PPP2R3B

Summary

PPP2R3B (protein phosphatase 2 regulatory subunit B’‘beta, HGNC:13417) is a protein-coding gene on chromosome Xp22.3 and Yp11.3, encoding Serine/threonine-protein phosphatase 2A regulatory subunit B’’ subunit beta (Q9Y5P8). The B regulatory subunit might modulate substrate selectivity and catalytic activity, and might also direct the localization of the catalytic enzyme to a particular subcellular compartment.

Protein phosphatase 2 (formerly named type 2A) is one of the four major Ser/Thr phosphatases and is implicated in the negative control of cell growth and division. Protein phosphatase 2 holoenzymes are heterotrimeric proteins composed of a structural subunit A, a catalytic subunit C, and a regulatory subunit B. The regulatory subunit is encoded by a diverse set of genes that have been grouped into the B/PR55, B’/PR61, and B’’/PR72 families. These different regulatory subunits confer distinct enzymatic specificities and intracellular localizations to the holozenzyme. The product of this gene belongs to the B’’ family. The B’’ family has been further divided into subfamilies. The product of this gene belongs to the beta subfamily of regulatory subunit B’’.

Source: NCBI Gene 28227 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 102 total
• MANE Select transcript: NM_013239

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:13417
Approved symbol	PPP2R3B
Name	protein phosphatase 2 regulatory subunit B’‘beta
Location	Xp22.3 and Yp11.3
Locus type	gene with protein product
Status	Approved
Aliases	PPP2R3LY, PR48, PR70
Ensembl gene	ENSG00000167393
Ensembl biotype	protein_coding
OMIM	300339
Entrez	28227

Gene structure

Transcript identifiers

Ensembl transcripts: 16 — 8 protein_coding, 8 retained_intron

ENST00000381625, ENST00000390665, ENST00000445792, ENST00000468169, ENST00000475859, ENST00000477110, ENST00000477636, ENST00000479438, ENST00000484364, ENST00000496630, ENST00000936620, ENST00000936621, ENST00000936622, ENST00000936623, ENST00000936624, ENST00000936625

RefSeq mRNA: 1 — MANE Select: NM_013239 NM_013239

CCDS: CCDS14104

Canonical transcript exons

ENST00000390665 — 13 exons

Exon	Start	End
ENSE00001844596	333933	334517
ENSE00001912068	386368	386907
ENSE00003489026	346701	346775
ENSE00003492683	347234	347336
ENSE00003501875	338604	338710
ENSE00003509428	347590	347693
ENSE00003511595	341883	341931
ENSE00003574906	346174	346260
ENSE00003587700	341307	341396
ENSE00003622978	338778	338896
ENSE00003653358	361405	361590
ENSE00003668507	340765	340940
ENSE00003687848	345516	345672

Expression profiles

Bgee: expression breadth ubiquitous, 134 present calls, max score 98.73.

FANTOM5 (CAGE): breadth broad, TPM avg 3.5737 / max 47.7928, expressed in 601 samples.

FANTOM5 promoters (3 alternative TSS)

Promoter ID	TPM avg	Samples expressed
198233	2.8725	590
198234	0.6965	398
198232	0.0048	1

Top tissues by expression

134 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
apex of heart	UBERON:0002098	98.73	gold quality
hindlimb stylopod muscle	UBERON:0004252	97.93	gold quality
heart left ventricle	UBERON:0002084	97.60	gold quality
right atrium auricular region	UBERON:0006631	97.49	gold quality
gastrocnemius	UBERON:0001388	97.34	gold quality
muscle of leg	UBERON:0001383	96.70	gold quality
sural nerve	UBERON:0015488	96.66	gold quality
skeletal muscle tissue	UBERON:0001134	96.50	gold quality
heart	UBERON:0000948	95.51	gold quality
right uterine tube	UBERON:0001302	95.16	gold quality
right testis	UBERON:0004534	93.60	gold quality
left testis	UBERON:0004533	93.42	gold quality
testis	UBERON:0000473	92.16	gold quality
stromal cell of endometrium	CL:0002255	92.04	gold quality
ventricular zone	UBERON:0003053	92.01	gold quality
skin of abdomen	UBERON:0001416	91.15	gold quality
tibial nerve	UBERON:0001323	91.12	gold quality
lower esophagus mucosa	UBERON:0035834	91.05	gold quality
muscle tissue	UBERON:0002385	91.02	gold quality
pituitary gland	UBERON:0000007	90.28	gold quality
zone of skin	UBERON:0000014	90.26	gold quality
hypothalamus	UBERON:0001898	90.05	gold quality
skin of leg	UBERON:0001511	89.87	gold quality
ganglionic eminence	UBERON:0004023	89.22	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	88.88	gold quality
adenohypophysis	UBERON:0002196	88.87	gold quality
temporal lobe	UBERON:0001871	88.70	gold quality
amygdala	UBERON:0001876	88.66	gold quality
substantia nigra	UBERON:0002038	87.81	gold quality
esophagus mucosa	UBERON:0002469	87.78	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

5 targeting PPP2R3B, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4262	100.00	73.26	3931
HSA-MIR-181C-5P	99.99	72.95	2996
HSA-MIR-3692-3P	99.98	70.27	2139
HSA-MIR-543	99.52	69.03	2595
HSA-MIR-553	94.01	65.93	158

Literature-anchored findings (GeneRIF, showing 2)

• Results show the crystal structure of PR48/PR70, at 2.0 A degrees resolution with two domain elongated structure and two Ca2+ binding EF-hands Scattering data. (PMID:25007185)
• PPP2R3B codes for the PR70 protein, a regulatory substrate-recognizing subunit of protein phosphatase 2A. PR70 decreased melanoma growth by negatively interfering with DNA replication and cell cycle progression through its role in stabilizing CDC6-chromatin licensing and CDT1 interaction (PMID:27974665)

Cross-species orthologs

0 orthologs

Paralogs (1): PPP2R3A (ENSG00000073711)

Protein

Protein identifiers

Serine/threonine-protein phosphatase 2A regulatory subunit B’’ subunit beta — Q9Y5P8 (reviewed: Q9Y5P8)

Alternative names: PP2A subunit B isoform PR48, Protein phosphatase 2A 48 kDa regulatory subunit

All UniProt accessions (2): C9JMU6, Q9Y5P8

UniProt curated annotations — full annotation on UniProt →

Function. The B regulatory subunit might modulate substrate selectivity and catalytic activity, and might also direct the localization of the catalytic enzyme to a particular subcellular compartment.

Subunit / interactions. PP2A consists of a common heterodimeric core enzyme, composed of a 36 kDa catalytic subunit (subunit C) and a 65 kDa constant regulatory subunit (PR65 or subunit A), that associates with a variety of regulatory subunits. Proteins that associate with the core dimer include three families of regulatory subunits B (the R2/B/PR55/B55, R3/B’’/PR72/PR130/PR59 and R5/B’/B56 families), the 48 kDa variable regulatory subunit, viral proteins, and cell signaling molecules. Interacts with N-terminal region of CDC6. Interacts with NOD2.

Subcellular location. Nucleus.

Miscellaneous. The gene coding for this protein is located in the pseudoautosomal region 1 (PAR1) of X and Y chromosomes.

Isoforms (2)

UniProt ID	Names	Canonical?
Q9Y5P8-1	1	yes
Q9Y5P8-2	2

RefSeq proteins (1): NP_037371* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR002048	EF_hand_dom	Domain
IPR011992	EF-hand-dom_pair	Homologous_superfamily
IPR018247	EF_Hand_1_Ca_BS	Binding_site
IPR041534	EF-hand_13	Domain
IPR048855	P2R3A_B_D_EF-hand	Domain

Pfam: PF13499, PF17958, PF21161

UniProt features (55 total): helix 29, strand 9, turn 7, binding site 4, sequence variant 2, chain 1, domain 1, region of interest 1, splice variant 1

Structure

Experimental structures (PDB)

3 structures.

PDB	Method	Resolution (Å)
4MEW	X-RAY DIFFRACTION	1.99
4I5L	X-RAY DIFFRACTION	2.43
4I5N	X-RAY DIFFRACTION	2.8

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9Y5P8-F1	80.96	0.64

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (4): 401; 403; 405; 412

Function

Pathways and Gene Ontology

Reactome pathways

3 pathways

ID	Pathway
R-HSA-113501	Inhibition of replication initiation of damaged DNA by RB1/E2F1
R-HSA-69231	Cyclin D associated events in G1
R-HSA-69273	Cyclin A/B1/B2 associated events during G2/M transition

MSigDB gene sets: 76 (showing top): REACTOME_INHIBITION_OF_REPLICATION_INITIATION_OF_DAMAGED_DNA_BY_RB1_E2F1, GOBP_REGULATION_OF_CELL_CYCLE, HELLER_HDAC_TARGETS_SILENCED_BY_METHYLATION_UP, GOBP_DEPHOSPHORYLATION, GOBP_PROTEIN_DEPHOSPHORYLATION, NUYTTEN_EZH2_TARGETS_DN, GOCC_PROTEIN_PHOSPHATASE_TYPE_2A_COMPLEX, GEORGES_TARGETS_OF_MIR192_AND_MIR215, GOMF_ENZYME_REGULATOR_ACTIVITY, GOMF_PHOSPHATASE_REGULATOR_ACTIVITY, chrXp22, chrYp11, CTIP_DN.V1_UP, PID_RB_1PATHWAY, KRAS.DF.V1_UP

GO Biological Process (2): protein dephosphorylation (GO:0006470), regulation of cell cycle (GO:0051726)

GO Molecular Function (4): calcium ion binding (GO:0005509), protein phosphatase regulator activity (GO:0019888), protein binding (GO:0005515), metal ion binding (GO:0046872)

GO Cellular Component (6): protein phosphatase type 2A complex (GO:0000159), nucleus (GO:0005634), nucleoplasm (GO:0005654), cytosol (GO:0005829), cilium (GO:0005929), ciliary tip (GO:0097542)

Reactome top-level categories

Rollup of top-3 pathways:

Category	Pathways
E2F mediated regulation of DNA replication	1
G1 Phase	1
G2/M Transition	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	3
dephosphorylation	1
protein modification process	1
cell cycle	1
regulation of cellular process	1
metal ion binding	1
phosphoprotein phosphatase activity	1
phosphatase regulator activity	1
protein phosphatase binding	1
binding	1
cation binding	1
protein serine/threonine phosphatase complex	1
intracellular membrane-bounded organelle	1
nuclear lumen	1
cytoplasm	1
intraciliary transport particle	1
membrane-bounded organelle	1
plasma membrane bounded cell projection	1
cilium	1

Protein interactions and networks

STRING

582 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
PPP2R3B	CDC6	Q99741	934
PPP2R3B	PPP2CA	P05323	796
PPP2R3B	PPP2R5A	Q15172	750
PPP2R3B	PPP2R2C	Q9Y2T4	719
PPP2R3B	PPP2R2D	Q66LE6	719
PPP2R3B	PLCXD1	Q9NUJ7	717
PPP2R3B	GTPBP6	O43824	698
PPP2R3B	MINK1	Q8N4C8	696
PPP2R3B	PPP2R2A	P50409	671
PPP2R3B	CCNB2	O95067	648
PPP2R3B	PPP2R5B	Q15173	644
PPP2R3B	PPP2R5C	Q13362	633
PPP2R3B	PPP2R5D	Q14738	625
PPP2R3B	PPP2R1A	P30153	614
PPP2R3B	STRN	O43815	605

IntAct

59 interactions, top by confidence:

A	B	Type	Score
PPP2R1A	STRN	psi-mi:“MI:0914”(association)	0.880
PPP2R1A	STRN	psi-mi:“MI:2364”(proximity)	0.880
PPP2CA	STRN	psi-mi:“MI:0914”(association)	0.840
PPP2CB	STRN	psi-mi:“MI:0914”(association)	0.790
PPP2CB	CEP43	psi-mi:“MI:0914”(association)	0.730
DUSP12	PPP2R3B	psi-mi:“MI:0915”(physical association)	0.670
PPP2R3B	DUSP12	psi-mi:“MI:0915”(physical association)	0.670
PPP2R1A	PPFIA3	psi-mi:“MI:0914”(association)	0.670
GPR156	PLD2	psi-mi:“MI:0914”(association)	0.640
HGS	PPP2R3B	psi-mi:“MI:0915”(physical association)	0.560
NAA10	PPP2R3B	psi-mi:“MI:0915”(physical association)	0.560
NOD2	PPP2R3B	psi-mi:“MI:0915”(physical association)	0.550
PPP2R3B	NOD2	psi-mi:“MI:0915”(physical association)	0.550
NOD2	PPP2R3B	psi-mi:“MI:2364”(proximity)	0.550
INAVA	DCTN6	psi-mi:“MI:0914”(association)	0.530
KRBA1	TRIM27	psi-mi:“MI:0914”(association)	0.530
PPP2R1A	ENSA	psi-mi:“MI:0914”(association)	0.530
PPP2R3B	INHA	psi-mi:“MI:0915”(physical association)	0.400
PPP2R3B	SHANK3	psi-mi:“MI:0915”(physical association)	0.370
PPP2R3B	N	psi-mi:“MI:0915”(physical association)	0.370
PPP2R3B	rep	psi-mi:“MI:0915”(physical association)	0.370
PPP2R3B	ORF10	psi-mi:“MI:0915”(physical association)	0.370

BioGRID (59): PPP2R3B (Two-hybrid), PPP2R3B (Affinity Capture-MS), PPP2R3B (Two-hybrid), TMEM14B (Two-hybrid), PPP2R3B (Affinity Capture-MS), PPP2R3B (Affinity Capture-MS), PPP2R3B (Affinity Capture-MS), PPP2R3B (Affinity Capture-MS), PPP2R3B (Two-hybrid), PPP2R3B (Affinity Capture-MS), PPP2R3B (Affinity Capture-MS), PPP2R3B (Affinity Capture-MS), PPP2R3B (Affinity Capture-MS), PPP2R3B (Affinity Capture-MS), PPP2R3B (Affinity Capture-MS)

ESM2 similar proteins: A0A3Q1LSX9, A2APV2, A4IHK8, A8K855, A9JRL3, D3Z8X7, O00418, O08796, O35099, O60308, P55265, P70531, Q13905, Q1LX49, Q28CB1, Q3SXY8, Q3UFM5, Q4V8B2, Q5E9V1, Q5QNQ6, Q5R6Y9, Q5R9G1, Q5RHX6, Q62172, Q62796, Q640N2, Q66JG9, Q6DD21, Q6DFA1, Q6ZPF4, Q7Z699, Q7ZYB4, Q80V31, Q80V94, Q8CI95, Q8IVF7, Q8IWE4, Q8K0Q5, Q8K0V2, Q8K4M9

Diamond homologs: Q06190, Q5QIT3, Q84JI6, Q8VZQ4, Q9SLI8, Q9XGR4, Q9Y5P8, Q9Z176

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 52 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Amplification of signal from unattached kinetochores via a MAD2 inhibitory signal	5	18.8×	8e-05
PI5P, PP2A and IER3 Regulate PI3K/AKT Signaling	5	15.6×	2e-04
EML4 and NUDC in mitotic spindle formation	5	15.0×	2e-04
Resolution of Sister Chromatid Cohesion	5	13.9×	3e-04
Mitotic Prometaphase	6	13.4×	6e-05
RHO GTPases Activate Formins	5	12.5×	4e-04
Separation of Sister Chromatids	5	9.8×	1e-03
Diseases of signal transduction by growth factor receptors and second messengers	5	9.2×	2e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

102 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	0
Likely benign	2
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

4010 predictions. Top by Δscore:

Variant	Effect	Δscore
X:338599:CT:C	donor_loss	1.0000
X:338602:AC:A	donor_gain	1.0000
X:338603:CC:C	donor_gain	1.0000
X:338776:AC:A	donor_gain	1.0000
X:338777:CC:C	donor_gain	1.0000
X:338822:T:TA	donor_gain	1.0000
X:340936:CGATG:C	acceptor_gain	1.0000
X:340939:TG:T	acceptor_gain	1.0000
X:340941:C:CC	acceptor_gain	1.0000
X:341410:C:CT	acceptor_gain	1.0000
X:341410:C:T	acceptor_gain	1.0000
X:341411:A:T	acceptor_gain	1.0000
X:345512:GCA:G	donor_loss	1.0000
X:345513:CACCG:C	donor_loss	1.0000
X:345514:A:AC	donor_gain	1.0000
X:345514:A:AT	donor_loss	1.0000
X:345515:C:A	donor_loss	1.0000
X:345515:C:CC	donor_gain	1.0000
X:345669:CATT:C	acceptor_gain	1.0000
X:345671:TT:T	acceptor_gain	1.0000
X:345673:C:CC	acceptor_gain	1.0000
X:346170:GCACC:G	donor_loss	1.0000
X:346171:CACC:C	donor_loss	1.0000
X:346173:C:CA	donor_loss	1.0000
X:347588:A:AC	donor_gain	1.0000
X:347589:C:CC	donor_gain	1.0000
X:347589:CTTT:C	donor_gain	1.0000
X:361401:GTAC:G	donor_loss	1.0000
X:361402:TACCT:T	donor_loss	1.0000
X:361403:A:AT	donor_loss	1.0000

AlphaMissense

7564 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
Y:345583:G:C	F323L	1.000
Y:345583:G:T	F323L	1.000
Y:345585:A:G	F323L	1.000
Y:345604:G:C	F316L	1.000
Y:345604:G:T	F316L	1.000
Y:345606:A:G	F316L	1.000
Y:346722:G:C	F257L	1.000
Y:346722:G:T	F257L	1.000
Y:346724:A:G	F257L	1.000
Y:338653:A:G	Y510H	0.999
Y:338675:C:A	W502C	0.999
Y:338675:C:G	W502C	0.999
Y:338677:A:G	W502R	0.999
Y:338677:A:T	W502R	0.999
Y:338875:A:G	L458P	0.999
Y:340878:A:G	L413P	0.999
Y:340878:A:T	L413H	0.999
Y:340893:A:T	L408Q	0.999
Y:340925:G:C	F397L	0.999
Y:340925:G:T	F397L	0.999
Y:340927:A:G	F397L	0.999
Y:340930:A:G	W396R	0.999
Y:340930:A:T	W396R	0.999
Y:340940:G:C	S392R	0.999
Y:340940:G:T	S392R	0.999
Y:341308:T:G	S392R	0.999
Y:341321:T:A	K387N	0.999
Y:341321:T:G	K387N	0.999
Y:341349:A:T	V378D	0.999
Y:345536:A:G	L339P	0.999

dbSNP variants (sampled 300 via entrez): RS1000047669 (X:351942 G>A), RS1000097625 (X:385431 G>C), RS1000185039 (X:370182 C>T), RS1000237194 (X:369966 C>T), RS1000253039 (X:364276 G>A), RS1000339453 (X:374055 C>A,T), RS1000353941 (X:338302 G>C), RS1000398796 (X:352198 A>G), RS1000425429 (X:342113 G>A,C,T), RS1000552783 (X:385159 T>C), RS1000580652 (X:335770 A>G), RS1000657753 (X:355422 A>T), RS1000658398 (X:388149 G>A), RS1000666010 (X:333870 G>A), RS1000674036 (X:338552 CACCCGTCCTCCCACTG>C,CACCCGTCCTCCCACTGACCCGTCCTCCCACTG)

Disease associations

OMIM: gene MIM:300339 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

19 total (human), top 19 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
triphenyl phosphate	affects expression	1
bisphenol A	decreases expression	1
sodium arsenite	decreases expression	1
nickel sulfate	increases expression	1
cyfluthrin	increases expression	1
CGP 52608	affects binding, increases reaction	1
incobotulinumtoxinA	decreases expression	1
Acetaminophen	increases expression	1
Air Pollutants	affects expression, increases abundance	1
Calcitriol	decreases expression, affects cotreatment	1
Diuron	decreases expression	1
Chlorpyrifos	increases expression	1
Ozone	affects expression, increases abundance	1
Smoke	decreases expression	1
Testosterone	affects cotreatment, decreases expression	1
Tobacco Smoke Pollution	decreases expression	1
Valproic Acid	increases methylation	1
Monocrotaline	decreases expression, increases metabolic processing	1
Copper Sulfate	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.