PPP1R11

Summary

PPP1R11 (protein phosphatase 1 regulatory inhibitor subunit 11, HGNC:9285) is a protein-coding gene on chromosome 6p22.1, encoding E3 ubiquitin-protein ligase PPP1R11 (O60927). Atypical E3 ubiquitin-protein ligase which ubiquitinates TLR2 at ‘Lys-754’ leading to its degradation by the proteasome. It is a common-essential gene (DepMap: required in 92.1% of cancer cell lines).

This gene encodes a specific inhibitor of protein phosphatase-1 (PP1) with a differential sensitivity toward the metal-independent and metal-dependent forms of PP1. The gene is located within the major histocompatibility complex class I region on chromosome 6.

Source: NCBI Gene 6992 — RefSeq curated summary.

At a glance

• GWAS associations: 25
• Clinical variants (ClinVar): 17 total — 1 pathogenic
• Cancer dependency (DepMap): dependent in 92.1% of screened cell lines (common-essential)
• MANE Select transcript: NM_021959

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:9285
Approved symbol	PPP1R11
Name	protein phosphatase 1 regulatory inhibitor subunit 11
Location	6p22.1
Locus type	gene with protein product
Status	Approved
Aliases	HCGV, Tctex5, HCG-V, CFAP255
Ensembl gene	ENSG00000204619
Ensembl biotype	protein_coding
OMIM	606670
Entrez	6992

Gene structure

Transcript identifiers

Ensembl transcripts: 6 — 6 protein_coding

ENST00000376758, ENST00000376763, ENST00000376765, ENST00000376769, ENST00000376772, ENST00000376773

RefSeq mRNA: 1 — MANE Select: NM_021959 NM_021959

CCDS: CCDS4671

Canonical transcript exons

ENST00000376772 — 3 exons

Exon	Start	End
ENSE00001665776	30069104	30070333
ENSE00001909114	30067198	30067479
ENSE00003626514	30068590	30068698

Expression profiles

Bgee: expression breadth ubiquitous, 133 present calls, max score 96.19.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 31.8231 / max 172.2434, expressed in 1817 samples.

FANTOM5 promoters (5 alternative TSS)

Promoter ID	TPM avg	Samples expressed
66697	30.1587	1817
66698	0.8207	547
66696	0.4012	174
66699	0.2311	78
66700	0.2114	73

Top tissues by expression

134 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
rectum	UBERON:0001052	96.19	gold quality
superior frontal gyrus	UBERON:0002661	96.02	gold quality
smooth muscle tissue	UBERON:0001135	95.92	gold quality
mucosa of transverse colon	UBERON:0004991	95.86	gold quality
granulocyte	CL:0000094	95.84	gold quality
duodenum	UBERON:0002114	95.77	gold quality
blood	UBERON:0000178	95.67	gold quality
colonic epithelium	UBERON:0000397	95.53	gold quality
primary visual cortex	UBERON:0002436	95.51	gold quality
body of stomach	UBERON:0001161	95.27	gold quality
anterior cingulate cortex	UBERON:0009835	95.25	gold quality
cortical plate	UBERON:0005343	95.21	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	95.19	gold quality
gall bladder	UBERON:0002110	95.12	gold quality
hypothalamus	UBERON:0001898	95.10	gold quality
lower esophagus	UBERON:0013473	95.06	gold quality
lower esophagus muscularis layer	UBERON:0035833	95.06	gold quality
leukocyte	CL:0000738	95.00	gold quality
transverse colon	UBERON:0001157	94.98	gold quality
fundus of stomach	UBERON:0001160	94.94	gold quality
popliteal artery	UBERON:0002250	94.93	gold quality
tibial artery	UBERON:0007610	94.93	gold quality
right frontal lobe	UBERON:0002810	94.91	gold quality
monocyte	CL:0000576	94.88	gold quality
Brodmann (1909) area 9	UBERON:0013540	94.87	gold quality
vermiform appendix	UBERON:0001154	94.80	gold quality
nucleus accumbens	UBERON:0001882	94.80	gold quality
amygdala	UBERON:0001876	94.76	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	94.75	gold quality
temporal lobe	UBERON:0001871	94.73	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	8.12

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

115 targeting PPP1R11, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4692	100.00	67.32	2066
HSA-MIR-3646	100.00	73.56	5283
HSA-MIR-4455	100.00	65.48	1587
HSA-MIR-6758-5P	100.00	66.21	1470
HSA-MIR-4747-5P	100.00	67.90	2681
HSA-MIR-5196-5P	100.00	67.98	2761
HSA-MIR-34A-5P	99.99	71.21	1784
HSA-MIR-449A	99.99	71.05	1776
HSA-MIR-4514	99.99	67.10	1870
HSA-MIR-34C-5P	99.97	70.45	1577
HSA-MIR-449B-5P	99.97	70.26	1580
HSA-MIR-146A-5P	99.96	68.93	988
HSA-MIR-146B-5P	99.96	69.13	977
HSA-MIR-96-5P	99.95	72.80	2140
HSA-MIR-7153-5P	99.94	68.89	1006
HSA-MIR-497-5P	99.92	71.83	2674
HSA-MIR-12133	99.92	71.82	2006
HSA-MIR-1271-5P	99.91	71.99	1972
HSA-MIR-15A-5P	99.90	72.80	2787
HSA-MIR-15B-5P	99.90	72.78	2798
HSA-MIR-16-5P	99.90	72.80	2780
HSA-MIR-195-5P	99.90	72.81	2805
HSA-MIR-3686	99.90	70.53	2432
HSA-MIR-424-5P	99.89	71.90	2641
HSA-MIR-6838-5P	99.89	71.94	2690
HSA-MIR-95-5P	99.89	72.17	3973
HSA-MIR-6780A-5P	99.88	66.69	2776
HSA-MIR-182-5P	99.87	74.03	2589
HSA-MIR-4492	99.87	68.25	3611
HSA-MIR-221-5P	99.86	65.45	1052

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 92.1% of screened cell lines, common-essential.

Literature-anchored findings (GeneRIF, showing 5)

• Sds22 and Inhibitor-3 form a heterotrimeric complex with PP1, both in cell lysates and after purification. A pool of PP1 is complexly controlled by both Sds22 and Inhibitor-3. (PMID:17630778)
• inhibitor-3 is an in vivo target of caspase-3 and participates in the apoptotic response (PMID:18450750)
• Inh3 has two domains that are required for its interaction with PP1. (PMID:18951879)
• a model in which I3 regulates an SDS22-mediated PP1 activation step in solution that precedes SDS22 dissociation and transfer of PP1 to kinetochores, and which is required for PP1 to efficiently antagonize Aurora B. (PMID:25298395)
• Lentiviral gene transfer or knockdown of PPP1R11 in mouse lungs significantly affects lung inflammation and the clearance of Staphylococcus aureus. There is a negative correlation between PPP1R11 and TLR2 levels in white blood cell samples isolated from patients with Staphylococcus aureus infections (PMID:27805901)

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio	ppp1r11	ENSDARG00000036063
mus_musculus	Ppp1r11	ENSMUSG00000036398
rattus_norvegicus	Ppp1r11	ENSRNOG00000082306
drosophila_melanogaster	CG13994	FBGN0031772
drosophila_melanogaster	I-3	FBGN0261624
caenorhabditis_elegans		WBGENE00015579

Protein

Protein identifiers

E3 ubiquitin-protein ligase PPP1R11 — O60927 (reviewed: O60927)

Alternative names: Hemochromatosis candidate gene V protein, Protein phosphatase 1 regulatory subunit 11, Protein phosphatase inhibitor 3

All UniProt accessions (3): O60927, A2BEK1, Q5SRK2

UniProt curated annotations — full annotation on UniProt →

Function. Atypical E3 ubiquitin-protein ligase which ubiquitinates TLR2 at ‘Lys-754’ leading to its degradation by the proteasome. Plays a role in regulating inflammatory cytokine release and gram-positive bacterial clearance by functioning, in part, through the ubiquitination and degradation of TLR2. Inhibitor of protein phosphatase 1.

Subunit / interactions. Interacts with TLR2 and UBE2D2.

Tissue specificity. Widely expressed.

Post-translational modifications. Auto-ubiquitinated.

Pathway. Protein modification; protein ubiquitination.

RefSeq proteins (1): NP_068778* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR011107	PPI_Ypi1	Family

Pfam: PF07491

UniProt features (23 total): modified residue 6, mutagenesis site 6, region of interest 4, compositionally biased region 3, initiator methionine 1, chain 1, turn 1, strand 1

Structure

Experimental structures (PDB)

3 structures.

PDB	Method	Resolution (Å)
8DWL	X-RAY DIFFRACTION	2
8DWK	X-RAY DIFFRACTION	2.5
8U5G	X-RAY DIFFRACTION	3.2

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O60927-F1	66.52	0.00

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (6): 73, 74, 75, 77, 109, 2

Mutagenesis-validated functional residues (6):

Position	Phenotype
52	loss of function in inducing tlr2 degradation.
60–62	loss of function in inducing tlr2 degradation.
85	loss of function in inducing tlr2 degradation.
87	loss of function in inducing tlr2 degradation.
89–90	loss of function in inducing tlr2 degradation.
94	loss of function in inducing tlr2 degradation.

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 215 (showing top): TGCTGCT_MIR15A_MIR16_MIR15B_MIR195_MIR424_MIR497, ENK_UV_RESPONSE_KERATINOCYTE_UP, GOBP_MACROMOLECULE_CATABOLIC_PROCESS, GOBP_NEGATIVE_REGULATION_OF_MULTICELLULAR_ORGANISMAL_PROCESS, GOBP_CYTOKINE_PRODUCTION, MODULE_480, GOBP_POST_TRANSLATIONAL_PROTEIN_MODIFICATION, GOBP_DEFENSE_RESPONSE_TO_GRAM_POSITIVE_BACTERIUM, MODULE_226, GOBP_DEFENSE_RESPONSE_TO_BACTERIUM, GOBP_NEGATIVE_REGULATION_OF_CYTOKINE_PRODUCTION, CAGCCTC_MIR4855P, IVANOVA_HEMATOPOIESIS_EARLY_PROGENITOR, GOBP_PROTEIN_CATABOLIC_PROCESS, SCHLOSSER_SERUM_RESPONSE_UP

GO Biological Process (4): negative regulation of cytokine production (GO:0001818), ubiquitin-dependent protein catabolic process (GO:0006511), protein ubiquitination (GO:0016567), defense response to Gram-positive bacterium (GO:0050830)

GO Molecular Function (7): protein phosphatase inhibitor activity (GO:0004864), protein serine/threonine phosphatase inhibitor activity (GO:0004865), protein phosphatase 1 binding (GO:0008157), phosphatase binding (GO:0019902), ubiquitin protein ligase activity (GO:0061630), protein binding (GO:0005515), transferase activity (GO:0016740)

GO Cellular Component (2): nucleus (GO:0005634), cytoplasm (GO:0005737)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cytokine production	1
regulation of cytokine production	1
negative regulation of gene expression	1
negative regulation of multicellular organismal process	1
protein ubiquitination	1
modification-dependent protein catabolic process	1
protein modification by small protein conjugation	1
defense response to bacterium	1
phosphoprotein phosphatase activity	1
phosphatase inhibitor activity	1
protein phosphatase regulator activity	1
protein serine/threonine phosphatase activity	1
protein phosphatase inhibitor activity	1
protein phosphatase binding	1
enzyme binding	1
ubiquitin-protein transferase activity	1
ubiquitin-like protein ligase activity	1
binding	1
catalytic activity	1
intracellular membrane-bounded organelle	1
intracellular anatomical structure	1
cellular anatomical structure	1

Protein interactions and networks

STRING

1160 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
PPP1R11	HLA-A	P01891	718
PPP1R11	PPP1R7	Q15435	717
PPP1R11	TRIM26	Q12899	692
PPP1R11	TRIM10	Q9UDY6	591
PPP1R11	POLR1H	Q9P1U0	567
PPP1R11	PPP1R2	P41236	556
PPP1R11	PPP1R2B	Q6NXS1	554
PPP1R11	MRPL39	Q9NYK5	532
PPP1R11	GNL1	P36915	532
PPP1R11	PRR3	P79522	522
PPP1R11	TRIM39	Q9HCM9	521
PPP1R11	MTG1	Q9BT17	520
PPP1R11	PPP1R8	Q12972	507
PPP1R11	PPP1CB	P37140	505
PPP1R11	PPP1CC	P36873	481

IntAct

67 interactions, top by confidence:

A	B	Type	Score
PPP1R11	PPP1CB	psi-mi:“MI:0915”(physical association)	0.920
PPP1R11	PPP1CC	psi-mi:“MI:0915”(physical association)	0.850
PPP1CB	CCDC85C	psi-mi:“MI:0914”(association)	0.750
PPP1CB	CCDC85C	psi-mi:“MI:2364”(proximity)	0.750
PPP1CC	CCDC85C	psi-mi:“MI:0914”(association)	0.740
PPP1CC	CCDC85C	psi-mi:“MI:2364”(proximity)	0.740
PPP1CA	CCDC85C	psi-mi:“MI:0914”(association)	0.670
PPP1CA	CCDC85C	psi-mi:“MI:2364”(proximity)	0.670
PPP1R11	YAF2	psi-mi:“MI:0915”(physical association)	0.560
PPP1R11	IFT20	psi-mi:“MI:0915”(physical association)	0.560
CASP6	PPP1R11	psi-mi:“MI:0915”(physical association)	0.560
PPP1R11	FGFR3	psi-mi:“MI:0915”(physical association)	0.560
LAMP2	PPP1R11	psi-mi:“MI:0915”(physical association)	0.560
RAN	PPP1R11	psi-mi:“MI:0915”(physical association)	0.560
PPP1R11	OPTN	psi-mi:“MI:0915”(physical association)	0.560
PPP1R11	CLSTN1	psi-mi:“MI:0915”(physical association)	0.560
UBQLN1	PPP1R11	psi-mi:“MI:0915”(physical association)	0.560

BioGRID (63): PPP1R11 (Affinity Capture-MS), PPP1R11 (Affinity Capture-MS), PPP1R11 (Affinity Capture-MS), PPP1R11 (Affinity Capture-MS), DUT (Co-fractionation), PPP1CB (Co-fractionation), PPP1R11 (Co-fractionation), PPP1R11 (Co-fractionation), PPP1R11 (Co-fractionation), PPP1R11 (Affinity Capture-MS), PPP1R11 (Affinity Capture-MS), PPP1R11 (Affinity Capture-MS), PPP1R11 (Affinity Capture-MS), PPP1R11 (Affinity Capture-MS), PPP1R11 (Affinity Capture-MS)

ESM2 similar proteins: A0A098DPY0, A1CQN6, A2QPT2, A3GGT2, A3GGV1, A4HWF0, A4RD36, A5DNZ1, A5E203, A7A241, A7EXU7, A8P353, B0DX25, B0XPZ9, F5HI87, O60927, P04370, P13200, P14379, P43587, P63248, P63249, Q06428, Q07852, Q0USF2, Q1DR50, Q2GNY7, Q2UPG7, Q568K2, Q59ZU1, Q5I135, Q5TM51, Q66648, Q6BSZ8, Q6C0K1, Q6CNA0, Q6DDH0, Q6FUM5, Q6GLB0, Q6MFY6

Diamond homologs: A1CQN6, A2QPT2, A3GGT2, A3GGV1, A4RD36, A5DNZ1, A5E203, A7A241, A7EXU7, A7TSJ7, A8P353, B0DX25, B0XPZ9, O14218, O60927, P43587, Q0USF2, Q1DR50, Q2GNY7, Q2UPG7, Q568K2, Q59ZU1, Q59ZW4, Q5TM51, Q6BSZ8, Q6C0K1, Q6CNA0, Q6DDH0, Q6FUM5, Q6GLB0, Q6MFY6, Q750F0, Q7YR30, Q8K1L5, Q9P6B0, Q09384, A7TJT3

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

17 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	0
Uncertain significance	10
Likely benign	2
Benign	0

Top pathogenic / likely-pathogenic (1)

Variant ID	HGVS	Classification
150044	GRCh38/hg38 6p25.2-21.33(chr6:3224310-30657190)x3	Pathogenic

SpliceAI

621 predictions. Top by Δscore:

Variant	Effect	Δscore
6:30067175:G:T	donor_gain	1.0000
6:30067192:G:GG	donor_gain	1.0000
6:30067208:G:GT	donor_gain	1.0000
6:30067222:G:GT	donor_gain	1.0000
6:30067222:G:T	donor_gain	1.0000
6:30067476:GCCC:G	donor_gain	1.0000
6:30068588:A:AG	acceptor_gain	1.0000
6:30068589:G:GA	acceptor_gain	1.0000
6:30068589:GGA:G	acceptor_gain	1.0000
6:30068589:GGAGA:G	acceptor_gain	1.0000
6:30068694:CAAAT:C	donor_gain	1.0000
6:30068695:AAAT:A	donor_gain	1.0000
6:30068696:AAT:A	donor_gain	1.0000
6:30068697:AT:A	donor_gain	1.0000
6:30068699:G:GA	donor_loss	1.0000
6:30068699:G:GG	donor_gain	1.0000
6:30068700:T:G	donor_loss	1.0000
6:30068703:G:GG	donor_gain	1.0000
6:30069100:CTAG:C	acceptor_loss	1.0000
6:30069101:TA:T	acceptor_loss	1.0000
6:30069102:AGGC:A	acceptor_loss	1.0000
6:30069103:GGCT:G	acceptor_gain	1.0000
6:30067170:G:GT	donor_gain	0.9900
6:30067182:G:GT	donor_gain	0.9900
6:30067215:C:T	donor_gain	0.9900
6:30067225:GTGGG:G	donor_gain	0.9900
6:30067363:G:GT	donor_gain	0.9900
6:30067480:G:GG	donor_gain	0.9900
6:30068584:TTCTA:T	acceptor_loss	0.9900
6:30068585:TCTA:T	acceptor_loss	0.9900

AlphaMissense

814 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
6:30068615:T:A	L32H	1.000
6:30068647:T:A	W43R	1.000
6:30068647:T:C	W43R	1.000
6:30068648:G:C	W43S	1.000
6:30068648:G:T	W43L	1.000
6:30068649:G:C	W43C	1.000
6:30068649:G:T	W43C	1.000
6:30068670:T:A	N50K	1.000
6:30068670:T:G	N50K	1.000
6:30068693:C:T	S58F	1.000
6:30069106:T:A	C61S	1.000
6:30069106:T:C	C61R	1.000
6:30069107:G:A	C61Y	1.000
6:30069107:G:C	C61S	1.000
6:30069109:T:C	C62R	1.000
6:30069115:T:G	Y64D	1.000
6:30068609:T:A	I30N	0.999
6:30068609:T:C	I30T	0.999
6:30068615:T:C	L32P	0.999
6:30068642:T:A	V41E	0.999
6:30068665:G:C	D49H	0.999
6:30068666:A:T	D49V	0.999
6:30068668:A:G	N50D	0.999
6:30068669:A:T	N50I	0.999
6:30068671:G:A	E51K	0.999
6:30068672:A:T	E51V	0.999
6:30068673:A:C	E51D	0.999
6:30068673:A:T	E51D	0.999
6:30068683:C:A	R55S	0.999
6:30068692:T:C	S58P	0.999

dbSNP variants (sampled 300 via entrez): RS1000019458 (6:30068001 T>A), RS1000037913 (6:30065626 A>C), RS1000494152 (6:30066008 C>G,T), RS1000509720 (6:30067148 CTTTGACGCATTTGGTGCCGTGGAAGGGAAAAAGGGGGACTGCAGTA>C), RS1002141658 (6:30059986 G>A), RS1002410977 (6:30065515 A>C), RS1002460014 (6:30065948 G>T), RS1003323055 (6:30063259 A>G), RS1003387282 (6:30070680 A>G), RS1003414227 (6:30063764 G>A), RS1003930310 (6:30061134 T>A,C), RS1004942849 (6:30067185 G>GA), RS1005603451 (6:30063724 C>T), RS1006113721 (6:30064933 C>G), RS1006602894 (6:30062670 C>G)

Disease associations

OMIM: gene MIM:606670 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

25 associations (top):

Study	Trait	p-value
GCST001392_18	Lipid metabolism phenotypes	3.000000e-29
GCST002324_6	Anger	8.000000e-07
GCST004521_12	Autism spectrum disorder or schizophrenia	2.000000e-12
GCST004521_121	Autism spectrum disorder or schizophrenia	3.000000e-13
GCST004521_171	Autism spectrum disorder or schizophrenia	4.000000e-14
GCST004521_177	Autism spectrum disorder or schizophrenia	3.000000e-12
GCST004521_2	Autism spectrum disorder or schizophrenia	2.000000e-16
GCST004521_210	Autism spectrum disorder or schizophrenia	5.000000e-15
GCST004521_216	Autism spectrum disorder or schizophrenia	5.000000e-13
GCST004521_218	Autism spectrum disorder or schizophrenia	5.000000e-11
GCST004521_247	Autism spectrum disorder or schizophrenia	4.000000e-09
GCST004521_263	Autism spectrum disorder or schizophrenia	7.000000e-17
GCST004521_268	Autism spectrum disorder or schizophrenia	7.000000e-12
GCST004521_269	Autism spectrum disorder or schizophrenia	7.000000e-11
GCST004521_295	Autism spectrum disorder or schizophrenia	6.000000e-18
GCST004521_3	Autism spectrum disorder or schizophrenia	2.000000e-15
GCST004521_44	Autism spectrum disorder or schizophrenia	2.000000e-17
GCST004521_51	Autism spectrum disorder or schizophrenia	9.000000e-14
GCST004521_56	Autism spectrum disorder or schizophrenia	1.000000e-22
GCST004521_58	Autism spectrum disorder or schizophrenia	1.000000e-17
GCST004521_59	Autism spectrum disorder or schizophrenia	1.000000e-11
GCST004521_70	Autism spectrum disorder or schizophrenia	8.000000e-20
GCST004521_79	Autism spectrum disorder or schizophrenia	1.000000e-16
GCST004521_80	Autism spectrum disorder or schizophrenia	1.000000e-15
GCST004521_92	Autism spectrum disorder or schizophrenia	1.000000e-11

EFO canonical traits (2, from GWAS)

EFO ID	Trait name
EFO:0004529	lipid measurement
EFO:0003015	aggressive behavior

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

26 total (human), top 26 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	affects cotreatment, decreases expression, increases abundance, increases expression	3
Lead	affects methylation, decreases expression	2
aristolochic acid I	decreases expression	1
triphenyl phosphate	affects expression	1
bisphenol A	affects expression	1
manganese chloride	affects cotreatment, increases abundance, increases expression	1
2-palmitoylglycerol	increases expression	1
monomethylarsonous acid	increases expression	1
ICG 001	increases expression	1
abrine	increases expression	1
Resveratrol	affects cotreatment, decreases expression	1
Decitabine	affects expression	1
Arsenic	affects cotreatment, increases abundance, increases expression	1
Benzo(a)pyrene	increases methylation	1
Caffeine	decreases phosphorylation	1
Cisplatin	affects expression	1
Doxorubicin	decreases expression	1
Ivermectin	decreases expression	1
Manganese	affects cotreatment, increases abundance, increases expression	1
Plant Extracts	affects cotreatment, decreases expression	1
Smoke	decreases expression	1
Tretinoin	affects cotreatment, decreases expression	1
7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	decreases expression	1
Cyclosporine	increases expression	1
Antirheumatic Agents	decreases expression	1
Cadmium Chloride	increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.