PPIAL4G
gene geneOn this page
Summary
PPIAL4G (peptidylprolyl isomerase A like 4G, HGNC:33996) is a protein-coding gene on chromosome 1q21.2, encoding Peptidyl-prolyl cis-trans isomerase A-like 4G (P0DN37). PPIases accelerate the folding of proteins.
Predicted to enable cyclosporin A binding activity and peptidyl-prolyl cis-trans isomerase activity. Predicted to be involved in protein folding. Predicted to be active in cytoplasm.
Source: NCBI Gene 644591 — RefSeq curated summary.
At a glance
- Clinical variants (ClinVar): 36 total
- MANE Select transcript:
NM_001123068
Identifiers
Gene identifiers
| Field | Value |
|---|---|
| HGNC ID | HGNC:33996 |
| Approved symbol | PPIAL4G |
| Name | peptidylprolyl isomerase A like 4G |
| Location | 1q21.2 |
| Locus type | gene with protein product |
| Status | Approved |
| Ensembl gene | ENSG00000236334 |
| Ensembl biotype | protein_coding |
| Entrez | 644591 |
Gene structure
Transcript identifiers
Ensembl transcripts: 1 — 1 protein_coding
ENST00000419275
RefSeq mRNA: 1 — MANE Select: NM_001123068
NM_001123068
CCDS: CCDS41375
Canonical transcript exons
ENST00000419275 — 1 exons
| Exon | Start | End |
|---|---|---|
| ENSE00003734399 | 148482548 | 148483302 |
Expression profiles
Bgee: expression breadth ubiquitous, 127 present calls, max score 85.07.
Top tissues by expression
134 total, by Bgee expression score (0-100, higher = more expressed):
| Tissue | Anatomy ID | Expression score | Quality |
|---|---|---|---|
| primordial germ cell in gonad | CL:0000670 ∩ UBERON:0000991 | 85.07 | silver quality |
| male germ line stem cell (sensu Vertebrata) in testis | CL:0000089 ∩ UBERON:0000473 | 83.56 | gold quality |
| calcaneal tendon | UBERON:0003701 | 65.57 | gold quality |
| corpus callosum | UBERON:0002336 | 64.34 | gold quality |
| granulocyte | CL:0000094 | 62.89 | gold quality |
| adrenal tissue | UBERON:0018303 | 61.57 | gold quality |
| sural nerve | UBERON:0015488 | 60.27 | gold quality |
| mucosa of stomach | UBERON:0001199 | 57.52 | gold quality |
| primary visual cortex | UBERON:0002436 | 53.62 | gold quality |
| endometrium | UBERON:0001295 | 53.39 | gold quality |
| duodenum | UBERON:0002114 | 52.99 | gold quality |
| right coronary artery | UBERON:0001625 | 52.90 | gold quality |
| nucleus accumbens | UBERON:0001882 | 52.19 | gold quality |
| right uterine tube | UBERON:0001302 | 52.16 | gold quality |
| pituitary gland | UBERON:0000007 | 52.02 | gold quality |
| right adrenal gland cortex | UBERON:0035827 | 51.32 | gold quality |
| cerebellar hemisphere | UBERON:0002245 | 50.37 | gold quality |
| cerebellar cortex | UBERON:0002129 | 50.30 | gold quality |
| cerebellum | UBERON:0002037 | 50.01 | gold quality |
| left adrenal gland cortex | UBERON:0035825 | 49.84 | gold quality |
| adenohypophysis | UBERON:0002196 | 49.71 | gold quality |
| hypothalamus | UBERON:0001898 | 49.66 | gold quality |
| anterior cingulate cortex | UBERON:0009835 | 49.31 | gold quality |
| prefrontal cortex | UBERON:0000451 | 49.26 | gold quality |
| bone marrow | UBERON:0002371 | 49.25 | gold quality |
| descending thoracic aorta | UBERON:0002345 | 49.11 | gold quality |
| brain | UBERON:0000955 | 48.72 | gold quality |
| left uterine tube | UBERON:0001303 | 48.44 | gold quality |
| frontal cortex | UBERON:0001870 | 48.30 | gold quality |
| right lung | UBERON:0002167 | 48.22 | gold quality |
Single-cell (SCXA)
Detected in 1 experiment(s), a significant marker in 1.
| Experiment | Marker? | Max mean expression |
|---|---|---|
| E-ANND-3 | yes | 2.71 |
Regulation
Is transcription factor: no
miRNA regulators (miRDB)
11 targeting PPIAL4G, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):
| miRNA | Max score | Avg score | miRNA target_count |
|---|---|---|---|
| HSA-MIR-1252-5P | 100.00 | 69.80 | 2774 |
| HSA-MIR-1184 | 99.99 | 68.19 | 1458 |
| HSA-MIR-205-3P | 99.92 | 69.92 | 3165 |
| HSA-MIR-4802-3P | 99.72 | 70.13 | 1273 |
| HSA-MIR-3202 | 99.66 | 67.70 | 2737 |
| HSA-MIR-548V | 99.29 | 69.47 | 1157 |
| HSA-MIR-6830-5P | 99.01 | 68.73 | 1884 |
| HSA-MIR-4456 | 97.50 | 64.88 | 1678 |
| HSA-MIR-3622B-5P | 94.62 | 64.58 | 835 |
| HSA-MIR-6750-5P | 93.94 | 66.68 | 797 |
| HSA-MIR-6822-5P | 93.94 | 66.34 | 812 |
Cross-species orthologs
10 orthologs
| Organism | Symbol | Gene ID |
|---|---|---|
| danio_rerio | ppifa | ENSDARG00000007409 |
| danio_rerio | ppiaa | ENSDARG00000009212 |
| danio_rerio | ppiab | ENSDARG00000103994 |
| drosophila_melanogaster | Cyp40 | FBGN0036020 |
| drosophila_melanogaster | Moca-cyp | FBGN0039581 |
| caenorhabditis_elegans | WBGENE00000877 | |
| caenorhabditis_elegans | WBGENE00000878 | |
| caenorhabditis_elegans | WBGENE00000879 | |
| caenorhabditis_elegans | WBGENE00000883 | |
| caenorhabditis_elegans | WBGENE00000885 |
Paralogs (22): PPIE (ENSG00000084072), PPIL2 (ENSG00000100023), PPIF (ENSG00000108179), PPWD1 (ENSG00000113593), NKTR (ENSG00000114857), PPIL4 (ENSG00000131013), PPIL1 (ENSG00000137168), PPIG (ENSG00000138398), CWC27 (ENSG00000153015), PPIB (ENSG00000166794), PPIC (ENSG00000168938), PPID (ENSG00000171497), PPIH (ENSG00000171960), PPIL6 (ENSG00000185250), PPIA (ENSG00000196262), PPIL3 (ENSG00000240344), PPIAL4A (ENSG00000263353), PPIAL4H (ENSG00000270339), PPIAL4E (ENSG00000271567), PPIAL4F (ENSG00000279782), PPIAL4C (ENSG00000288867), PPIAL4D (ENSG00000289549)
Protein
Protein identifiers
Peptidyl-prolyl cis-trans isomerase A-like 4G — P0DN37 (reviewed: P0DN37)
Alternative names: Peptidylprolyl cis-trans isomerase A-like 4
All UniProt accessions (1): P0DN37
UniProt curated annotations — full annotation on UniProt →
Function. PPIases accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides.
Subcellular location. Cytoplasm.
Miscellaneous. It is one of six related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 1.
Similarity. Belongs to the cyclophilin-type PPIase family. PPIase A subfamily.
RefSeq proteins (1): NP_001116540* (*=MANE)
Domains & families (InterPro)
| ID | Name | Type |
|---|---|---|
| IPR002130 | Cyclophilin-type_PPIase_dom | Domain |
| IPR020892 | Cyclophilin-type_PPIase_CS | Conserved_site |
| IPR024936 | Cyclophilin-type_PPIase | Family |
| IPR029000 | Cyclophilin-like_dom_sf | Homologous_superfamily |
Pfam: PF00160
Catalyzed reactions (Rhea), 1 shown:
- [protein]-peptidylproline (omega=180) = [protein]-peptidylproline (omega=0) (RHEA:16237)
UniProt features (2 total): chain 1, domain 1
Structure
Experimental structures (PDB)
0 structures.
Predicted structure (AlphaFold)
| Model | pLDDT | Fraction very-high |
|---|---|---|
| AF-P0DN37-F1 | 96.40 | 0.98 |
Function
Pathways and Gene Ontology
Reactome pathways
0 pathways
MSigDB gene sets: 11 (showing top):
GOBP_PROTEIN_MATURATION, GOBP_PROTEIN_FOLDING, chr1q21, GOMF_CIS_TRANS_ISOMERASE_ACTIVITY, GOMF_AMIDE_BINDING, GOMF_ISOMERASE_ACTIVITY, GOMF_CYCLOSPORIN_A_BINDING, MIR548V, MIR6750_5P, MIR6822_5P, OSMAN_BLOOD_CHAD63_KH_AGE_18_50YO_HIGH_DOSE_SUBJECTS_24HR_DN
GO Biological Process (2): protein folding (GO:0006457), protein peptidyl-prolyl isomerization (GO:0000413)
GO Molecular Function (3): peptidyl-prolyl cis-trans isomerase activity (GO:0003755), cyclosporin A binding (GO:0016018), isomerase activity (GO:0016853)
GO Cellular Component (1): cytoplasm (GO:0005737)
GO top-level categories
Rollup of top GO terms by namespace:
| Category | Terms |
|---|---|
| cellular process | 1 |
| protein maturation | 1 |
| peptidyl-proline modification | 1 |
| cis-trans isomerase activity | 1 |
| catalytic activity, acting on a protein | 1 |
| binding | 1 |
| catalytic activity | 1 |
| intracellular anatomical structure | 1 |
| cellular anatomical structure | 1 |
Protein interactions and networks
STRING
1924 interactions, top by confidence (×1000):
| Protein A | Protein B | Partner UniProt | Score |
|---|---|---|---|
| PPIAL4G | NBPF12 | Q5TAG4 | 986 |
| PPIAL4G | PRSS38 | A1L453 | 478 |
| PPIAL4G | OR2T33 | Q8NG76 | 436 |
| PPIAL4G | LYPD5 | Q6UWN5 | 375 |
| PPIAL4G | TRIML1 | Q8N9V2 | 372 |
| PPIAL4G | ANKRD36 | A6QL64 | 325 |
| PPIAL4G | TAS2R43 | P59537 | 321 |
| PPIAL4G | LRRN2 | O75325 | 308 |
| PPIAL4G | CSAG2 | Q9Y5P2 | 302 |
| PPIAL4G | ACP6 | Q9NPH0 | 300 |
| PPIAL4G | TSPAN31 | Q12999 | 290 |
| PPIAL4G | GPHRA | B7ZAQ6 | 287 |
| PPIAL4G | ATP13A3 | Q9H7F0 | 263 |
| PPIAL4G | FMO5 | P49326 | 262 |
| PPIAL4G | FKBP1C | Q5VVH2 | 262 |
IntAct
7 interactions, top by confidence:
| A | B | Type | Score |
|---|---|---|---|
| CACNG2 | CCNT1 | psi-mi:“MI:0914”(association) | 0.530 |
| PPIAL4G | ACTB | psi-mi:“MI:0914”(association) | 0.530 |
| TIGD5 | P4HA2 | psi-mi:“MI:0914”(association) | 0.350 |
| QNG1 | PPIAL4G | psi-mi:“MI:0914”(association) | 0.350 |
| PPIAL4G | PPIAL4D | psi-mi:“MI:0914”(association) | 0.350 |
| PPIAL4G | YES1 | psi-mi:“MI:0914”(association) | 0.350 |
ESM2 similar proteins: A0A075B759, A0A075B767, A0A0B4J2A2, F5H284, O00060, O43447, O74729, O94273, P0C1I0, P0C1I3, P0C1I5, P0C1I8, P0CP82, P0CP83, P0DN26, P0DN37, P17742, P23285, P24525, P25719, P52010, P52018, P62940, P84343, Q0P5D0, Q0ZQK7, Q0ZQK8, Q0ZQL0, Q0ZQL1, Q26516, Q26551, Q26565, Q27774, Q2TZ33, Q38867, Q38900, Q42406, Q4IPH4, Q4P6X6, Q4WCM6
Diamond homologs: A0A075B759, A0A075B767, A0A0B4J2A2, A0A0R0H9T5, A4FV72, D4AY02, F5H284, H2QII6, O00060, O49886, O93826, P0C1H7, P0C1H8, P0C1I2, P0C1I7, P0C1I8, P0C1I9, P0CP78, P0CP79, P0DN26, P0DN37, P10111, P10255, P14088, P14832, P14851, P17742, P18253, P21568, P21569, P22011, P24367, P24525, P25007, P25719, P29117, P30404, P30405, P34790, P34791
SIGNOR signaling
0 interactions.
Disease & clinical
Clinical variants and AI predictions
ClinVar
36 variants total. Per-class counts are floors (≥ shown; pagination cap):
| Classification | Count (floor) |
|---|---|
| Pathogenic | 0 |
| Likely pathogenic | 0 |
| Uncertain significance | 31 |
| Likely benign | 4 |
| Benign | 1 |
Top pathogenic / likely-pathogenic (0)
SpliceAI
248 predictions. Top by Δscore:
| Variant | Effect | Δscore |
|---|---|---|
| 1:148483118:T:TA | donor_gain | 0.8200 |
| 1:148483027:TGTC:T | donor_gain | 0.8100 |
| 1:148483073:AAAC:A | donor_gain | 0.7900 |
| 1:148482584:A:C | donor_gain | 0.7700 |
| 1:148483072:TAA:T | donor_gain | 0.7500 |
| 1:148483073:AAA:A | donor_gain | 0.7500 |
| 1:148483127:T:A | donor_gain | 0.7400 |
| 1:148483211:G:A | donor_gain | 0.7300 |
| 1:148483025:CTTG:C | donor_gain | 0.7200 |
| 1:148483026:TTGT:T | donor_gain | 0.7200 |
| 1:148483116:AAT:A | donor_gain | 0.6900 |
| 1:148483059:C:CT | donor_gain | 0.6500 |
| 1:148483100:G:C | donor_gain | 0.6500 |
| 1:148483123:T:A | donor_gain | 0.6300 |
| 1:148483137:AGAG:A | donor_gain | 0.6200 |
| 1:148483115:AAAT:A | donor_gain | 0.6100 |
| 1:148483088:T:TA | donor_gain | 0.6000 |
| 1:148483102:AAC:A | donor_gain | 0.6000 |
| 1:148482896:AGT:A | donor_gain | 0.5900 |
| 1:148482896:A:AC | donor_gain | 0.5800 |
| 1:148482921:TGGG:T | donor_gain | 0.5800 |
| 1:148482999:T:C | donor_gain | 0.5800 |
| 1:148483062:C:A | donor_gain | 0.5700 |
| 1:148482881:G:A | donor_gain | 0.5600 |
| 1:148483104:C:A | donor_gain | 0.5600 |
| 1:148483180:A:AC | donor_gain | 0.5600 |
| 1:148483181:C:CC | donor_gain | 0.5600 |
| 1:148482583:A:AC | donor_gain | 0.5500 |
| 1:148483013:C:A | donor_gain | 0.5500 |
| 1:148483102:A:AT | donor_gain | 0.5500 |
AlphaMissense
1108 scored. Top likely-pathogenic:
| Variant | Protein change | am_pathogenicity |
|---|---|---|
| 1:148482866:A:C | F129L | 0.769 |
| 1:148482866:A:T | F129L | 0.769 |
| 1:148482868:A:G | F129L | 0.769 |
| 1:148482917:A:C | F112L | 0.768 |
| 1:148482917:A:T | F112L | 0.768 |
| 1:148482919:A:G | F112L | 0.768 |
| 1:148483073:A:C | F60L | 0.759 |
| 1:148483073:A:T | F60L | 0.759 |
| 1:148483075:A:G | F60L | 0.759 |
| 1:148483004:A:C | F83L | 0.731 |
| 1:148483004:A:T | F83L | 0.731 |
| 1:148483006:A:G | F83L | 0.731 |
| 1:148483094:A:C | F53L | 0.721 |
| 1:148483094:A:T | F53L | 0.721 |
| 1:148483096:A:G | F53L | 0.721 |
| 1:148483232:A:C | F7L | 0.701 |
| 1:148483232:A:T | F7L | 0.701 |
| 1:148483234:A:G | F7L | 0.701 |
| 1:148483052:G:C | F67L | 0.644 |
| 1:148483052:G:T | F67L | 0.644 |
| 1:148483054:A:G | F67L | 0.644 |
| 1:148483115:A:C | F46L | 0.641 |
| 1:148483115:A:T | F46L | 0.641 |
| 1:148483117:A:G | F46L | 0.641 |
| 1:148482914:G:C | F113L | 0.639 |
| 1:148482914:G:T | F113L | 0.639 |
| 1:148482916:A:G | F113L | 0.639 |
| 1:148483145:A:C | F36L | 0.634 |
| 1:148483145:A:T | F36L | 0.634 |
| 1:148483147:A:G | F36L | 0.634 |
dbSNP variants (sampled 300 via entrez): RS111334863 (1:148482247 C>T), RS11485934 (1:148484940 C>A,T), RS11488510 (1:148484988 T>C), RS1156276953 (1:148484389 T>G), RS1156366816 (1:148485033 T>G), RS1156406160 (1:148483666 G>A), RS1156598462 (1:148483349 T>C), RS1158113756 (1:148485282 C>T), RS1159004439 (1:148485217 T>C), RS1159240245 (1:148482538 G>T), RS1160629434 (1:148484005 G>A), RS1160702450 (1:148482257 A>G), RS1160808608 (1:148483565 TTCTTTCTTTCTTTCTTTCTTTCTTTC>T), RS1160827300 (1:148483555 ATTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTC>A,ATTTC,ATTTCTTTC,ATTTCTTTCTTTC,ATTTCTTTCTTTCTTTC,ATTTCTTTCTTTCTTTCTTTC,ATTTCTTTCTTTCTTTCTTTCTTTC,ATTTCTTTCTTTCTTTCTTTCTTTCTTTC,ATTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTC,ATTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTC,ATTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTC,ATTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTC,ATTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTC), RS1161336153 (1:148484691 G>A)
Disease associations
OMIM: gene `` | disease phenotypes:
GenCC curated gene-disease
Mondo (0):
Orphanet (0):
HPO phenotypes
0 total (0 of 0 shown, HPO-id order):
GWAS associations
0 associations (top):
Drugs & pharmacology
Drug and pharmacology data
Is drug target: no
PharmGKB: 1 entry (VIP=true, CPIC=false)
CTD chemical–gene interactions
5 total (human), top 5 by PubMed support.
| Chemical | Actions (top 5) | PubMed papers |
|---|---|---|
| epigallocatechin gallate | decreases expression | 1 |
| Caffeine | decreases expression | 1 |
| Tobacco Smoke Pollution | decreases expression | 1 |
| Asbestos, Crocidolite | decreases expression | 1 |
| Cadmium Chloride | decreases expression | 1 |
Clinical trials (associated diseases)
0 trials via MONDO — disease-level, not drug-specific.
Related Atlas pages
No linked Atlas pages yet — the cross-entity mesh grows as the corpus expands.