PPP1R26

Summary

PPP1R26 (protein phosphatase 1 regulatory subunit 26, HGNC:29089) is a protein-coding gene on chromosome 9q34.3, encoding Protein phosphatase 1 regulatory subunit 26 (Q5T8A7). Inhibits phosphatase activity of protein phosphatase 1 (PP1) complexes.

Predicted to enable protein phosphatase inhibitor activity. Predicted to be located in nucleolus.

Source: NCBI Gene 9858 — RefSeq curated summary.

At a glance

• GWAS associations: 1
• Clinical variants (ClinVar): 249 total
• MANE Select transcript: NM_014811

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:29089
Approved symbol	PPP1R26
Name	protein phosphatase 1 regulatory subunit 26
Location	9q34.3
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000196422
Ensembl biotype	protein_coding
OMIM	614056
Entrez	9858

Gene structure

Transcript identifiers

Ensembl transcripts: 23 — 21 protein_coding, 2 protein_coding_CDS_not_defined

ENST00000356818, ENST00000401470, ENST00000602993, ENST00000604351, ENST00000605286, ENST00000605660, ENST00000652373, ENST00000906155, ENST00000906156, ENST00000906157, ENST00000906158, ENST00000936577, ENST00000936578, ENST00000936579, ENST00000936580, ENST00000936581, ENST00000936582, ENST00000936583, ENST00000936584, ENST00000936585, ENST00000966275, ENST00000966276, ENST00000966277

RefSeq mRNA: 1 — MANE Select: NM_014811 NM_014811

CCDS: CCDS6988

Canonical transcript exons

ENST00000356818 — 4 exons

Exon	Start	End
ENSE00001421923	135482683	135482815
ENSE00001456105	135483950	135484082
ENSE00001456106	135479782	135480022
ENSE00003842800	135484449	135488892

Expression profiles

Bgee: expression breadth ubiquitous, 269 present calls, max score 87.84.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 2.7759 / max 42.2922, expressed in 1311 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
99434	1.4259	895
99433	1.3500	786

Top tissues by expression

289 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
endometrium epithelium	UBERON:0004811	87.84	gold quality
apex of heart	UBERON:0002098	87.21	gold quality
cortical plate	UBERON:0005343	86.68	gold quality
pancreatic ductal cell	CL:0002079	86.47	silver quality
ventricular zone	UBERON:0003053	86.45	gold quality
frontal pole	UBERON:0002795	86.31	gold quality
middle temporal gyrus	UBERON:0002771	85.59	gold quality
cingulate cortex	UBERON:0003027	85.22	gold quality
anterior cingulate cortex	UBERON:0009835	85.14	gold quality
amygdala	UBERON:0001876	84.96	gold quality
ganglionic eminence	UBERON:0004023	84.83	gold quality
prefrontal cortex	UBERON:0000451	84.74	gold quality
dorsal motor nucleus of vagus nerve	UBERON:0002870	84.65	gold quality
adenohypophysis	UBERON:0002196	83.94	gold quality
endothelial cell	CL:0000115	83.86	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	83.54	gold quality
right frontal lobe	UBERON:0002810	83.50	gold quality
pituitary gland	UBERON:0000007	83.39	gold quality
neocortex	UBERON:0001950	83.07	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	82.89	gold quality
middle frontal gyrus	UBERON:0002702	82.69	silver quality
right uterine tube	UBERON:0001302	82.54	gold quality
frontal cortex	UBERON:0001870	82.45	gold quality
Brodmann (1909) area 10	UBERON:0013541	82.33	gold quality
lower esophagus mucosa	UBERON:0035834	82.16	gold quality
medial globus pallidus	UBERON:0002477	82.14	gold quality
paraflocculus	UBERON:0005351	82.11	gold quality
parotid gland	UBERON:0001831	82.10	gold quality
nucleus accumbens	UBERON:0001882	82.03	gold quality
cerebral cortex	UBERON:0000956	82.02	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	2.11

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

32 targeting PPP1R26, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-520D-5P	99.98	73.34	4883
HSA-MIR-524-5P	99.98	73.43	4882
HSA-MIR-568	99.98	69.86	2084
HSA-MIR-218-5P	99.93	72.22	2103
HSA-MIR-4492	99.87	68.25	3611
HSA-MIR-636	99.80	69.58	1500
HSA-MIR-6764-5P	99.75	67.89	2304
HSA-MIR-187-5P	99.74	70.26	1404
HSA-MIR-1283	99.69	72.42	3009
HSA-MIR-548B-3P	99.38	67.26	1000
HSA-MIR-3911	99.38	66.95	1087
HSA-MIR-7974	99.24	65.48	1137
HSA-MIR-6744-3P	99.22	64.41	972
HSA-MIR-499A-3P	99.18	69.20	1392
HSA-MIR-499B-3P	99.18	69.27	1391
HSA-MIR-4757-5P	99.12	64.51	981
HSA-MIR-6737-3P	98.95	68.56	1577
HSA-MIR-7157-3P	98.95	68.70	1582
HSA-MIR-5008-3P	98.73	67.50	1433
HSA-MIR-1227-5P	98.65	65.32	1549
HSA-MIR-6852-3P	98.54	67.60	1468
HSA-MIR-4709-5P	98.51	67.25	1335
HSA-MIR-7156-3P	98.25	67.66	859
HSA-MIR-6884-3P	98.05	65.32	750
HSA-MIR-12127	97.93	66.67	793
HSA-MIR-3909	97.55	66.78	887
HSA-MIR-1226-3P	97.51	66.32	1063
HSA-MIR-509-3-5P	97.21	67.74	1517
HSA-MIR-509-5P	97.21	67.90	1512

Literature-anchored findings (GeneRIF, showing 3)

• we showed that KIAA0649 mRNA is widely expressed in human multiple tissues and cell lines. We have also demonstrated that KIAA0649 has oncogenic characteristics: it enhances colony formation, allows anchorage-independent growth. (PMID:16053918)
• identified NRBE3 as a novel ubiquitin E3 ligase for RB that might play a role as a potential oncoprotein in human cancers (PMID:26442585)
• Results show that up-regulation of NRBE3 is correlated with lymphatic metastasis in human breast cancer (BC) tissues. Ectopic expression of NRBE3 promotes migration and invasion in BC cells. Accordingly, its knockdown inhibits migration and invasion in BC cells and lung metastasis in vivo. (PMID:30262434)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	ppp1r26	ENSDARG00000102891
mus_musculus	Ppp1r26	ENSMUSG00000035829
rattus_norvegicus	Ppp1r26	ENSRNOG00000027193

Protein

Protein identifiers

Protein phosphatase 1 regulatory subunit 26 — Q5T8A7 (reviewed: Q5T8A7)

All UniProt accessions (1): Q5T8A7

UniProt curated annotations — full annotation on UniProt →

Function. Inhibits phosphatase activity of protein phosphatase 1 (PP1) complexes. May positively regulate cell proliferation.

Subunit / interactions. Interacts with UTP20 and PPP1CA.

Subcellular location. Nucleus. Nucleolus.

Tissue specificity. Ubiquitous in normal tissues. Expressed in numerous adenocarcinoma cell lines.

RefSeq proteins (1): NP_055626* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR026130	PPP1R26	Family
IPR031474	PPP1R26_N	Domain

Pfam: PF15740

UniProt features (31 total): compositionally biased region 12, region of interest 9, sequence variant 7, chain 1, modified residue 1, sequence conflict 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q5T8A7-F1	47.17	0.06

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (1): 1161

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 61 (showing top): GSE45365_NK_CELL_VS_CD8A_DC_DN, MULLIGHAN_NPM1_SIGNATURE_3_UP, WANG_CLIM2_TARGETS_UP, TTTGTAG_MIR520D, NUYTTEN_EZH2_TARGETS_DN, GOCC_NUCLEOLUS, GOMF_PHOSPHATASE_INHIBITOR_ACTIVITY, AAGCACA_MIR218, GEORGES_TARGETS_OF_MIR192_AND_MIR215, GOMF_ENZYME_INHIBITOR_ACTIVITY, GOMF_ENZYME_REGULATOR_ACTIVITY, GOMF_PHOSPHATASE_REGULATOR_ACTIVITY, MIKKELSEN_IPS_LCP_WITH_H3K4ME3_AND_H3K27ME3, MARTENS_TRETINOIN_RESPONSE_UP, chr9q34

GO Biological Process (1): negative regulation of phosphatase activity (GO:0010923)

GO Molecular Function (2): protein phosphatase inhibitor activity (GO:0004864), protein binding (GO:0005515)

GO Cellular Component (2): nucleolus (GO:0005730), nucleus (GO:0005634)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
regulation of phosphatase activity	1
phosphatase activity	1
negative regulation of dephosphorylation	1
negative regulation of hydrolase activity	1
phosphoprotein phosphatase activity	1
phosphatase inhibitor activity	1
protein phosphatase regulator activity	1
binding	1
nuclear lumen	1
intracellular membraneless organelle	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

3762 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
PPP1R26	NAP1L5	Q96NT1	587
PPP1R26	GPR152	Q8TDT2	524
PPP1R26	PTRH1	Q86Y79	515
PPP1R26	NACC2	Q96BF6	511
PPP1R26	HINFP	Q9BQA5	497
PPP1R26	TOR2A	Q5JU69	493
PPP1R26	PDXDC1	Q6P996	491
PPP1R26	TMEM134	Q9H6X4	474
PPP1R26	TRIM27	P14373	467
PPP1R26	ASRGL1	Q7L266	462
PPP1R26	PPP1R13B	Q96KQ4	461
PPP1R26	PPP1R12B	O60237	458
PPP1R26	CABP4	P57796	457
PPP1R26	PPP1R27	Q86WC6	453
PPP1R26	STEEP1	Q9H5V9	433

IntAct

25 interactions, top by confidence:

A	B	Type	Score
UTP20	PPP1R26	psi-mi:“MI:0915”(physical association)	0.630
PPP1R26	UTP20	psi-mi:“MI:0915”(physical association)	0.630
PPP1CA	PPP1R26	psi-mi:“MI:0407”(direct interaction)	0.590
PPP1R26	PPP1CA	psi-mi:“MI:0915”(physical association)	0.590
PPP1R26	GOLGA2	psi-mi:“MI:0915”(physical association)	0.560
PPP1R26	TRAF2	psi-mi:“MI:0915”(physical association)	0.560
GOLGA2	PPP1R26	psi-mi:“MI:0915”(physical association)	0.560
TRAF2	PPP1R26	psi-mi:“MI:0915”(physical association)	0.560
PPP1R26	HOOK2	psi-mi:“MI:0915”(physical association)	0.560
PPP1R26	TRIB3	psi-mi:“MI:0915”(physical association)	0.560
PPP1R26	HNRNPM	psi-mi:“MI:0915”(physical association)	0.400
PPP1R26	H2AC4	psi-mi:“MI:0915”(physical association)	0.400
PPP1R26	HNRNPA1	psi-mi:“MI:0915”(physical association)	0.400
CELSR3	PPP1R26	psi-mi:“MI:0915”(physical association)	0.370
PPP1R26	HOOK2	psi-mi:“MI:0915”(physical association)	0.000
PPP1R26	TRIB3	psi-mi:“MI:0915”(physical association)	0.000
ypeB	PPP1R26	psi-mi:“MI:0915”(physical association)	0.000
PPP1R26		psi-mi:“MI:0915”(physical association)	0.000

BioGRID (28): PPP1R26 (Affinity Capture-RNA), PPP1R26 (Reconstituted Complex), RB1 (Affinity Capture-Western), RB1 (Biochemical Activity), PPP1R26 (Two-hybrid), PPP1R26 (Reconstituted Complex), PPP1R26 (Affinity Capture-Western), PPP1R26 (Affinity Capture-RNA), PPP1R26 (Two-hybrid), PPP1R26 (Two-hybrid), PPP1R26 (Proximity Label-MS), PPP1R26 (Proximity Label-MS), PPP1R26 (Proximity Label-MS), PPP1R26 (Affinity Capture-RNA), PPP1R26 (Affinity Capture-MS)

ESM2 similar proteins: A0A096LP49, A0A8V8TNH8, A0A8V8TPE2, A6NDY2, A6NIJ5, A6NJQ4, A6NKC0, A6NNH2, A6NNJ1, A8MUA0, A8MWA6, A8MX19, A8MXJ8, A8MXZ1, A8MYA2, B1ASB6, D6RGX4, P0C7V4, P0C7W8, P0C7W9, P0C7X0, P0DV73, P0DV74, P0DV75, P0DV76, Q0VDD7, Q2KIS6, Q3UHD3, Q4R736, Q5SZB4, Q5T8A7, Q5VZ46, Q5XIK6, Q658T7, Q6A025, Q6NTE8, Q6PIX9, Q6ZMY3, Q86Y26, Q86YD7

Diamond homologs: Q5T8A7, Q6A025, Q6NU19

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

249 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	216
Likely benign	31
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

719 predictions. Top by Δscore:

Variant	Effect	Δscore
9:135479188:C:T	donor_gain	0.9800
9:135479720:GTCCG:G	donor_gain	0.9700
9:135479726:T:G	donor_loss	0.9700
9:135479725:G:GG	donor_gain	0.9600
9:135482816:G:GG	donor_gain	0.9600
9:135480552:GG:G	donor_gain	0.9500
9:135480553:GG:G	donor_gain	0.9500
9:135483943:GTTCC:G	acceptor_loss	0.9400
9:135483944:TTCCA:T	acceptor_loss	0.9400
9:135483945:TCCA:T	acceptor_loss	0.9400
9:135483946:CCAG:C	acceptor_loss	0.9400
9:135483947:CAG:C	acceptor_loss	0.9400
9:135483948:A:C	acceptor_loss	0.9400
9:135480533:T:TA	donor_gain	0.9200
9:135482677:T:TA	acceptor_gain	0.9200
9:135483949:GGA:G	acceptor_gain	0.9200
9:135480549:CTAGG:C	donor_loss	0.9100
9:135480550:TAGG:T	donor_loss	0.9100
9:135480551:AGGG:A	donor_loss	0.9100
9:135480553:GGTGA:G	donor_loss	0.9100
9:135480554:GT:G	donor_loss	0.9100
9:135480555:T:A	donor_loss	0.9100
9:135480556:G:GG	donor_loss	0.9100
9:135488511:T:A	acceptor_gain	0.9100
9:135480557:AG:A	donor_loss	0.8900
9:135482356:C:G	donor_gain	0.8900
9:135480558:G:C	donor_loss	0.8800
9:135480952:AG:A	donor_gain	0.8800
9:135482826:G:GG	donor_gain	0.8800
9:135479721:TCCG:T	donor_gain	0.8700

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000192495 (9:135486904 A>C,G), RS1000318538 (9:135482932 GGGCTCACCTGTGTGTAGGTGGCCA>G), RS1000930688 (9:135481609 A>C,G), RS1001279384 (9:135481391 C>T), RS1001429291 (9:135481885 C>A,G,T), RS1002601987 (9:135482075 A>C,G,T), RS1002869387 (9:135478847 C>G), RS1002878278 (9:135484383 C>A,T), RS1002925386 (9:135478267 T>C), RS1003147674 (9:135483504 A>C,G), RS1003209633 (9:135479836 C>CGCGCGGGG), RS1003322946 (9:135477929 G>T), RS1003729195 (9:135483141 C>T), RS1003826696 (9:135479987 G>A), RS1004719597 (9:135480121 A>G)

Disease associations

OMIM: gene MIM:614056 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST009391_796	Metabolite levels	7.000000e-06

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0010395	sphingomyelin 22:0 measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

25 total (human), top 25 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Phenylmercuric Acetate	affects cotreatment, decreases expression	2
Valproic Acid	affects expression, increases expression, increases methylation	2
GSK-J4	decreases expression	1
dicrotophos	increases expression	1
bisphenol A	affects cotreatment, increases methylation	1
terbufos	decreases methylation	1
beta-lapachone	decreases expression	1
butyraldehyde	decreases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
abrine	decreases expression	1
dorsomorphin	decreases expression, affects cotreatment	1
jinfukang	increases expression	1
Sunitinib	increases expression	1
Arsenic Trioxide	decreases response to substance	1
Fulvestrant	affects cotreatment, increases methylation	1
Benzo(a)pyrene	decreases methylation	1
Fonofos	decreases methylation	1
Parathion	decreases methylation	1
Smoke	decreases expression	1
Cyclosporine	increases expression	1
Antirheumatic Agents	increases expression	1
Cadmium Chloride	decreases expression	1
Okadaic Acid	decreases expression	1
Copper Sulfate	decreases expression	1
Vitamin K 3	affects expression	1

Cellosaurus cell lines

2 cell lines: 2 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B2BW	Abcam HeLa PPP1R26 KO	Cancer cell line	Female
CVCL_TF76	HAP1 PPP1R26 (-)	Cancer cell line	Male

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.