	1
cytoskeleton	1
neuron projection	1
H4/H2A histone acetyltransferase complex	1
cell junction	1
extracellular vesicle	1

Protein interactions and networks

STRING

578 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
POTEJ	TRIM49C	P0CI26	470
POTEJ	NMT1	P30419	456
POTEJ	AGAP4	Q96P64	400
POTEJ	CCDC183	Q5T5S1	394
POTEJ	PPP1R37	O75864	372
POTEJ	ZNG1C	Q5JTY5	371
POTEJ	A0A087WTP8	A0A087WTP8	353
POTEJ	TRIM49	P0CI25	348
POTEJ	ZNF418	Q8TF45	348
POTEJ	AMER3	Q8N944	322
POTEJ	GPR148	Q8TDV2	307
POTEJ	ABRACL	Q9P1F3	297
POTEJ	ARGLU1	Q9NWB6	290
POTEJ	CDH24	Q86UP0	271
POTEJ	VSIG2	Q96IQ7	270

IntAct

23 interactions, top by confidence:

A	B	Type	Score
CFTR	ESYT2	psi-mi:“MI:0914”(association)	0.710
BCL7A	ARID1A	psi-mi:“MI:0914”(association)	0.640
INSR	PIK3R2	psi-mi:“MI:2364”(proximity)	0.570
CFTR	PLEKHG3	psi-mi:“MI:0914”(association)	0.480
CFTR	CNOT1	psi-mi:“MI:0914”(association)	0.480
CAT	NUDT19	psi-mi:“MI:0914”(association)	0.420
BCL7A	DPF1	psi-mi:“MI:0914”(association)	0.350
RIN3		psi-mi:“MI:0914”(association)	0.350
CTBP1	TAF15	psi-mi:“MI:0914”(association)	0.350
CFTR	POTEF	psi-mi:“MI:0914”(association)	0.350
HCN1	POTEF	psi-mi:“MI:0914”(association)	0.350
CAP2	POTEF	psi-mi:“MI:0914”(association)	0.350
PFN3	POTEJ	psi-mi:“MI:0914”(association)	0.350
VP24	POTEF	psi-mi:“MI:0914”(association)	0.350
NDN	HDLBP	psi-mi:“MI:2364”(proximity)	0.270

BioGRID (77): POTEJ (Affinity Capture-MS), POTEJ (Affinity Capture-MS), POTEJ (Affinity Capture-MS), POTEJ (Affinity Capture-MS), POTEJ (Affinity Capture-MS), POTEJ (Affinity Capture-MS), POTEJ (Affinity Capture-MS), POTEJ (Affinity Capture-MS), POTEJ (Affinity Capture-MS), POTEJ (Affinity Capture-MS), POTEJ (Affinity Capture-MS), POTEJ (Affinity Capture-MS), POTEJ (Affinity Capture-MS), POTEJ (Affinity Capture-MS), POTEJ (Affinity Capture-MS)

ESM2 similar proteins: A0A072TK64, A0A072ULZ1, A0A6P8HC43, A2PYL6, A2PYL7, A2PYL8, A2XE45, A2XEA0, A2Y6J9, A5A3E0, B5DUH6, E9Q0N2, F4HWL4, F4JCB2, O04309, O08528, O24521, O95744, P0CG38, P0CG39, P25071, P27881, P28316, P29127, P35753, P37842, P52789, Q1W674, Q29428, Q6S8J3, Q70SU7, Q70SU8, Q75II4, Q84JE8, Q8L727, Q8LRK8, Q8RXK2, Q8VC49, Q90WJ7, Q93Y92

Diamond homologs: A0A0A6YYL3, A0JP26, A0PJZ0, A2A2Z9, A2RUR9, A5A3E0, A6NC57, A6NI47, A7E2S9, B2RU33, H3BUK9, P0CG38, P0CG39, Q3MJ40, Q4R3S3, Q4UJ75, Q5CZ79, Q5JPF3, Q5SQ80, Q5TYW2, Q5VUR7, Q6NSI1, Q6S545, Q6S5H5, Q6S8J3, Q6S8J7, Q811D2, Q86YR6, Q8IYA2, Q92527, Q9BXX2, Q9BXX3, Q9D504, Q9H560, Q9UPS8, Q8IVF6, A6QL64, Q8N2N9, Q8NF67, Q96IX9

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

12 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	0
Likely benign	9
Benign	1

Top pathogenic / likely-pathogenic (0)

SpliceAI

1720 predictions. Top by Δscore:

Variant	Effect	Δscore
2:130611940:G:GT	donor_gain	1.0000
2:130611940:GAG:G	donor_gain	1.0000
2:130617048:T:TA	acceptor_gain	1.0000
2:130617054:A:AG	acceptor_gain	1.0000
2:130617055:A:G	acceptor_gain	1.0000
2:130617059:T:A	acceptor_gain	1.0000
2:130617235:CAAGG:C	donor_loss	1.0000
2:130617236:AAGG:A	donor_loss	1.0000
2:130617238:GGTA:G	donor_loss	1.0000
2:130617239:G:GA	donor_loss	1.0000
2:130617240:T:G	donor_loss	1.0000
2:130620044:GC:G	acceptor_gain	1.0000
2:130620044:GCAT:G	acceptor_gain	1.0000
2:130620149:A:T	donor_gain	1.0000
2:130621464:A:AG	acceptor_gain	1.0000
2:130621465:G:GA	acceptor_gain	1.0000
2:130621465:GAACT:G	acceptor_gain	1.0000
2:130621602:GT:G	donor_gain	1.0000
2:130621604:G:GG	donor_gain	1.0000
2:130624059:CATA:C	acceptor_loss	1.0000
2:130624061:TAGA:T	acceptor_loss	1.0000
2:130624062:A:AG	acceptor_gain	1.0000
2:130624062:A:C	acceptor_loss	1.0000
2:130624063:G:GG	acceptor_gain	1.0000
2:130624063:GA:G	acceptor_gain	1.0000
2:130632483:A:AG	acceptor_gain	1.0000
2:130632485:TCAAG:T	acceptor_loss	1.0000
2:130632487:AAG:A	acceptor_gain	1.0000
2:130632488:A:G	acceptor_gain	1.0000
2:130632489:G:GG	acceptor_gain	1.0000

AlphaMissense

6971 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
2:130616804:T:C	L142P	0.991
2:130621519:T:C	L287P	0.988
2:130657119:T:C	F787L	0.988
2:130657121:T:A	F787L	0.988
2:130657121:T:G	F787L	0.988
2:130617102:T:C	L188S	0.986
2:130617105:T:C	L189P	0.986
2:130617201:T:C	L221P	0.986
2:130617065:G:C	A176P	0.985
2:130617134:G:C	D199H	0.985
2:130657128:T:C	F790L	0.984
2:130657130:C:A	F790L	0.984
2:130657130:C:G	F790L	0.984
2:130611861:C:A	A110D	0.983
2:130620139:A:T	D265V	0.983
2:130657767:T:A	W1003R	0.983
2:130657767:T:C	W1003R	0.983
2:130616876:A:T	D166V	0.982
2:130611891:T:C	L120P	0.981
2:130617134:G:T	D199Y	0.981
2:130621582:C:A	A308D	0.981
2:130617235:C:A	N232K	0.980
2:130617235:C:G	N232K	0.980
2:130620069:G:C	G242R	0.980
2:130616843:T:C	L155P	0.978
2:130617135:A:T	D199V	0.978
2:130620067:T:C	L241P	0.978
2:130621480:T:C	L274P	0.978
2:130657803:T:C	F1015L	0.978
2:130657805:C:A	F1015L	0.978

dbSNP variants (sampled 300 via entrez): RS1000305412 (2:130654459 C>G), RS1000566233 (2:130658312 G>C), RS1000626227 (2:130655938 A>C), RS1000673038 (2:130637245 C>A,T), RS1000785402 (2:130636795 A>G), RS1001464202 (2:130634416 T>C), RS1001472236 (2:130656098 T>C), RS1001619467 (2:130656966 C>G,T), RS1001798341 (2:130656414 C>T), RS1001852285 (2:130639939 T>C), RS1001914249 (2:130637966 T>A), RS1002134743 (2:130610568 T>C), RS1002421987 (2:130612960 C>T), RS1003454894 (2:130613290 ATATATATACATATG>A,ATATATATACATATGTATATATACATATG), RS1003528216 (2:130644361 T>G)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

7 total (human), top 7 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
beauvericin	affects cotreatment, decreases expression	1
bisphenol A	decreases expression	1
sodium arsenite	increases expression	1
enniatins	affects cotreatment, decreases expression	1
Doxorubicin	decreases expression	1
Oxygen	increases expression	1
Tobacco Smoke Pollution	affects expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.