PPP5C

Summary

PPP5C (protein phosphatase 5 catalytic subunit, HGNC:9322) is a protein-coding gene on chromosome 19q13.32, encoding Serine/threonine-protein phosphatase 5 (P53041). Serine/threonine-protein phosphatase that dephosphorylates a myriad of proteins involved in different signaling pathways including the kinases CSNK1E, ASK1/MAP3K5, PRKDC and RAF1, the nuclear receptors NR3C1, PPARG, ESR1 and ESR2, SMAD proteins and TAU/MAPT.

This gene encodes a serine/threonine phosphatase which is a member of the protein phosphatase catalytic subunit family. Proteins in this family participate in pathways regulated by reversible phosphorylation at serine and threonine residues; many of these pathways are involved in the regulation of cell growth and differentiation. The product of this gene has been shown to participate in signaling pathways in response to hormones or cellular stress, and elevated levels of this protein may be associated with breast cancer development. Alternative splicing results in multiple transcript variants.

Source: NCBI Gene 5536 — RefSeq curated summary.

At a glance

• Gene–disease (curated): neurodevelopmental disorder (Moderate, GenCC)
• GWAS associations: 10
• Clinical variants (ClinVar): 66 total
• Druggable target: yes — 2 molecules with ChEMBL bioactivity
• MANE Select transcript: NM_006247

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:9322
Approved symbol	PPP5C
Name	protein phosphatase 5 catalytic subunit
Location	19q13.32
Locus type	gene with protein product
Status	Approved
Aliases	PP5
Ensembl gene	ENSG00000011485
Ensembl biotype	protein_coding
OMIM	600658
Entrez	5536

Gene structure

Transcript identifiers

Ensembl transcripts: 22 — 12 retained_intron, 9 protein_coding, 1 nonsense_mediated_decay

ENST00000012443, ENST00000391919, ENST00000467502, ENST00000467902, ENST00000478046, ENST00000486994, ENST00000487483, ENST00000491003, ENST00000492109, ENST00000493347, ENST00000525507, ENST00000527193, ENST00000527623, ENST00000532058, ENST00000595055, ENST00000886856, ENST00000886857, ENST00000923869, ENST00000923870, ENST00000923871, ENST00000923872, ENST00000949880

RefSeq mRNA: 2 — MANE Select: NM_006247 NM_001204284, NM_006247

CCDS: CCDS12684

Canonical transcript exons

ENST00000012443 — 13 exons

Exon	Start	End
ENSE00001134741	46347087	46347217
ENSE00001235477	46383411	46383476
ENSE00003507150	46387366	46387453
ENSE00003513903	46375604	46375751
ENSE00003540801	46384804	46384909
ENSE00003542909	46388408	46388448
ENSE00003561435	46387093	46387235
ENSE00003613331	46383780	46383878
ENSE00003620203	46376453	46376574
ENSE00003624099	46390051	46390132
ENSE00003653575	46353748	46353989
ENSE00003683290	46388553	46388731
ENSE00003895183	46390284	46390975

Expression profiles

Bgee: expression breadth ubiquitous, 205 present calls, max score 96.24.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 53.5613 / max 270.0729, expressed in 1815 samples.

FANTOM5 promoters (4 alternative TSS)

Promoter ID	TPM avg	Samples expressed
176552	44.5418	1808
176549	6.2927	1668
176551	1.3839	1020
176550	1.3429	978

Top tissues by expression

280 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
cortical plate	UBERON:0005343	96.24	gold quality
right uterine tube	UBERON:0001302	96.06	gold quality
ganglionic eminence	UBERON:0004023	96.05	gold quality
adenohypophysis	UBERON:0002196	95.63	gold quality
ventricular zone	UBERON:0003053	95.51	gold quality
right hemisphere of cerebellum	UBERON:0014890	95.49	gold quality
apex of heart	UBERON:0002098	95.27	gold quality
stromal cell of endometrium	CL:0002255	95.23	gold quality
cerebellar hemisphere	UBERON:0002245	95.17	gold quality
right atrium auricular region	UBERON:0006631	95.15	gold quality
cerebellar cortex	UBERON:0002129	95.06	gold quality
right frontal lobe	UBERON:0002810	95.03	gold quality
right adrenal gland	UBERON:0001233	94.97	gold quality
body of uterus	UBERON:0009853	94.93	gold quality
metanephros cortex	UBERON:0010533	94.90	gold quality
right adrenal gland cortex	UBERON:0035827	94.86	gold quality
left adrenal gland	UBERON:0001234	94.81	gold quality
left adrenal gland cortex	UBERON:0035825	94.66	gold quality
mucosa of stomach	UBERON:0001199	94.60	gold quality
right lobe of thyroid gland	UBERON:0001119	94.58	gold quality
body of stomach	UBERON:0001161	94.55	gold quality
right ovary	UBERON:0002118	94.52	gold quality
hindlimb stylopod muscle	UBERON:0004252	94.52	gold quality
descending thoracic aorta	UBERON:0002345	94.43	gold quality
transverse colon	UBERON:0001157	94.30	gold quality
tibial nerve	UBERON:0001323	94.17	gold quality
popliteal artery	UBERON:0002250	94.15	gold quality
tibial artery	UBERON:0007610	94.15	gold quality
left lobe of thyroid gland	UBERON:0001120	94.07	gold quality
prefrontal cortex	UBERON:0000451	94.02	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	7.69
E-MTAB-10137	no	183.41

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): HIF1A

miRNA regulators (miRDB)

52 targeting PPP5C, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4481	100.00	66.42	1669
HSA-MIR-520D-5P	99.98	73.34	4883
HSA-MIR-524-5P	99.98	73.43	4882
HSA-MIR-4745-5P	99.98	65.95	1028
HSA-MIR-302C-5P	99.97	72.56	3642
HSA-MIR-6825-5P	99.96	69.81	3431
HSA-MIR-548AB	99.95	71.31	3488
HSA-MIR-559	99.95	72.28	3609
HSA-MIR-548A-5P	99.94	71.27	3482
HSA-MIR-548AD-5P	99.94	71.23	3502
HSA-MIR-548AE-5P	99.94	71.23	3502
HSA-MIR-548AK	99.94	71.24	3488
HSA-MIR-548AM-5P	99.94	71.24	3488
HSA-MIR-548AP-5P	99.94	71.14	3489
HSA-MIR-548AQ-5P	99.94	71.34	3426
HSA-MIR-548AR-5P	99.94	71.28	3515
HSA-MIR-548AS-5P	99.94	71.22	3482
HSA-MIR-548AU-5P	99.94	71.24	3488
HSA-MIR-548AY-5P	99.94	71.23	3502
HSA-MIR-548B-5P	99.94	71.23	3502
HSA-MIR-548BB-5P	99.94	71.27	3509
HSA-MIR-548C-5P	99.94	71.24	3488
HSA-MIR-548D-5P	99.94	71.23	3502
HSA-MIR-548H-5P	99.94	71.24	3488
HSA-MIR-548I	99.94	71.25	3481
HSA-MIR-548J-5P	99.94	71.14	3489
HSA-MIR-548O-5P	99.94	71.24	3488
HSA-MIR-548W	99.94	71.24	3488
HSA-MIR-548Y	99.94	71.28	3514
HSA-MIR-3143	99.93	71.96	3104

Literature-anchored findings (GeneRIF, showing 37)

• PP5 suppresses a pathway regulating the expression of p21(waf1) (PMID:12519780)
• protein phosphatase 5 interacts with DNA-PKcs and dephosphorylates with surprising specificity at least two functional sites. (PMID:14734805)
• structure of Serine/threonine protein phosphatase-5(PP5c) provides a structural basis for explaining the exceptional catalytic proficiency of protein phosphatases. (PMID:15155720)
• PP5 is regulated by mTOR and activates apoptosis signal-regulating kinase 1 signaling (PMID:15218033)
• PP5 plays an important role in the survival of cells in a low oxygen environment by suppressing a hypoxia-induced ASK-1/MKK4/JNK signaling cascade that promotes an apoptotic response (PMID:15328343)
• Results describe the structure of the autoinhibited state of protein phosphatase 5, revealing mechanisms of tetratricopeptide repeat-mediated phosphatase inhibition and Hsp90- and arachidonic acid-induced stimulation of phosphatase activity. (PMID:15577939)
• PP5 plays a critical role in ATR-mediated checkpoint activation (PMID:16260606)
• We report the solution structure of a complex of the TPR domain of Ppp5 with the C-terminal pentapeptide of Hsp90.This may be important for the relief of autoinhibition in Ppp5 and for the mechanisms of TPR-mediated recognition of Hsp90 by other proteins. (PMID:16531226)
• PP5, casein kinase Iepsilon, and cryptochrome dynamically regulate the mammalian circadian clock (PMID:16790549)
• PP5 is a physiological regulator of Raf-1 signalling pathways. (PMID:16892053)
• Protein phosphatase 5 as a key dephosphorylation regulator of Raf-1 activation. (PMID:17084641)
• these studies indicate that elevated levels of PP5 protein occur in human breast cancer and suggest that PP5 over-expression may aid tumor progression. (PMID:18280813)
• domain amphiphilicity is of higher importance than amino acid sequence specificity in the determination of protein adsorption and interfacial activity. (PMID:18547097)
• PP5 plays an important role in the regulation of 53BP1 phosphorylation and activity in vivo (PMID:19176521)
• Estrogen inhibits glucocorticoid action via protein phosphatase 5 (PP5)-mediated glucocorticoid receptor dephosphorylation. (PMID:19586900)
• Specific binding of PP5 to activated Rac1 provides a direct mechanism by which PP5 can be stimulated and recruited to participate in Rac1-mediated signaling pathways. (PMID:19948726)
• Findings are indicative of a regulatory role of PP5 in cardiac function. (PMID:20875921)
• PP5 plays a crucial role in ATR-mediated repair of UV-induced DNA damage. (PMID:21144835)
• genetic disruption of PP5 is associated with enhanced and prolonged phosphorylation of a single serine (Ser-345) on Chk1 (PMID:21921034)
• S100A1 and permanently active S100P inhibited the apoptosis signal-regulating kinase 1 (ASK1) and PP5 interaction, resulting the inhibition of dephosphorylation of phospho-ASK1 by PP5 (PMID:22399290)
• proasthmatic cytokine-induced corticosteroid insensitivity in airway smooth muscle cells is due, in part, to PP5-mediated impairment of glucocorticoid receptor-Ser211 phosphorylation. (PMID:22592921)
• Suggest that Slim/KLHDC10 is an activator of ASK1, contributing to oxidative stress-induced cell death through the suppression of PP5. (PMID:23102700)
• Chp-1 and melusin can interact with cochaperones PP5 and Sgt1 and with each other in an ATP-dependent manner (PMID:23184943)
• these results suggest that caveolin-1 is a novel physiological activator of PP5. (PMID:23352616)
• These results demonstrate that Hsp70 recruits PP5 and activates its phosphatase activity which suggests dual roles for PP5 that might link chaperone systems with signaling pathways in cancer and development. (PMID:24327656)
• Data indicate that Cu-oxidized S100 calcium binding protein A4 (S100A4) interacted with S100 calcium binding protein A1 (S100A1) and prevented protein phosphatase 5 (PP5) activation. (PMID:25269953)
• We demonstrate for the first time that PPP5C is essential for growth of HCC cells, which suggests that inhibition of PPP5C by RNAi may be a potential therapeutic strategy for the treatment of hepatocellular carcinoma. (PMID:25326185)
• PPP5C could be essential for glioma cell growth. (PMID:25796168)
• Measles Virus Infection Inactivates Cellular Protein Phosphatase 5 with Consequent Suppression of Sp1 and c-Myc Activities. (PMID:26157124)
• PP5-dependent impairment of GRalpha function represents a novel mechanism driving GC insensitivity in ASM in severe asthma. (PMID:27501780)
• Our results showed 1) a critical role for PP5 in cytokine-induced resistance to GC-mediated eosinophil death, 2) supported the dependence of GCR phosphorylation on PP5 activity, and 3) revealed that PP5 is a target of the lipoxin A4-induced pathway countering cytokine-induced resistance to GCs in eosinophils. (PMID:27742828)
• High PPP5C expression is associated with urinary bladder cancer. (PMID:28534961)
• PP5 binds and dephosphorylates the elastic N2B-unique sequence (N2Bus) of titin in cardiomyocytes. PP5 is pathologically elevated and likely contributes to hypo-phosphorylation of N2Bus in failing human hearts. Furthermore, Hsp90-activated PP5 interacts with components of a sarcomeric, N2Bus-associated, mechanosensor complex, and blocks mitogen-activated protein-kinase signaling in this complex. (PMID:29343782)
• This work offers insights of how cantharidin-like inhibitors interact with human PP5, potentially allowing the design of more specific and even less cytotoxic drugs for cancer treatments. (PMID:30280322)
• These data demonstrate that LB-100 is a catalytic inhibitor of both PP2AC and PPP5C and suggest that the observed antitumor activity might be due to an additive effect achieved by suppressing both PP2A and PPP5C. (PMID:30679389)
• The role of the catalytic Mn(2+) ions in regulating the binding of PP5 with its substrate was investigated through MD simulations. Results reveal that the different states of Mn(2+) ions can alter the structure of the active site and the conformations of the residues coordinating the Mn(2+) ions or the substrate. (PMID:30826056)
• Over-expression of human PP5 gene in mice induces corneal hyperplasia and leads to ocular surface squamous neoplasia. (PMID:32703456)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	ppp5c	ENSDARG00000034313
mus_musculus	Ppp5c	ENSMUSG00000003099
rattus_norvegicus	Ppp5c	ENSRNOG00000016907
drosophila_melanogaster	PpD3	FBGN0005777
caenorhabditis_elegans		WBGENE00012665

Paralogs (12): PPEF1 (ENSG00000086717), PPP2CB (ENSG00000104695), PPP3CB (ENSG00000107758), PPP2CA (ENSG00000113575), PPP6C (ENSG00000119414), PPP3CC (ENSG00000120910), PPP3CA (ENSG00000138814), PPP4C (ENSG00000149923), PPEF2 (ENSG00000156194), PPP1CA (ENSG00000172531), PPP1CC (ENSG00000186298), PPP1CB (ENSG00000213639)

Protein

Protein identifiers

Serine/threonine-protein phosphatase 5 — P53041 (reviewed: P53041)

Alternative names: Protein phosphatase T

All UniProt accessions (3): P53041, A8MU39, H0YDU8

UniProt curated annotations — full annotation on UniProt →

Function. Serine/threonine-protein phosphatase that dephosphorylates a myriad of proteins involved in different signaling pathways including the kinases CSNK1E, ASK1/MAP3K5, PRKDC and RAF1, the nuclear receptors NR3C1, PPARG, ESR1 and ESR2, SMAD proteins and TAU/MAPT. Implicated in wide ranging cellular processes, including apoptosis, differentiation, DNA damage response, cell survival, regulation of ion channels or circadian rhythms, in response to steroid and thyroid hormones, calcium, fatty acids, TGF-beta as well as oxidative and genotoxic stresses. Participates in the control of DNA damage response mechanisms such as checkpoint activation and DNA damage repair through, for instance, the regulation ATM/ATR-signaling and dephosphorylation of PRKDC and TP53BP1. Inhibits ASK1/MAP3K5-mediated apoptosis induced by oxidative stress. Plays a positive role in adipogenesis, mainly through the dephosphorylation and activation of PPARG transactivation function. Also dephosphorylates and inhibits the anti-adipogenic effect of NR3C1. Regulates the circadian rhythms, through the dephosphorylation and activation of CSNK1E. May modulate TGF-beta signaling pathway by the regulation of SMAD3 phosphorylation and protein expression levels. Dephosphorylates and may play a role in the regulation of TAU/MAPT. Through their dephosphorylation, may play a role in the regulation of ions channels such as KCNH2. Dephosphorylate FNIP1, disrupting interaction with HSP90AA1/Hsp90.

Subunit / interactions. Probably forms a complex composed of chaperones HSP90 and HSP70, co-chaperones STIP1/HOP, CDC37, PPP5C, PTGES3/p23, TSC1 and client protein TSC2. Probably forms a complex composed of chaperones HSP90 and HSP70, co-chaperones CDC37, PPP5C, TSC1 and client protein TSC2, CDK4, AKT, RAF1 and NR3C1; this complex does not contain co-chaperones STIP1/HOP and PTGES3/p23. Part of a complex with HSP90/HSP90AA1 and steroid receptors. Interacts (via TPR repeats) with HSP90AA1 (via TPR repeat-binding motif) or HSPA1A/HSPA1B; the interaction is direct and activates the phosphatase activity. Dissociates from HSPA1A/HSPA1B and HSP90AA1 in response to arachidonic acid. Interacts with CPNE1 (via VWFA domain). Interacts with CDC16, CDC27. Interacts with KLHDC10 (via the 6 Kelch repeats); inhibits the phosphatase activity on MAP3K5. Interacts with ATM and ATR; both interactions are induced by DNA damage and enhance ATM and ATR kinase activity. Interacts with RAD17; reduced by DNA damage. Interacts with nuclear receptors such as NR3C1/GCR and PPARG (activated by agonist); regulates their transactivation activities. Interacts (via TPR repeats) with S100 proteins S100A1, S100A2, S100A6, S100B and S100P; the interactions are calcium-dependent, strongly activate PPP5C phosphatase activity and compete with HSP90AA1 and MAP3K5 interactions. Interacts with SMAD2 and SMAD3 but not with SMAD1; decreases SMAD3 phosphorylation and protein levels. Interacts (via TPR repeats) with CRY1 and CRY2; the interaction with CRY2 down-regulates the phosphatase activity on CSNK1E. Interacts (via TPR repeats) with the active form of RAC1, GNA12 or GNA13; these interactions activate the phosphatase activity and translocate PPP5C to the cell membrane. Interacts with FLCN.

Subcellular location. Nucleus. Cytoplasm. Cell membrane.

Tissue specificity. Ubiquitous.

Post-translational modifications. Activated by at least two different proteolytic cleavages producing a 56 kDa and a 50 kDa form.

Activity regulation. Autoinhibited. In the autoinhibited state, the TPR domain interacts with the catalytic region and prevents substrate access to the catalytic pocket. Allosterically activated by various polyunsaturated fatty acids, free long-chain fatty-acids and long-chain fatty acyl-CoA esters, arachidonic acid being the most effective activator. HSP90A and probably RAC1, GNA12 and GNA13 can also release the autoinhibition by the TPR repeat. Activation by RAC1, GNA12 and GNA13 is synergistic with the one produced by fatty acids binding. Inhibited by okadaic acid.

Cofactor. Binds 2 Mg(2+) or Mn(2+) cations per subunit.

Similarity. Belongs to the PPP phosphatase family. PP-5 (PP-T) subfamily.

RefSeq proteins (2): NP_001191213, NP_006238* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR004843	Calcineurin-like_PHP	Domain
IPR006186	Ser/Thr-sp_prot-phosphatase	Domain
IPR011990	TPR-like_helical_dom_sf	Homologous_superfamily
IPR013235	PPP_dom	Domain
IPR019734	TPR_rpt	Repeat
IPR029052	Metallo-depent_PP-like	Homologous_superfamily
IPR041753	PP5_C	Domain
IPR051134	PPP_phosphatase	Family

Pfam: PF00149, PF00515, PF08321

Enzyme classification (BRENDA):

• EC 3.1.3.16 — protein-serine/threonine phosphatase (BRENDA: 92 organisms, 641 substrates, 468 inhibitors, 127 Km, 67 kcat entries)

Substrate kinetics (BRENDA)

59 substrates with measured Km, best-characterized 15. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
6,8-DIFLUORO-4-METHYLUMBELLIFERYL PHOSPHATE	0.023–0.862	22
4-NITROPHENYL PHOSPHATE	0.0028–12.7	13
P-NITROPHENYL PHOSPHATE	3–200	11
RRAPTVA	0.058–1.954	4
PHOSPHOCASEIN	0.0001–0.002	3
PHOSPHOHISTONE	0.0023–0.0723	3
PHOSPHORYLATED MYOSIN LIGHT CHAIN PEPTIDE	0.01–0.11	3
PHOSPHOSERINE-MYELIN BASIC PROTEIN	0.0004–0.022	3
DLDVPIPGRFDRRVSVAAE	0.0006–0.0138	2
DLDVPIPGRFDRRVY(P)VAAE	0.0025–0.023	2
PHOSPHORYLASE A	0.004–0.021	2
RRA(PT)VA	0.0536–0.308	2
80S-RIBOSOME	0.0027	1
AAAPTVA	0.206	1
AGPALSPVPPV	0.357	1

Catalyzed reactions (Rhea), 2 shown:

• O-phospho-L-seryl-[protein] + H2O = L-seryl-[protein] + phosphate (RHEA:20629)
• O-phospho-L-threonyl-[protein] + H2O = L-threonyl-[protein] + phosphate (RHEA:47004)

UniProt features (74 total): strand 21, helix 20, binding site 12, mutagenesis site 7, repeat 3, turn 3, region of interest 3, initiator methionine 1, chain 1, modified residue 1, sequence conflict 1, active site 1

Structure

Experimental structures (PDB)

22 structures.

PDB	Method	Resolution (Å)
4ZX2	X-RAY DIFFRACTION	1.23
3H63	X-RAY DIFFRACTION	1.3
3H62	X-RAY DIFFRACTION	1.4
3H61	X-RAY DIFFRACTION	1.45
3H68	X-RAY DIFFRACTION	1.5
1S95	X-RAY DIFFRACTION	1.6
3H67	X-RAY DIFFRACTION	1.65
5WG8	X-RAY DIFFRACTION	1.65
3H64	X-RAY DIFFRACTION	1.9
5UI1	X-RAY DIFFRACTION	1.96
3H60	X-RAY DIFFRACTION	2
4ZVZ	X-RAY DIFFRACTION	2
3H69	X-RAY DIFFRACTION	2.1
5HPE	X-RAY DIFFRACTION	2.27
1A17	X-RAY DIFFRACTION	2.45
3H66	X-RAY DIFFRACTION	2.59
1WAO	X-RAY DIFFRACTION	2.9
8GAE	ELECTRON MICROSCOPY	3.3
8GFT	ELECTRON MICROSCOPY	3.8
7ZR5	ELECTRON MICROSCOPY	3.9
7ZR6	ELECTRON MICROSCOPY	4.2
2BUG	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P53041-F1	93.00	0.84

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1): 304 (proton donor/acceptor)

Ligand- & substrate-binding residues (12): 244; 244; 271; 271; 275; 303–304; 303; 352; 400; 427; 427; 242

Post-translational modifications (1): 2

Mutagenesis-validated functional residues (7):

Position	Phenotype
32	loss of interaction with hsp90aa1. no effect on interaction with s100a1, s100a2 and s100a6.
74	loss of interaction with hsp90aa1. no effect on interaction with s100a1, s100a2 and s100a6.
83	no effect on interaction with hsp90aa1.
93	decreases interaction with rac1 and translocation to the membrane in presence of active rac1.
97	loss of interaction with hsp90aa1. no effect on interaction with s100a1, s100a2 and s100a6. loss of interaction with raf
101	loss of interaction with hsp90aa1. no effect on interaction with s100a1, s100a2 and s100a6.
304	catalytically inactive; no effect on interaction with cry2 but increases the stability of the interaction with csnk1e. n

Function

Pathways and Gene Ontology

Reactome pathways

3 pathways

ID	Pathway
R-HSA-5675221	Negative regulation of MAPK pathway
R-HSA-5693565	Recruitment and ATM-mediated phosphorylation of repair and signaling proteins at DNA double strand breaks
R-HSA-8939211	ESR-mediated signaling

MSigDB gene sets: 264 (showing top): GSE45365_CD8A_DC_VS_CD11B_DC_IFNAR_KO_MCMV_INFECTION_UP, GSE45365_NK_CELL_VS_CD8_TCELL_DN, GOBP_RESPONSE_TO_NITROGEN_COMPOUND, AAGCAAT_MIR137, MORF_MSH3, GOBP_CELLULAR_RESPONSE_TO_LIPID, KEGG_MAPK_SIGNALING_PATHWAY, MODULE_45, MORF_BRCA1, GOBP_CELLULAR_RESPONSE_TO_CADMIUM_ION, GOBP_CANONICAL_NF_KAPPAB_SIGNAL_TRANSDUCTION, MORF_ATRX, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_UP, GRAESSMANN_RESPONSE_TO_MC_AND_DOXORUBICIN_UP, GOBP_POSITIVE_REGULATION_OF_INTRACELLULAR_STEROID_HORMONE_RECEPTOR_SIGNALING_PATHWAY

GO Biological Process (16): MAPK cascade (GO:0000165), mitotic cell cycle (GO:0000278), double-strand break repair (GO:0006302), DNA-templated transcription (GO:0006351), response to lead ion (GO:0010288), negative regulation of apoptotic process (GO:0043066), positive regulation of canonical NF-kappaB signal transduction (GO:0043123), response to morphine (GO:0043278), negative regulation of MAPK cascade (GO:0043409), peptidyl-serine dephosphorylation (GO:0070262), cellular response to hydrogen peroxide (GO:0070301), cellular response to cadmium ion (GO:0071276), response to arachidonate (GO:1904550), positive regulation of nuclear receptor-mediated glucocorticoid signaling pathway (GO:2000324), DNA repair (GO:0006281), DNA damage response (GO:0006974)

GO Molecular Function (20): G-protein alpha-subunit binding (GO:0001965), RNA binding (GO:0003723), phosphoprotein phosphatase activity (GO:0004721), protein serine/threonine phosphatase activity (GO:0004722), ATP binding (GO:0005524), microtubule binding (GO:0008017), lipid binding (GO:0008289), phosphatase activity (GO:0016791), protein serine/threonine kinase inhibitor activity (GO:0030291), Hsp70 protein binding (GO:0030544), mitogen-activated protein kinase kinase kinase binding (GO:0031435), identical protein binding (GO:0042802), ADP binding (GO:0043531), protein-containing complex binding (GO:0044877), metal ion binding (GO:0046872), tau protein binding (GO:0048156), Hsp90 protein binding (GO:0051879), protein binding (GO:0005515), hydrolase activity (GO:0016787), heat shock protein binding (GO:0031072)

GO Cellular Component (11): nucleus (GO:0005634), nucleoplasm (GO:0005654), cytosol (GO:0005829), plasma membrane (GO:0005886), protein-containing complex (GO:0032991), perikaryon (GO:0043204), protein folding chaperone complex (GO:0101031), proximal dendrite (GO:1990635), cytoplasm (GO:0005737), membrane (GO:0016020), neuronal cell body (GO:0043025)

Reactome top-level categories

Rollup of top-3 pathways:

Category	Pathways
RAF/MAP kinase cascade	1
DNA Double Strand Break Response	1
Signaling by Nuclear Receptors	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	5
protein binding	3
binding	3
adenyl ribonucleotide binding	2
heat shock protein binding	2
intracellular signaling cassette	1
cell cycle	1
mitotic nuclear division	1
DNA repair	1
gene expression	1
RNA biosynthetic process	1
response to metal ion	1
apoptotic process	1
regulation of apoptotic process	1
negative regulation of programmed cell death	1
canonical NF-kappaB signal transduction	1
regulation of canonical NF-kappaB signal transduction	1
positive regulation of intracellular signal transduction	1
response to isoquinoline alkaloid	1
MAPK cascade	1
regulation of MAPK cascade	1
negative regulation of intracellular signal transduction	1
protein dephosphorylation	1
cellular response to reactive oxygen species	1
response to hydrogen peroxide	1
response to cadmium ion	1
cellular response to metal ion	1
response to fatty acid	1
positive regulation of intracellular steroid hormone receptor signaling pathway	1
nuclear receptor-mediated glucocorticoid signaling pathway	1
regulation of nuclear receptor-mediated glucocorticoid signaling pathway	1
DNA metabolic process	1
DNA damage response	1
cellular response to stress	1
nucleic acid binding	1
phosphatase activity	1
catalytic activity, acting on a protein	1
phosphoprotein phosphatase activity	1
purine ribonucleoside triphosphate binding	1
tubulin binding	1

Protein interactions and networks

STRING

2408 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
PPP5C	HSP90AA1	P07900	928
PPP5C	HSP90AB1	P08238	901
PPP5C	CDC37	Q16543	824
PPP5C	PPM1L	Q5SGD2	706
PPP5C	HSPA4	P34932	695
PPP5C	MAP3K5	Q99683	596
PPP5C	PPT1	P50897	560
PPP5C	MAP2K6	P52564	547
PPP5C	PPM1G	O15355	546
PPP5C	DNAJB1	P25685	525
PPP5C	PPM1B	O75688	518
PPP5C	MAP3K7	O43318	498
PPP5C	AHSA1	O95433	487
PPP5C	DUSP3	P51452	481
PPP5C	MAP2K3	P46734	470
PPP5C	CDK3	Q00526	470

IntAct

135 interactions, top by confidence:

A	B	Type	Score
ATG13	ULK1	psi-mi:“MI:2364”(proximity)	0.940
PPP5C	HSP90AB1	psi-mi:“MI:0407”(direct interaction)	0.900
PIK3R1	PIK3CD	psi-mi:“MI:0914”(association)	0.890
PPP5C	HSP90AA1	psi-mi:“MI:0914”(association)	0.870
HSP90AA1	PPP5C	psi-mi:“MI:0915”(physical association)	0.870
ANAPC5	CDC27	psi-mi:“MI:0914”(association)	0.810
CDC37	PPP5C	psi-mi:“MI:0915”(physical association)	0.710
HSP90AA1	CHUK	psi-mi:“MI:0914”(association)	0.670
CRY2	CSNK1E	psi-mi:“MI:0914”(association)	0.640
CD27	TCAF2	psi-mi:“MI:0914”(association)	0.640
IRS4	PIK3R2	psi-mi:“MI:0914”(association)	0.640
PPP5C	ESR1	psi-mi:“MI:0915”(physical association)	0.630
ESR1	PPP5C	psi-mi:“MI:0915”(physical association)	0.630
PPP5C	STIP1	psi-mi:“MI:0915”(physical association)	0.620
PPP5C	AGO1	psi-mi:“MI:0915”(physical association)	0.620
PPP5C	IRS4	psi-mi:“MI:0914”(association)	0.570
PPP5C	IRS4	psi-mi:“MI:2364”(proximity)	0.570
PHLPP1	USP12	psi-mi:“MI:0914”(association)	0.570
EGFR	PPP5C	psi-mi:“MI:0915”(physical association)	0.550
PPP5C	EGFR	psi-mi:“MI:0915”(physical association)	0.550
PPP5C	CDK9	psi-mi:“MI:0915”(physical association)	0.540
KSR2	POLR3A	psi-mi:“MI:0914”(association)	0.530

BioGRID (289): PPP5C (Affinity Capture-RNA), PPP5C (Affinity Capture-RNA), PPP5C (Affinity Capture-RNA), PPP5C (Affinity Capture-RNA), PPP5C (Affinity Capture-MS), DUT (Co-fractionation), MINPP1 (Co-fractionation), PPP5C (Co-fractionation), PPP5C (Co-fractionation), TATDN1 (Co-fractionation), PPP5C (Affinity Capture-MS), HSP90AA1 (Affinity Capture-MS), HSP90AB1 (Affinity Capture-MS), PSEN2 (Affinity Capture-MS), RBBP6 (Affinity Capture-MS)

ESM2 similar proteins: A1Z6E0, A2BHJ4, A8IU92, B0X9V1, B3MDR0, B3NRP1, B4F739, B4GBN7, B4HQ29, B4J6Q0, B4KNC5, B4LMQ3, B4MR59, B4P4K8, B4QE02, P00860, P0C2W1, P0CH38, P11926, P27117, P27119, P27120, P48455, P53041, P53042, Q0G819, Q16XV7, Q290L5, Q5BJ41, Q5E9X6, Q5VST6, Q5XH73, Q60676, Q68FK8, Q6AXU9, Q6AY17, Q6IR85, Q6NZ03, Q7M759, Q7QGL9

Diamond homologs: A0A3L6DPG1, B0BN85, D3ZSP7, F8RP11, O13797, O59709, O88196, P15705, P53041, P53042, Q08446, Q0JL44, Q12118, Q2KIK0, Q2U919, Q388N2, Q43468, Q4WTC0, Q54IP0, Q55ED0, Q5R8D8, Q5U2X2, Q5WA76, Q5XEP2, Q5ZML4, Q60676, Q7T3F7, Q80ZK9, Q80ZX8, Q8BW49, Q8IZP2, Q8VWG7, Q93YR3, Q95LY5, Q99615, Q9CX34, Q9H892, Q9NES8, Q9QYI3, Q9STH1

SIGNOR signaling

14 interactions.

A	Effect	B	Mechanism
PPP5C	“down-regulates activity”	MAP3K5	dephosphorylation
HSP90AA1	up-regulates	PPP5C	binding
PPP5C	“down-regulates activity”	NR3C1	dephosphorylation
PPP5C	“down-regulates activity”	CDC37	dephosphorylation
PPP5C	“down-regulates activity”	CILK1	dephosphorylation
PPP2R3C	“up-regulates activity”	PPP5C	binding
PPP5C	“down-regulates activity”	ABCB1	dephosphorylation
CSNK1D	“up-regulates activity”	PPP5C	phosphorylation
PPP5C	“down-regulates activity”	RAF1	dephosphorylation
GNA12	“up-regulates activity”	PPP5C	binding
GNA13	“up-regulates activity”	PPP5C	binding

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 124 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Constitutive Signaling by EGFRvIII	5	38.8×	3e-05
Signaling by ERBB2 ECD mutants	5	36.5×	3e-05
Constitutive Signaling by Ligand-Responsive EGFR Cancer Variants	5	31.0×	5e-05
Signaling by ERBB2 KD Mutants	5	23.0×	2e-04
HSP90 chaperone cycle for steroid hormone receptors (SHR) in the presence of ligand	7	14.7×	5e-05
Transcriptional Regulation by VENTX	5	14.4×	2e-03
RET signaling	5	14.1×	2e-03
ESR-mediated signaling	9	12.6×	3e-05

GO biological processes:

GO term	Partners	Fold	FDR
chaperone-mediated protein complex assembly	5	30.5×	3e-04
autophagosome assembly	7	13.7×	3e-04
regulation of autophagy	6	12.6×	1e-03
protein folding	11	9.9×	1e-05
positive regulation of canonical Wnt signaling pathway	7	9.4×	1e-03
protein stabilization	10	5.8×	1e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

66 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	45
Likely benign	3
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

1977 predictions. Top by Δscore:

Variant	Effect	Δscore
19:46347214:AAAGG:A	donor_loss	1.0000
19:46347215:AAGG:A	donor_loss	1.0000
19:46347216:AGG:A	donor_loss	1.0000
19:46347218:GTGC:G	donor_loss	1.0000
19:46353743:C:CA	acceptor_gain	1.0000
19:46353743:CGCA:C	acceptor_loss	1.0000
19:46353744:GCAG:G	acceptor_loss	1.0000
19:46353745:CA:C	acceptor_loss	1.0000
19:46353746:A:AG	acceptor_gain	1.0000
19:46353746:A:AT	acceptor_loss	1.0000
19:46353747:G:A	acceptor_loss	1.0000
19:46353747:G:GA	acceptor_gain	1.0000
19:46353747:GC:G	acceptor_gain	1.0000
19:46353747:GCC:G	acceptor_gain	1.0000
19:46353747:GCCA:G	acceptor_gain	1.0000
19:46353747:GCCAA:G	acceptor_gain	1.0000
19:46353905:G:GT	donor_gain	1.0000
19:46353986:GACG:G	donor_gain	1.0000
19:46355740:T:G	donor_gain	1.0000
19:46375599:CCCA:C	acceptor_loss	1.0000
19:46375601:CA:C	acceptor_loss	1.0000
19:46375602:A:AG	acceptor_gain	1.0000
19:46375602:AG:A	acceptor_gain	1.0000
19:46375602:AGGT:A	acceptor_gain	1.0000
19:46375603:G:GA	acceptor_loss	1.0000
19:46375603:G:GG	acceptor_gain	1.0000
19:46375603:GG:G	acceptor_gain	1.0000
19:46375603:GGTG:G	acceptor_gain	1.0000
19:46375747:CATGA:C	donor_gain	1.0000
19:46375748:ATGA:A	donor_gain	1.0000

AlphaMissense

3317 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
19:46353829:G:C	R68P	1.000
19:46353831:A:C	S69R	1.000
19:46353833:C:A	S69R	1.000
19:46353833:C:G	S69R	1.000
19:46353879:G:C	A85P	1.000
19:46353918:G:C	G98R	1.000
19:46353919:G:A	G98D	1.000
19:46353927:C:A	R101S	1.000
19:46353928:G:C	R101P	1.000
19:46353931:G:C	R102P	1.000
19:46353934:C:A	A103D	1.000
19:46353970:C:A	A115E	1.000
19:46375682:T:C	F148L	1.000
19:46375684:T:A	F148L	1.000
19:46375684:T:G	F148L	1.000
19:46383801:G:T	G241W	1.000
19:46383802:G:A	G241E	1.000
19:46383802:G:T	G241V	1.000
19:46383804:G:C	D242H	1.000
19:46383805:A:C	D242A	1.000
19:46383805:A:G	D242G	1.000
19:46383805:A:T	D242V	1.000
19:46383806:C:A	D242E	1.000
19:46383806:C:G	D242E	1.000
19:46383810:C:G	H244D	1.000
19:46383812:T:A	H244Q	1.000
19:46383812:T:G	H244Q	1.000
19:46383813:G:C	G245R	1.000
19:46383813:G:T	G245C	1.000
19:46383814:G:A	G245D	1.000

dbSNP variants (sampled 300 via entrez): RS1000002479 (19:46355093 G>C,T), RS1000112174 (19:46361305 A>G), RS1000138893 (19:46346494 A>T), RS1000295330 (19:46383182 T>C), RS1000365748 (19:46345227 G>T), RS1000546201 (19:46360923 A>G), RS1000582344 (19:46382844 A>C,G), RS1000620415 (19:46384476 C>G), RS1000650382 (19:46346874 A>G), RS1000815489 (19:46370755 T>G), RS1000838428 (19:46367680 G>A), RS1000842765 (19:46349693 CTG>C), RS1000902608 (19:46363953 A>G), RS1001009995 (19:46389586 TGCCTGTGAGTTCCCTGTCTCTCCCCACCCGCATCATTTATTTGTTGAA>T), RS1001034579 (19:46370550 C>T)

Disease associations

OMIM: gene MIM:600658 | disease phenotypes:

GenCC curated gene-disease

Disease	Classification	Inheritance
neurodevelopmental disorder	Moderate	Autosomal dominant

Mondo (1): neurodevelopmental disorder (MONDO:0700092)

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

10 associations (top):

Study	Trait	p-value
GCST004132_48	Crohn’s disease	4.000000e-07
GCST004631_7	Basophil percentage of white cells	2.000000e-09
GCST005232_111	Neuroticism	3.000000e-08
GCST005537_49	Chronic inflammatory diseases (ankylosing spondylitis, Crohn’s disease, psoriasis, primary sclerosing cholangitis, ulcerative colitis) (pleiotropy)	2.000000e-11
GCST006817_5	Response to antidepressants in depression	5.000000e-06
GCST010244_340	Triglyceride levels	8.000000e-14
GCST90002381_350	Eosinophil count	1.000000e-10
GCST90002382_472	Eosinophil percentage of white cells	1.000000e-15
GCST90002384_458	Hemoglobin	1.000000e-09
GCST90002388_374	Lymphocyte count	8.000000e-13

EFO canonical traits (7, from GWAS)

EFO ID	Trait name
EFO:0007992	basophil percentage of leukocytes
EFO:0007660	neuroticism measurement
EFO:0004530	triglyceride measurement
EFO:0004842	eosinophil count
EFO:0007991	eosinophil percentage of leukocytes
EFO:0004509	hemoglobin measurement
EFO:0004587	lymphocyte count

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D065886	Neurodevelopmental Disorders	F03.625

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL3425389 (SINGLE PROTEIN)

Molecules with ChEMBL bioactivity

2 molecules (phase ≥1), by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 5,094 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

Molecule	Name	Phase	Patents
CHEMBL48449	CANTHARIDIN	4	4,679
CHEMBL4297300	LB-100	2	415

PharmGKB: 1 entry (VIP=true, CPIC=false)

Binding affinities (BindingDB)

4 measured of 9 human assays (9 total across all organisms); most potent 4 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value
EDASRMEEVD	KD	77 nM
DDTSRMEEVD	KD	79 nM
GSGPTMEEVD	KD	133 nM
IEEVD	KD	426 nM

ChEMBL bioactivities

20 potent at pChembl≥5 of 28 total, top 18 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
9.27	Kd	0.54	nM	CHEMBL5593159
9.00	IC50	1	nM	MICROCYSTIN-LR
8.52	IC50	3	nM	CALYCULIN A
8.46	IC50	3.5	nM	CHEMBL5268133
8.40	IC50	4	nM	CHEMBL5276260
8.00	IC50	10	nM	TAUTOMYCIN
7.92	IC50	11.9	nM	CHEMBL5276593
7.52	IC50	30	nM	CHEMBL5561795
6.40	IC50	400	nM	CANTHARIDIN
6.22	IC50	600	nM	CANTHARIDIN
6.16	IC50	700	nM	CHEMBL5405890
6.09	Kd	811	nM	CHEMBL5593159
6.00	IC50	1000	nM	CHEMBL5421006
6.00	IC50	1000	nM	DEMETHYL-CANTHARIDIN
5.94	Kd	1140	nM	CHEMBL5593159
5.75	IC50	1800	nM	CHEMBL5415208
5.70	IC50	2000	nM	CHEMBL5558181
5.60	IC50	2500	nM	CHEMBL5558644

PubChem BioAssay actives

27 with measured affinity, of 104 total; 22 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
5,7-difluoro-2-iminochromene-3-carbothioamide	2117658: Binding affinity to human PP5 extracted from Escherichia coli BL21 using immobilized CDC37 as substrate assessed as increase in PP5 binding to substrate by measuring dissociation constant preincubated with compound for 10 mins followed by CDC37 addition by biolayer interferometric analysis (Rvb = 20.9 nM )	kd	0.0005	uM
(5R,8S,11R,12S,15S,18S,19S,22R)-15-[3-(diaminomethylideneamino)propyl]-18-[(1E,3E,5S,6S)-6-methoxy-3,5-dimethyl-7-phenylhepta-1,3-dienyl]-1,5,12,19-tetramethyl-2-methylidene-8-(2-methylpropyl)-3,6,9,13,16,20,25-heptaoxo-1,4,7,10,14,17,21-heptazacyclopentacosane-11,22-dicarboxylic acid	1924792: Inhibition of PP5 (unknown origin)	ic50	0.0010	uM
[(2R,3R,5R,7R,8S,9S)-2-[(1S,3S,4S,5R,6R,7E,9E,11E,13Z)-14-cyano-3,5-dihydroxy-1-methoxy-4,6,8,9,13-pentamethyltetradeca-7,9,11,13-tetraenyl]-9-[(E)-3-[2-[(2S)-4-[[(2S,3S,4S)-4-(dimethylamino)-2,3-dihydroxy-5-methoxypentanoyl]amino]butan-2-yl]-1,3-oxazol-4-yl]prop-2-enyl]-7-hydroxy-4,4,8-trimethyl-1,10-dioxaspiro[4.5]decan-3-yl] dihydrogen phosphate	1924795: Inhibition of human PP5 using [3H]-phosphohistone as substrate	ic50	0.0030	uM
(2R)-3-[(2S,6R,11R)-2-[(E,2S)-4-[(2S,2’R,4R,4aS,6R,8aR)-4-hydroxy-2-[(1S,3S)-1-hydroxy-3-[(2S,3R,6S)-3-methyl-1,7-dioxaspiro[5.5]undecan-2-yl]butyl]-3-methylidenespiro[4a,7,8,8a-tetrahydro-4H-pyrano[3,2-b]pyran-6,5’-oxolane]-2’-yl]but-3-en-2-yl]-11-hydroxy-4-methyl-1,7-dioxaspiro[5.5]undec-4-en-8-yl]-2-hydroxy-2-methylpropanoic acid	1924792: Inhibition of PP5 (unknown origin)	ic50	0.0035	uM
[(2Z,5R,6S,9S,12S,13S,16R)-5-carboxyoxy-9-[3-(diaminomethylideneamino)propyl]-2-ethylidene-12-[(1E,3E,5S,6S)-6-methoxy-3,5-dimethyl-7-phenylhepta-1,3-dienyl]-1,6,13-trimethyl-3,7,10,14,19-pentaoxo-1,4,8,11,15-pentazacyclononadec-16-yl] hydrogen carbonate	1924797: Inhibition of PP5 (unknown origin) using [3H]-phosphohistone as substrate by liquid scintillation counting analysis	ic50	0.0040	uM
[(3R,4R,5R,8S,9S,12R)-12-[(2S,3S,6R,8S,9R)-3,9-dimethyl-8-[(3S)-3-methyl-4-oxopentyl]-1,7-dioxaspiro[5.5]undecan-2-yl]-5,9-dihydroxy-4-methoxy-2,8-dimethyl-7-oxotridecan-3-yl] (3R)-3-hydroxy-3-(4-methyl-2,5-dioxofuran-3-yl)propanoate	1924792: Inhibition of PP5 (unknown origin)	ic50	0.0100	uM
[(2R,3R,4R,7S,8S,11S,13R,16E)-17-ethyl-4,8-dihydroxy-3,7,11,13-tetramethyl-6,15-dioxononadeca-16,18-dien-2-yl] (3R)-3-hydroxy-3-(4-methyl-2,5-dioxofuran-3-yl)propanoate	1924797: Inhibition of PP5 (unknown origin) using [3H]-phosphohistone as substrate by liquid scintillation counting analysis	ic50	0.0119	uM
N,N’-bis(3-carbamoyl-6-ethyl-4,5,6,7-tetrahydro-1-benzothiophen-2-yl)pentanediamide	2084024: Inhibition of GST-tagged human PP5 expressed in Escherichia coli BL21 (DE3) using NH2-EDASRMEEVD-COOH peptide as substrate preincubated for 15 mins followed by substrate addition measured after 15 mins by Alpha Screen assay	ic50	0.0300	uM
(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-amino-4-carboxybutanoyl]amino]-3-carboxypropanoyl]amino]propanoyl]amino]-3-hydroxypropanoyl]amino]-5-(diaminomethylideneamino)pentanoyl]amino]-4-methylsulfanylbutanoyl]amino]-4-carboxybutanoyl]amino]-4-carboxybutanoyl]amino]-3-methylbutanoyl]amino]butanedioic acid	1802484: Fluorescence Polarization Assay from Article 10.1074/jbc.M113.519421: “The molecular chaperone Hsp70 activates protein phosphatase 5 (PP5) by binding the tetratricopeptide repeat (TPR) domain.”	kd	0.0770	uM
(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S,3R)-2-[[(2S)-2-[[(2S)-2-amino-3-carboxypropanoyl]amino]-3-carboxypropanoyl]amino]-3-hydroxybutanoyl]amino]-3-hydroxypropanoyl]amino]-5-(diaminomethylideneamino)pentanoyl]amino]-4-methylsulfanylbutanoyl]amino]-4-carboxybutanoyl]amino]-4-carboxybutanoyl]amino]-3-methylbutanoyl]amino]butanedioic acid	1802484: Fluorescence Polarization Assay from Article 10.1074/jbc.M113.519421: “The molecular chaperone Hsp70 activates protein phosphatase 5 (PP5) by binding the tetratricopeptide repeat (TPR) domain.”	kd	0.0790	uM
(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S,3R)-2-[[(2S)-1-[2-[[(2S)-2-[(2-aminoacetyl)amino]-3-hydroxypropanoyl]amino]acetyl]pyrrolidine-2-carbonyl]amino]-3-hydroxybutanoyl]amino]-4-methylsulfanylbutanoyl]amino]-4-carboxybutanoyl]amino]-4-carboxybutanoyl]amino]-3-methylbutanoyl]amino]butanedioic acid	1802484: Fluorescence Polarization Assay from Article 10.1074/jbc.M113.519421: “The molecular chaperone Hsp70 activates protein phosphatase 5 (PP5) by binding the tetratricopeptide repeat (TPR) domain.”	kd	0.1330	uM
(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-amino-4-methylsulfanylbutanoyl]amino]-4-carboxybutanoyl]amino]-4-carboxybutanoyl]amino]-3-methylbutanoyl]amino]butanedioic acid	1802484: Fluorescence Polarization Assay from Article 10.1074/jbc.M113.519421: “The molecular chaperone Hsp70 activates protein phosphatase 5 (PP5) by binding the tetratricopeptide repeat (TPR) domain.”	kd	0.1400	uM
Cantharidin	1924795: Inhibition of human PP5 using [3H]-phosphohistone as substrate	ic50	0.4000	uM
(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S,3S)-2-[[(2S)-2-[[(2S)-2-[[(2S,3R)-2-[[(2S)-2-[[(2S)-2-amino-3-carboxypropanoyl]amino]-3-carboxypropanoyl]amino]-3-hydroxybutanoyl]amino]-3-hydroxypropanoyl]amino]-5-(diaminomethylideneamino)pentanoyl]amino]-3-methylpentanoyl]amino]-4-carboxybutanoyl]amino]-4-carboxybutanoyl]amino]-3-methylbutanoyl]amino]butanedioic acid	1802484: Fluorescence Polarization Assay from Article 10.1074/jbc.M113.519421: “The molecular chaperone Hsp70 activates protein phosphatase 5 (PP5) by binding the tetratricopeptide repeat (TPR) domain.”	kd	0.4200	uM
(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S,3S)-2-amino-3-methylpentanoyl]amino]-4-carboxybutanoyl]amino]-4-carboxybutanoyl]amino]-3-methylbutanoyl]amino]butanedioic acid	1802484: Fluorescence Polarization Assay from Article 10.1074/jbc.M113.519421: “The molecular chaperone Hsp70 activates protein phosphatase 5 (PP5) by binding the tetratricopeptide repeat (TPR) domain.”	kd	0.4260	uM
(1S,2R,3S,4S,5S)-5-butoxy-7-oxabicyclo[2.2.1]heptane-2,3-dicarboxylic acid	1973980: Inhibition of PPP5C (unknown origin) phosphatase domain	ic50	0.7000	uM
(1S,2R,3S,4R,5S)-5-methyl-7-oxabicyclo[2.2.1]heptane-2,3-dicarboxylic acid	1973980: Inhibition of PPP5C (unknown origin) phosphatase domain	ic50	1.0000	uM
(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S,3S)-2-[[(2S,3R)-2-[[(2S)-1-[2-[[(2S)-2-[[(2S)-2-amino-3-hydroxypropanoyl]amino]-3-hydroxypropanoyl]amino]acetyl]pyrrolidine-2-carbonyl]amino]-3-hydroxybutanoyl]amino]-3-methylpentanoyl]amino]-4-carboxybutanoyl]amino]-4-carboxybutanoyl]amino]-3-methylbutanoyl]amino]butanedioic acid	1802484: Fluorescence Polarization Assay from Article 10.1074/jbc.M113.519421: “The molecular chaperone Hsp70 activates protein phosphatase 5 (PP5) by binding the tetratricopeptide repeat (TPR) domain.”	kd	1.0600	uM
(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S,3S)-2-[[(2S,3R)-2-[[(2S)-1-[2-[[(2S)-2-[(2-aminoacetyl)amino]-3-hydroxypropanoyl]amino]acetyl]pyrrolidine-2-carbonyl]amino]-3-hydroxybutanoyl]amino]-3-methylpentanoyl]amino]-4-carboxybutanoyl]amino]-4-carboxybutanoyl]amino]-3-methylbutanoyl]amino]butanedioic acid	1802484: Fluorescence Polarization Assay from Article 10.1074/jbc.M113.519421: “The molecular chaperone Hsp70 activates protein phosphatase 5 (PP5) by binding the tetratricopeptide repeat (TPR) domain.”	kd	1.5500	uM
(1S,2R,3S,4R)-3-(4-methylpiperazine-1-carbonyl)-7-oxabicyclo[2.2.1]heptane-2-carboxylic acid	1973971: Inhibition of MBP fused recombinant human PPP5C phosphatase domain expressed in Escherichia coli using DiFMUP as substrate	ic50	1.8000	uM
N,N’-bis(3-carbamoyl-4,5-dimethylthiophen-2-yl)pentanediamide	2084024: Inhibition of GST-tagged human PP5 expressed in Escherichia coli BL21 (DE3) using NH2-EDASRMEEVD-COOH peptide as substrate preincubated for 15 mins followed by substrate addition measured after 15 mins by Alpha Screen assay	ic50	2.0000	uM
methyl 2-[[2-[[5,6-bis(furan-2-yl)-1,2,4-triazin-3-yl]sulfanyl]acetyl]amino]-4,5-dimethylthiophene-3-carboxylate	2084024: Inhibition of GST-tagged human PP5 expressed in Escherichia coli BL21 (DE3) using NH2-EDASRMEEVD-COOH peptide as substrate preincubated for 15 mins followed by substrate addition measured after 15 mins by Alpha Screen assay	ic50	2.5000	uM

CTD chemical–gene interactions

48 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	affects methylation, decreases expression, increases abundance, increases expression	4
Particulate Matter	decreases expression, increases abundance	3
bisphenol A	affects cotreatment, increases methylation, decreases methylation, increases expression	2
Arsenic	affects methylation, decreases expression, increases abundance	2
Cadmium Chloride	decreases expression, decreases reaction	2
aristolochic acid I	increases expression	1
bisphenol F	increases expression	1
triphenyl phosphate	affects expression	1
trichostatin A	affects expression	1
coumarin	increases phosphorylation	1
di-n-butylphosphoric acid	affects expression	1
CGP 52608	increases reaction, affects binding	1
nutlin 3	affects cotreatment, increases secretion	1
bisphenol B	increases expression	1
bisphenol S	affects cotreatment, decreases methylation	1
Bortezomib	decreases expression	1
Sunitinib	decreases expression	1
Fulvestrant	affects cotreatment, increases methylation, decreases methylation	1
Acetaminophen	affects cotreatment, decreases expression	1
Glyphosate	decreases expression	1
Acetylcysteine	decreases expression, decreases reaction	1
Adenosine Diphosphate	affects binding, affects folding	1
Adenosine Triphosphate	affects binding, affects folding, increases reaction	1
Air Pollutants	decreases expression, increases abundance	1
Benzo(a)pyrene	affects methylation	1
Cannabidiol	increases expression	1
Chelating Agents	affects binding, decreases expression	1
Chlorogenic Acid	affects cotreatment, decreases expression	1
Copper	decreases expression, affects binding	1
Coumestrol	increases expression	1

ChEMBL screening assays

46 unique, capped per target: 46 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL3428706	Binding	Inhibition of PP5 (unknown origin) using pNPP as substrate at pH 7 at 25 degC by spectrophotometric analysis	A potent and selective inhibitor for the UBLCP1 proteasome phosphatase. — Bioorg Med Chem

Cellosaurus cell lines

4 cell lines: 2 transformed cell line, 2 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B3EM	Abcam HEK293T PPP5C KO	Transformed cell line	Female
CVCL_D9PA	Ubigene HEK293 PPP5C KO	Transformed cell line	Female
CVCL_TG28	HAP1 PPP5C (-) 1	Cancer cell line	Male
CVCL_TG29	HAP1 PPP5C (-) 2	Cancer cell line	Male

Clinical trials (associated diseases)

202 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT04586348	PHASE4	UNKNOWN	Prenatal Iodine Supplementation and Early Childhood Neurodevelopment
NCT04873115	PHASE4	UNKNOWN	Double-blind, Placebo-controlled, Randomized Clinical Trial Comparing the Efficacy and Safety of Sialanar Plus orAl rehabiLitation Against Placebo Plus Oral Rehabilitation for chIldren and Adolescents With seVere Sialorrhoea and Neurodisabilties,
NCT02559102	PHASE3	COMPLETED	Dexmedetomidine Sedation Versus General Anaesthesia for Inguinal Hernia Surgery in Infants
NCT02757079	PHASE3	COMPLETED	Study of the Efficacy and Safety of NPC-15 for Sleep Disorders of Children With Neurodevelopmental Disorders
NCT06915480	PHASE3	RECRUITING	Reducing Missed Appointments
NCT07377032	PHASE3	RECRUITING	TAP-GRIN: Interventional Study on Patients With GRIN-related Neurodevelopmental Disorders
NCT02909959	PHASE2	COMPLETED	Sulforaphane for the Treatment of Young Men With Autism Spectrum Disorder
NCT06081348	PHASE2	RECRUITING	Sertraline vs. Placebo in the Treatment of Anxiety in Children and AdoLescents With NeurodevelopMental Disorders
NCT06352372	PHASE2	COMPLETED	Safety and Efficacy of tPBM for Epileptiform Activity in Autism
NCT00503191	PHASE1	COMPLETED	NeuroModulation Technique Treatment of Autism
NCT04475848	PHASE1	COMPLETED	A Study to Investigate the Safety, Tolerability, Pharmacokinetics, Pharmacodynamics and Food Effect of RO6953958 in Healthy Participants
NCT06300398	PHASE1	COMPLETED	IAMA-6 Oral Dose Study in Healthy Adults
NCT01783041	PHASE2/PHASE3	COMPLETED	Effect of Early L-Carnitine Supplementation on Neurodevelopmental Outcomes in Very Preterm Infants
NCT05767385	PHASE2/PHASE3	RECRUITING	Fetal Cerebrovascular Autoregulation in Congenital Heart Disease and Association With Neonatal Neurobehavior
NCT05675098	EARLY_PHASE1	NOT_YET_RECRUITING	Central Nervous System Stimulants and Physical Function in Children With Cerebral Palsy
NCT00783783	Not specified	COMPLETED	CYP2D6 Pharmacogenetics in Risperidone-Treated Children
NCT01778504	Not specified	RECRUITING	Studying Childhood-onset Behavioral, Psychiatric, and Developmental Disorders
NCT01850784	Not specified	UNKNOWN	High Energy Formula Feeding in Infants With Congenital Heart Disease
NCT01922791	Not specified	COMPLETED	Nutrition and Pregnancy Intervention Study
NCT01942525	Not specified	UNKNOWN	Influence of Intrauterine Growth Restriction on Amplitude-integrated EEG in Preterm Infants
NCT02003170	Not specified	COMPLETED	Etiology and Early Diagnosis of Neurodevelopmental Disorders
NCT02118649	Not specified	ACTIVE_NOT_RECRUITING	Enhancing Behavior and Brain Response to Visual Targets Using a Computer Game
NCT02557191	Not specified	TERMINATED	Biomarkers, Neurodevelopment and Preterm Infants
NCT02690675	Not specified	COMPLETED	Iron Supplement Effect on Child Development
NCT02694003	Not specified	COMPLETED	Better Nights, Better Days for Children With Neurodevelopment Disorders
NCT02792894	Not specified	COMPLETED	Family Networks (FaNs) for Children With Developmental Disorders and Delays
NCT02871674	Not specified	UNKNOWN	Good Night Project: Behavioural Sleep Interventions for Children With ADHD: A Randomised Controlled Trial
NCT02887157	Not specified	COMPLETED	Analyzing Retinal Microanatomy in ROP
NCT02898298	Not specified	COMPLETED	Positive Emotion Regulation Training in Children, Adolescents and Young Adults With and Without Developmental Disorder
NCT02912780	Not specified	UNKNOWN	Introduction of Microsystems in a Level 3 Neonatal Intensive Care Unit
NCT03023293	Not specified	COMPLETED	n-3 PUFAs, Irisin and Maternal Glucose Metabolism From Pregnancy to Postpartum
NCT03023644	Not specified	COMPLETED	Improving Neurodevelopmental Outcomes in Children With Congenital Heart Disease: An Intervention Study
NCT03032991	Not specified	UNKNOWN	Early Biomarkers of Neurodevelopment in Offspring of Diabetic Mothers
NCT03088189	Not specified	TERMINATED	Effect of Parental Peri-conceptional Vitamin B12 Supplementation on Infant Neurocognitive Development in Offspring
NCT03096028	Not specified	COMPLETED	Developmental Origins of Mental Health Disorders
NCT03148782	Not specified	COMPLETED	Brain Plasticity Underlying Acquisition of New Organizational Skills in Children-R61 Phase
NCT03172104	Not specified	COMPLETED	Neurobehavioural Development of Infants Born <30 Weeks Gestational Age Between Birth and Five Years of Age
NCT03222375	Not specified	RECRUITING	SQUED™ Series 28.1 Home-use and Treatment of Autowave Reverberator of Autism
NCT03229928	Not specified	COMPLETED	Clinical Testing of a Real-Time Behavior Measurement Tool: Measuring Outcomes for CHAnge
NCT03232489	Not specified	UNKNOWN	Study for the Evaluation of the Feasibility of Applying Advanced MRI Scanning in Pediatric Clinical Practice