PRKAB2

Summary

PRKAB2 (protein kinase AMP-activated non-catalytic subunit beta 2, HGNC:9379) is a protein-coding gene on chromosome 1q21.1, encoding 5’-AMP-activated protein kinase subunit beta-2 (O43741). Non-catalytic subunit of AMP-activated protein kinase (AMPK), an energy sensor protein kinase that plays a key role in regulating cellular energy metabolism.

The protein encoded by this gene is a regulatory subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This subunit may be a positive regulator of AMPK activity. It is highly expressed in skeletal muscle and thus may have tissue-specific roles. Multiple alternatively spliced transcript variants have been found for this gene.

Source: NCBI Gene 5565 — RefSeq curated summary.

At a glance

• Gene–disease (curated): congenital heart disease (Disputed, ClinGen)
• Clinical variants (ClinVar): 27 total — 3 pathogenic
• GTEx eGene: eQTL in 25 tissues, sQTL in 2 (q < 0.05)
• Drug target: yes — 1 via a complex or family; 2 molecules with ChEMBL bioactivity
• Constraint (gnomAD): pLI 0.00 (LoF-tolerant), LOEUF 0.86 (unconstrained)
• MANE Select transcript: NM_005399

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:9379
Approved symbol	PRKAB2
Name	protein kinase AMP-activated non-catalytic subunit beta 2
Location	1q21.1
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000131791
Ensembl biotype	protein_coding
OMIM	602741
Entrez	5565

Gene structure

Transcript identifiers

Ensembl transcripts: 24 — 15 protein_coding, 7 nonsense_mediated_decay, 2 protein_coding_CDS_not_defined

MANE Select: ENST00000254101

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 1, TSL 3: 1, TSL 4: 1

ENST00000254101, ENST00000474939, ENST00000496858, ENST00000896001, ENST00000896002, ENST00000911676, ENST00000975695, ENST00000975696, ENST00000975697, ENST00000975698, ENST00000975699, ENST00000975700, ENST00000975701, ENST00000975702, ENST00000975703, ENST00000975704, ENST00000975705, ENST00000975706, ENST00000975707, ENST00000975708, ENST00001043148, ENST00001043149, ENST00001121076, ENST00001145686

RefSeq mRNA: 1 — MANE Select: NM_005399 NM_005399

CCDS: CCDS925

Canonical transcript exons

ENST00000254101 — 8 exons

Exon	Start	End
ENSE00000903087	147167767	147167933
ENSE00001706527	147162440	147162573
ENSE00001858470	147172429	147172470
ENSE00001949097	147155106	147159642
ENSE00003584114	147166846	147166939
ENSE00003620866	147171989	147172167
ENSE00003627429	147166498	147166618
ENSE00003664558	147161712	147161780

Expression profiles

Bgee: expression breadth ubiquitous, 274 present calls, max score 97.24.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 12.1245 / max 375.2191, expressed in 1779 samples.

Highest expression (Bgee): jejunal mucosa, biceps brachii, skeletal muscle tissue of rectus abdominis, skeletal muscle tissue of biceps brachii, jejunum.

Genetic regulation across tissues (GTEx eQTL / sQTL)

PRKAB2 is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 25 tissues and its splicing (sQTL) in 2 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 27 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Skin Not Sun Exposed Suprapubic	eqtl	1.3e-29	-0.27	1:147172620:C:A
Skin Sun Exposed Lower leg	eqtl	1.1e-26	-0.21	1:147217371:T:C
Brain Cerebellar Hemisphere	eqtl	1.9e-15	-0.28	1:147157163:T:G
Muscle Skeletal	eqtl	1.7e-14	-0.21	1:147124724:T:C
Cells Cultured fibroblasts	eqtl	7.6e-14	-0.17	1:147153614:C:T
Nerve Tibial	eqtl	5.6e-13	-0.21	1:147157821:GC:G
Testis	eqtl	1.4e-12	-0.21	1:147157821:GC:G
Whole Blood	eqtl	2.6e-11	-0.16	1:147228408:A:G
Brain Cerebellum	eqtl	4.5e-11	-0.27	1:147146982:A:G
Stomach	eqtl	8.5e-10	+0.35	1:146975926:C:G
Artery Tibial	eqtl	5.0e-08	-0.18	1:147321991:G:C
Adipose Visceral Omentum	eqtl	2.1e-06	-0.12	1:147122310:C:G
Adipose Subcutaneous	eqtl	9.5e-06	-0.14	1:147162935:T:G
Ovary	eqtl	1.9e-05	-0.39	1:147206806:TGATGTAAATGACAAGTTAATG:T
Liver	eqtl	3.7e-05	-0.18	1:147166024:A:T
Esophagus Mucosa	eqtl	5.0e-04	-0.14	1:147157163:T:G
Heart Left Ventricle	eqtl	6.1e-04	-0.11	1:147124724:T:C
Brain Anterior cingulate cortex BA24	eqtl	7.0e-04	-0.66	1:148125144:C:G
Skin Not Sun Exposed Suprapubic	sqtl	7.5e-04	+0.23	1:147238135:C:T
Esophagus Muscularis	eqtl	6.4e-03	-0.10	1:147126253:G:A

FANTOM5 promoters

5 alternative TSS:

Promoter ID	TPM avg	Samples expressed
14206	5.9229	1615
14203	3.3017	1304
14207	2.5291	1241
14205	0.2828	122
14202	0.0881	26

Top tissues by expression

showing 100 of 295 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
jejunal mucosa	UBERON:0000399	97.24	gold quality
biceps brachii	UBERON:0001507	96.91	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	96.40	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	96.02	gold quality
jejunum	UBERON:0002115	95.42	gold quality
gastrocnemius	UBERON:0001388	95.32	gold quality
body of tongue	UBERON:0011876	95.25	gold quality
muscle of leg	UBERON:0001383	94.81	gold quality
saphenous vein	UBERON:0007318	93.36	gold quality
adrenal tissue	UBERON:0018303	92.32	gold quality
skeletal muscle organ	UBERON:0014892	92.29	gold quality
muscle organ	UBERON:0001630	92.28	gold quality
hindlimb stylopod muscle	UBERON:0004252	91.65	gold quality
buccal mucosa cell	CL:0002336	91.17	gold quality
tibial artery	UBERON:0007610	90.83	gold quality
popliteal artery	UBERON:0002250	90.82	gold quality
duodenum	UBERON:0002114	90.63	gold quality
cortical plate	UBERON:0005343	90.62	gold quality
tibia	UBERON:0000979	90.48	gold quality
body of pancreas	UBERON:0001150	90.35	gold quality
middle temporal gyrus	UBERON:0002771	89.56	gold quality
right lobe of liver	UBERON:0001114	89.43	gold quality
muscle layer of sigmoid colon	UBERON:0035805	89.33	gold quality
right coronary artery	UBERON:0001625	89.24	gold quality
tongue	UBERON:0001723	89.20	gold quality
skin of hip	UBERON:0001554	89.09	gold quality
aorta	UBERON:0000947	88.73	gold quality
lower esophagus muscularis layer	UBERON:0035833	88.15	gold quality
lower esophagus	UBERON:0013473	88.14	gold quality
urethra	UBERON:0000057	87.94	gold quality
skeletal muscle tissue	UBERON:0001134	87.87	gold quality
body of uterus	UBERON:0009853	87.87	gold quality
sigmoid colon	UBERON:0001159	87.65	gold quality
descending thoracic aorta	UBERON:0002345	87.57	gold quality
body of stomach	UBERON:0001161	87.34	gold quality
visceral pleura	UBERON:0002401	87.32	gold quality
fundus of stomach	UBERON:0001160	87.28	gold quality
heart right ventricle	UBERON:0002080	87.27	gold quality
liver	UBERON:0002107	87.17	gold quality
Brodmann (1909) area 23	UBERON:0013554	87.09	gold quality
left coronary artery	UBERON:0001626	86.96	gold quality
upper leg skin	UBERON:0004262	86.96	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	86.96	gold quality
heart left ventricle	UBERON:0002084	86.95	gold quality
cardiac ventricle	UBERON:0002082	86.93	gold quality
coronary artery	UBERON:0001621	86.68	gold quality
tibialis anterior	UBERON:0001385	86.66	silver quality
myometrium	UBERON:0001296	86.64	gold quality
small intestine	UBERON:0002108	86.53	gold quality
heart	UBERON:0000948	86.38	gold quality
mucosa of stomach	UBERON:0001199	86.30	gold quality
small intestine Peyer’s patch	UBERON:0003454	86.25	gold quality
stomach	UBERON:0000945	86.24	gold quality
right atrium auricular region	UBERON:0006631	86.20	gold quality
deltoid	UBERON:0001476	86.18	gold quality
right hemisphere of cerebellum	UBERON:0014890	86.13	gold quality
cerebellar hemisphere	UBERON:0002245	86.06	gold quality
cerebellar cortex	UBERON:0002129	85.99	gold quality
thoracic aorta	UBERON:0001515	85.95	gold quality
intestine	UBERON:0000160	85.91	gold quality
ascending aorta	UBERON:0001496	85.82	gold quality
colon	UBERON:0001155	85.80	gold quality
superior surface of tongue	UBERON:0007371	85.74	gold quality
large intestine	UBERON:0000059	85.65	gold quality
ganglionic eminence	UBERON:0004023	85.65	gold quality
gluteal muscle	UBERON:0002000	85.62	gold quality
endothelial cell	CL:0000115	85.59	gold quality
pancreas	UBERON:0001264	85.54	gold quality
ectocervix	UBERON:0012249	85.51	gold quality
vastus lateralis	UBERON:0001379	85.47	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	85.27	gold quality
transverse colon	UBERON:0001157	85.18	gold quality
ventricular zone	UBERON:0003053	85.17	gold quality
dorsal root ganglion	UBERON:0000044	85.16	gold quality
muscle tissue	UBERON:0002385	85.15	gold quality
cardiac atrium	UBERON:0002081	84.95	gold quality
endocervix	UBERON:0000458	84.91	gold quality
skin of leg	UBERON:0001511	84.90	gold quality
colonic epithelium	UBERON:0000397	84.87	gold quality
pleura	UBERON:0000977	84.87	gold quality
vagina	UBERON:0000996	84.69	gold quality
skin of abdomen	UBERON:0001416	84.69	gold quality
quadriceps femoris	UBERON:0001377	84.68	gold quality
rectum	UBERON:0001052	84.67	gold quality
right lung	UBERON:0002167	84.64	gold quality
cerebellum	UBERON:0002037	84.55	gold quality
seminal vesicle	UBERON:0000998	84.33	gold quality
synovial joint	UBERON:0002217	84.26	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	84.17	gold quality
stromal cell of endometrium	CL:0002255	84.16	gold quality
parietal pleura	UBERON:0002400	84.09	gold quality
smooth muscle tissue	UBERON:0001135	83.92	gold quality
tibial nerve	UBERON:0001323	83.91	gold quality
right adrenal gland	UBERON:0001233	83.81	gold quality
zone of skin	UBERON:0000014	83.77	gold quality
tendon	UBERON:0000043	83.71	gold quality
left adrenal gland	UBERON:0001234	83.58	gold quality
subcutaneous adipose tissue	UBERON:0002190	83.54	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	83.52	gold quality
esophagus	UBERON:0001043	83.50	gold quality

Single-cell (SCXA)

Detected in 3 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-GEOD-100618	yes	1246.03
E-ANND-3	no	4.49
E-CURD-112	no	2.93

HPA expression

RNA tissue specificity: Tissue enhanced

showing 60 of 80 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Tongue	tissue	97.0
Skeletal muscle	tissue	91.1	medium
Parathyroid gland	tissue	60.9	high
Liver	tissue	52.7	high
Pancreas	tissue	32.8	high
Duodenum	tissue	30.1	high
Heart muscle	tissue	24.2	medium
Small intestine	tissue	19.6	high
Smooth muscle	tissue	18.4	medium
Seminal vesicle	tissue	18.3	medium
Postcentral gyrus	tissue	17.6
Spinal cord	tissue	15.4
Skin 1	tissue	14.6	medium
Retina	tissue	13.6
Vagina	tissue	13.5	low
Frontal cortex	tissue	12.7
Endometrium 1	tissue	12.4	medium
Cerebellum	tissue	12.4	medium
Midbrain	tissue	12.1
Hippocampal formation	tissue	12.0
Medulla oblongata	tissue	11.9
Substantia nigra	tissue	11.9
Prostate	tissue	11.9	medium
Superior colliculi	tissue	11.7
Placenta	tissue	11.5	high
Pons	tissue	11.4
Breast	tissue	11.1	medium
Nucleus accumbens	tissue	11.0
Thalamus	tissue	11.0
Locus coeruleus	tissue	10.7
Ovary	tissue	10.6	low
Corpus callosum	tissue	10.3
Cerebral cortex	tissue	10.2	medium
Somatosensory cortex	tissue	10.2
Rectum	tissue	10.1	medium
Hippocampus	tissue	10.0	medium
Esophagus	tissue	9.7	medium
Caudate putamen	tissue	9.7
Hypothalamus	tissue	9.4
Periaqueductal gray	tissue	9.4
Motor cortex	tissue	9.3
Colon	tissue	9.1	medium
Stomach 1	tissue	9.0	medium
Occipital cortex	tissue	9.0
Prefrontal cortex	tissue	8.9
Urinary bladder	tissue	8.9	high
Putamen	tissue	8.9
Kidney	tissue	8.9	medium
Retrosplenial and cingulate cortex	tissue	8.9
Adrenal gland	tissue	8.8	medium
Amygdala	tissue	8.7
Entorhinal cortex	tissue	8.7
Ventral forebrain	tissue	8.6
Bone marrow	tissue	8.5	medium
Septum	tissue	8.4
Retrosplenial cortex	tissue	8.4
Insular cortex	tissue	8.4
Cervix	tissue	8.2	medium
Temporal cortex	tissue	8.2
Epididymis	tissue	8.0	high

Brain sub-regions (HPA Brain Atlas): detected in 192; highest nTPM — Blood vessel (27.4), Cerebellar cortex (18.9), Flocculonodular lobe (17.3), Vermis (16.8), Dorsal funiculus (white matter) (15.9).

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

Targeting PRKAB2 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 162 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-29A-3P	100.00	73.11	1835
HSA-MIR-29B-3P	100.00	73.18	1833
HSA-MIR-29C-3P	100.00	73.15	1833
HSA-MIR-8485	100.00	77.57	4731
HSA-MIR-3064-3P	100.00	70.09	1254
HSA-MIR-4668-3P	100.00	68.74	2635
HSA-MIR-518D-5P	100.00	67.51	979
HSA-MIR-518F-5P	100.00	67.51	979
HSA-MIR-520C-5P	100.00	67.51	979
HSA-MIR-526A-5P	100.00	67.51	979
HSA-MIR-3646	100.00	73.56	5283
HSA-MIR-4425	100.00	67.59	1049
HSA-MIR-518E-5P	100.00	67.66	954
HSA-MIR-519A-5P	100.00	67.66	954
HSA-MIR-519B-5P	100.00	67.66	954
HSA-MIR-519C-5P	100.00	67.66	954
HSA-MIR-522-5P	100.00	67.66	954
HSA-MIR-523-5P	100.00	67.66	954
HSA-MIR-520G-5P	99.99	66.76	658
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-3662	99.99	73.82	5684
HSA-MIR-103A-3P	99.98	69.14	1595
HSA-MIR-107	99.98	69.14	1595
HSA-MIR-12136	99.98	72.81	5713
HSA-MIR-3617-3P	99.98	67.86	918
HSA-MIR-3148	99.97	75.06	6478
HSA-MIR-3688-3P	99.97	72.02	2834
HSA-MIR-1250-3P	99.96	70.04	4038
HSA-MIR-5688	99.96	73.23	4504
HSA-MIR-495-3P	99.96	72.81	4197

Functional genomics

gnomAD constraint: pLI 0.00108, LOEUF 0.863, missense Z 1.39 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD)

ENST00000254101 splits into 2 regions with different missense tolerance; 0 are missense-constrained. Missense variants in a constrained region (low observed/expected) are more likely to be pathogenic. gnomAD

Region (GRCh38)	Missense obs / exp	o/e	Constrained
1:147,159,568–147,162,510	42 / 88.8	0.47	no
1:147,162,511–147,172,144	228 / 255.5	0.89	no

Literature-anchored findings (GeneRIF, showing 12)

• variants in PRKAB2 are unlikely to contribute to the type 2 diabetes mellitus susceptibility in Pima Indians (PMID:12490143)
• Purification and characterization of truncated human AMPK alpha 2 beta 2 gamma 3 heterotrimer from baculovirus-infected insect cells (PMID:19836452)
• These results suggest that the modification introduced by the laforin-malin complex could affect the subcellular distribution of AMPK beta subunits. (PMID:20534808)
• results of this study demonistrated that the novel findings that intronic SNPs in the genes coding for the regulatory beta2(PRKAB2) of AMPK are associated with antipsychotic-induced weight gain in schizophrenia or schizoaffective disorder patients (PMID:22305490)
• Data indicate that except AMPK-alpha1, expressions of the other five AMPK subunits -alpha2, -beta1, -beta2, -gamma1 and -gamma2 are significantly higher in ovarian carcinomas. (PMID:22897928)
• Studies suggest insights into the regulation of AMPK, its diverse biological actions, and therapeutic potential in the heart. (PMID:22935535)
• Sumoylation of AMPKbeta2 subunit enhances AMP-activated protein kinase activity. (PMID:23552691)
• AMP-activated protein kinase can be modulated by diverse ligands and by phosphorylation. (PMID:30206123)
• Sleep disturbances are one of the most common problems affecting individuals with psychiatric disorders. We show that AMPK is required for maintenance of proper sleep architecture and for sleep recovery following sleep deprivation. Neuronal AMPKbeta loss specifically leads to sleep fragmentation and causes dysregulation of genes believed to play a role in sleep homeostasis. (PMID:30566533)
• these data indicate that increased expression of AMPKbeta2 is an important feature of efficient adipogenesis. (PMID:31189568)
• AMPKbeta1 and AMPKbeta2 define an isoform-specific gene signature in human pluripotent stem cells, differentially mediating cardiac lineage specification. (PMID:33454005)
• MiR-29b Alleviates High Glucose-induced Inflammation and Apoptosis in Podocytes by Down-regulating PRKAB2. (PMID:38204237)

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio		ENSDARG00000067817
mus_musculus	Prkab2	ENSMUSG00000038205
rattus_norvegicus	Prkab2	ENSRNOG00000018166
caenorhabditis_elegans		WBGENE00007222
caenorhabditis_elegans		WBGENE00010115
caenorhabditis_elegans		WBGENE00012928

Paralogs (1): PRKAB1 (ENSG00000111725)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:1336185) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 22 distinct phenotype terms.

Mouse phenotype (MP)	Records
impaired exercise endurance	3
increased circulating insulin level	2
insulin resistance	2
decreased skeletal muscle glycogen level	2
muscle weakness	1
increased circulating triglyceride level	1
abnormal glucose homeostasis	1
abnormal lipid homeostasis	1
decreased glycogen catabolism rate	1
increased eosinophil cell number	1
impaired glucose tolerance	1
decreased circulating glucose level	1
increased susceptibility to diet-induced obesity	1
decreased physiological sensitivity to xenobiotic	1
decreased mean platelet volume	1
decreased skeletal muscle fiber size	1
increased total body fat amount	1
decreased liver glycogen level	1
preweaning lethality, incomplete penetrance	1
increased muscle cell glucose uptake	1
decreased muscle cell glucose uptake	1
decreased skeletal muscle cell glucose uptake	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Pongo abelii	Q5R801	99.6%	Diamond
Bos taurus	Q5BIS9	97.0%	Diamond
Sus scrofa	P80387	96.7%	Diamond
Arabidopsis thaliana	Q9FEB5	63.9%	Diamond
Oryza sativa Japonica Group	Q10F03	41.3%	Diamond
Schizosaccharomyces pombe 972h-	P78789	40.7%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
RNVU1-8	snRNA	101447996
FMO5	protein-coding	2330
CHD1L	protein-coding	9557
LINC00624	ncRNA	100289211

Protein

Protein identifiers

5’-AMP-activated protein kinase subunit beta-2 — O43741 (reviewed: O43741)

All UniProt accessions (3): O43741, X5D2Z8, X5D9J1

UniProt curated annotations — full annotation on UniProt →

Function. Non-catalytic subunit of AMP-activated protein kinase (AMPK), an energy sensor protein kinase that plays a key role in regulating cellular energy metabolism. In response to reduction of intracellular ATP levels, AMPK activates energy-producing pathways and inhibits energy-consuming processes: inhibits protein, carbohydrate and lipid biosynthesis, as well as cell growth and proliferation. AMPK acts via direct phosphorylation of metabolic enzymes, and by longer-term effects via phosphorylation of transcription regulators. Also acts as a regulator of cellular polarity by remodeling the actin cytoskeleton; probably by indirectly activating myosin. Beta non-catalytic subunit acts as a scaffold on which the AMPK complex assembles, via its C-terminus that bridges alpha (PRKAA1 or PRKAA2) and gamma subunits (PRKAG1, PRKAG2 or PRKAG3).

Subunit / interactions. AMPK is a heterotrimer of an alpha catalytic subunit (PRKAA1 or PRKAA2), a beta (PRKAB1 or PRKAB2) and a gamma non-catalytic subunits (PRKAG1, PRKAG2 or PRKAG3).

Post-translational modifications. Phosphorylated when associated with the catalytic subunit (PRKAA1 or PRKAA2). Phosphorylated by ULK1 and ULK2; leading to negatively regulate AMPK activity and suggesting the existence of a regulatory feedback loop between ULK1, ULK2 and AMPK.

Similarity. Belongs to the 5’-AMP-activated protein kinase beta subunit family.

Isoforms (2)

UniProt ID	Names	Canonical?
O43741-1	1	yes
O43741-2	2

RefSeq proteins (1): NP_005390* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR006828	ASC_dom	Domain
IPR013783	Ig-like_fold	Homologous_superfamily
IPR014756	Ig_E-set	Homologous_superfamily
IPR032640	AMPK1_CBM	Domain
IPR037256	ASC_dom_sf	Homologous_superfamily
IPR050827	CRP1_MDG1_kinase	Family

Pfam: PF04739, PF16561

Enzyme classification (BRENDA)

• EC 2.7.11.31 — [hydroxymethylglutaryl-CoA reductase (NADPH)] kinase (BRENDA: 25 organisms, 266 substrates, 134 inhibitors, 51 Km, 0 kcat entries)

Substrate kinetics (BRENDA)

19 substrates with measured Km, best-characterized 15. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
ATP	0.02–0.4168	15
BIOTIN-GGHMRSAMSGLHLVKRR-NH2	0.0267–0.1214	6
ACETYL-COA CARBOXYLASE	—	4
HMGSAMSGLHLVKRR	0.573–2.316	2
HMHSAMSGLHLVKRR	0.118–0.428	2
HMKSAMSGLHLVKRR	0.111–0.133	2
HMRSAGSGLHLVKRR	0.069–0.07	2
HMRSAMSGLHGVKRR	0.013–0.096	2
HMRSAMSGLHLGKRR	0.038–0.042	2
HMRSAMSGLHLVKRR	0.0498–0.091	2
HMRSAMTGLHGVKRR	0.034–0.065	2
HGRSAMSGLHLVKRR	0.0404	1
HISTONE	0.005	1
HISTONE H1	0.0029	1
HMRSAMSGLHGGKRR	0.049	1

UniProt features (33 total): strand 11, modified residue 10, helix 5, splice variant 2, turn 2, chain 1, region of interest 1, mutagenesis site 1

Structure

Experimental structures (PDB)

17 structures by resolution:

PDB	Title	Method	Resolution (Å)
2F15	Glycogen-Binding Domain Of The Amp-Activated Protein Kinase beta2 Subunit	X-RAY DIFFRACTION	2
2V8Q	Crystal structure of the regulatory fragment of mammalian AMPK in complexes with AMP	X-RAY DIFFRACTION	2.1
4EAI	Co-crystal structure of an AMPK core with AMP	X-RAY DIFFRACTION	2.29
2V92	Crystal structure of the regulatory fragment of mammalian AMPK in complexes with ATP-AMP	X-RAY DIFFRACTION	2.4
2Y8L	Structure of the regulatory fragment of mammalian aMPK in complex with two ADP	X-RAY DIFFRACTION	2.5
2YA3	STRUCTURE OF THE REGULATORY FRAGMENT OF MAMMALIAN AMPK IN COMPLEX WITH COUMARIN ADP	X-RAY DIFFRACTION	2.51
2V9J	Crystal structure of the regulatory fragment of mammalian AMPK in complexes with …	X-RAY DIFFRACTION	2.53
4EAJ	Co-crystal of AMPK core with AMP soaked with ATP	X-RAY DIFFRACTION	2.61
2Y8Q	Structure of the regulatory fragment of mammalian AMPK in complex with one ADP	X-RAY DIFFRACTION	2.8
4CFH	Structure of an active form of mammalian AMPK	X-RAY DIFFRACTION	3.24
7JHG	Cryo-EM structure of ATP-bound fully inactive AMPK in complex with Dorsomorphin (Compound …	ELECTRON MICROSCOPY	3.47
6B2E	Structure of full length human AMPK (a2b2g1) in complex with a small molecule activator …	X-RAY DIFFRACTION	3.8
7JHH	Cryo-EM structure of ATP-bound fully inactive AMPK in complex with Fab and nanobody	ELECTRON MICROSCOPY	3.92
7M74	ATP-bound AMP-activated protein kinase	ELECTRON MICROSCOPY	3.93
4RER	Crystal structure of the phosphorylated human alpha1 beta2 gamma1 holo-AMPK complex bound …	X-RAY DIFFRACTION	4.05
4REW	Crystal structure of the non-phosphorylated human alpha1 beta2 gamma1 holo-AMPK complex	X-RAY DIFFRACTION	4.58
7JIJ	ATP-bound AMP-activated protein kinase	X-RAY DIFFRACTION	5.5

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O43741-F1	78.62	0.59

Antibody-complex structures (SAbDab)

3 antibodies co-crystallized with this protein: 7JHG, 7JHH, 7M74

Human Protein Atlas

Protein class: Predicted intracellular proteins, FDA approved drug targets, Small molecule drugs

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): nucleoplasm; cytosol

Antibody reliability (HPA): IH enhanced · IF approved

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (10)

Type	Positions
Phosphoserine	174, 184, 39, 69, 95, 108, 158, 170
Phosphothreonine	40, 148

Mutagenesis-validated functional residues (1)

Position	Phenotype
235	results in an ampk enzyme that is activable by phosphorylation but has significantly increased rate of dephosphorylation in phosphatase …

Function

Pathways and Gene Ontology

Reactome pathways

6 curated (TAS) of 33; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

33 pathways:

ID	Pathway	Evidence
R-HSA-9931269	AMPK-induced ERAD and lysosome mediated degradation of PD-L1(CD274)	curated
R-HSA-200425	Carnitine shuttle	curated
R-HSA-380972	Energy dependent regulation of mTOR by LKB1-AMPK	curated
R-HSA-1632852	Macroautophagy	curated
R-HSA-6804756	Regulation of TP53 Activity through Phosphorylation	curated
R-HSA-5628897	TP53 Regulates Metabolic Genes	curated
R-HSA-163680	AMPK inhibits chREBP transcriptional activation activity	electronic
R-HSA-9619483	Activation of AMPK downstream of NMDARs	electronic
R-HSA-442755	Activation of NMDA receptors and postsynaptic events	—
R-HSA-2151209	Activation of PPARGC1A (PGC-1alpha) by phosphorylation	electronic
R-HSA-9612973	Autophagy	—
R-HSA-8978868	Fatty acid metabolism	—
R-HSA-74160	Gene expression (Transcription)	—
R-HSA-212436	Generic Transcription Pathway	—
R-HSA-163685	Integration of energy metabolism	—
R-HSA-9613354	Lipophagy	electronic
R-HSA-165159	MTOR signalling	—
R-HSA-199991	Membrane Trafficking	—
R-HSA-1430728	Metabolism	—
R-HSA-556833	Metabolism of lipids	—
R-HSA-1592230	Mitochondrial biogenesis	—
R-HSA-112316	Neuronal System	—
R-HSA-112314	Neurotransmitter receptors and postsynaptic signal transmission	—
R-HSA-1852241	Organelle biogenesis and maintenance	—
R-HSA-438064	Post NMDA receptor activation events	—
R-HSA-73857	RNA Polymerase II Transcription	—
R-HSA-5633007	Regulation of TP53 Activity	—
R-HSA-9663891	Selective autophagy	—
R-HSA-162582	Signal Transduction	—
R-HSA-3700989	Transcriptional Regulation by TP53	—
R-HSA-1445148	Translocation of SLC2A4 (GLUT4) to the plasma membrane	electronic
R-HSA-112315	Transmission across Chemical Synapses	—
R-HSA-5653656	Vesicle-mediated transport	—

MSigDB gene sets: 281 (showing top): BROWNE_HCMV_INFECTION_30MIN_DN, GSE45365_NK_CELL_VS_CD8_TCELL_UP, TGGTGCT_MIR29A_MIR29B_MIR29C, KEGG_ADIPOCYTOKINE_SIGNALING_PATHWAY, REACTOME_ADAPTIVE_IMMUNE_SYSTEM, KYNG_DNA_DAMAGE_DN, REACTOME_MEMBRANE_TRAFFICKING, GOBP_MONOCARBOXYLIC_ACID_METABOLIC_PROCESS, GOBP_ORGANIC_ACID_BIOSYNTHETIC_PROCESS, SRF_Q5_01, PATIL_LIVER_CANCER, GOBP_SMALL_MOLECULE_BIOSYNTHETIC_PROCESS, SRF_C, BROWNE_HCMV_INFECTION_14HR_DN, WTGAAAT_UNKNOWN

GO Biological Process (6): fatty acid biosynthetic process (GO:0006633), signal transduction (GO:0007165), cellular response to nutrient levels (GO:0031669), positive regulation of cold-induced thermogenesis (GO:0120162), lipid metabolic process (GO:0006629), fatty acid metabolic process (GO:0006631)

GO Molecular Function (4): protein kinase binding (GO:0019901), AMP-activated protein kinase activity (GO:0004679), protein binding (GO:0005515), kinase activity (GO:0016301)

GO Cellular Component (6): nucleus (GO:0005634), nucleoplasm (GO:0005654), cytoplasm (GO:0005737), endoplasmic reticulum lumen (GO:0005788), cytosol (GO:0005829), nucleotide-activated protein kinase complex (GO:0031588)

Reactome top-level categories

16 top-level categories:

Category	Pathways
Membrane Trafficking	1
Autophagy	1
Integration of energy metabolism	1
Fatty acid metabolism	1
Mitochondrial biogenesis	1
MTOR signalling	1
Transcriptional Regulation by TP53	1
Regulation of TP53 Activity	1
Selective autophagy	1
Post NMDA receptor activation events	1
Regulation of PD-L1(CD274) Post-translational modification	1
Transmission across Chemical Synapses	1
Neuronal System	1
Organelle biogenesis and maintenance	1
Metabolism	1
Signal Transduction	1

GO top-level categories

29 GO namespaces:

Category	Terms
cellular anatomical structure	3
cellular response to stimulus	2
fatty acid metabolic process	1
lipid biosynthetic process	1
monocarboxylic acid biosynthetic process	1
cell communication	1
cellular process	1
signaling	1
regulation of cellular process	1
response to nutrient levels	1
positive regulation of multicellular organismal process	1
cold-induced thermogenesis	1
regulation of cold-induced thermogenesis	1
primary metabolic process	1
lipid metabolic process	1
monocarboxylic acid metabolic process	1
kinase binding	1
protein serine/threonine kinase activity	1
AMP binding	1
binding	1
transferase activity, transferring phosphorus-containing groups	1
intracellular membrane-bounded organelle	1
nuclear lumen	1
intracellular anatomical structure	1
endoplasmic reticulum	1
intracellular organelle lumen	1
cytoplasm	1
intracellular protein-containing complex	1
protein kinase complex	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 2 of 16 annotations. The rest are phylogenetic / computational / electronic (IEA).

2 experimentally-supported GO terms:

GO term	NS	Evidence
cellular response to nutrient levels	BP	direct assay
nucleotide-activated protein kinase complex	CC	direct assay

Protein interactions and networks

STRING

showing 15 of 1,314 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
PRKAB2	PRKAG1	P54619	943
PRKAB2	PRKAA2	P54646	926
PRKAB2	PRKAA1	Q13131	881
PRKAB2	PRKAG3	Q9UGI9	793
PRKAB2	PRKAG2	Q9UGJ0	762
PRKAB2	ACP6	Q9NPH0	731
PRKAB2	CHD1L	Q86WJ1	717
PRKAB2	GJA8	P48165	632
PRKAB2	GJA5	P36382	599
PRKAB2	FMO5	P49326	596
PRKAB2	GPHRA	B7ZAQ6	596
PRKAB2	NBPF11	Q86T75	547
PRKAB2	PRKAB1	Q9Y478	500
PRKAB2	POLR3GL	Q9BT43	496
PRKAB2	CAMKK2	Q96RR4	492

IntAct

Human interaction partners of PRKAB2 in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

showing 30 of 186 partners by confidence:

Partner	Interaction type	MIscore	Records
PRKAA1	association	0.950	15
PRKAG1	association	0.940	17
PRKAA2	physical association	0.940	9
IKZF3	physical association	0.910	12
MDFI	physical association	0.880	12
GOLGA2	physical association	0.880	10
KLF15	physical association	0.870	9
BLZF1	physical association	0.840	9
PSME3	physical association	0.840	9
CRX	physical association	0.830	9
GET4	physical association	0.830	8
TRAF2	physical association	0.830	8
DAO	physical association	0.800	6
PRKAG3	association	0.800	5
PYGM	physical association	0.780	7
RHEBL1	physical association	0.780	7
GATA1	physical association	0.760	9
IHO1	physical association	0.760	6
BANP	physical association	0.740	8
CDX4	physical association	0.740	5
PRKAB1	association	0.740	3
GYS1	association	0.730	2
PRKAG2	association	0.730	2
KRTAP10-7	physical association	0.720	8
KRTAP9-2	physical association	0.720	8
KRT40	physical association	0.720	6
KRTAP10-8	physical association	0.720	6
KRTAP10-9	physical association	0.720	6
KRTAP5-9	physical association	0.720	6
KRTAP1-3	physical association	0.700	5

BioGRID (397 interactions; top human partners by supporting records): PRKAA1 (Two-hybrid; 17 records), PRKAG1 (Two-hybrid; 16 records), PRKAA2 (Two-hybrid; 15 records), PRKAG2 (Affinity Capture-MS; 12 records), PRKAG3 (Affinity Capture-MS; 6 records), GET4 (Two-hybrid; 5 records), IKZF3 (Two-hybrid; 5 records), PRKAB1 (Affinity Capture-MS; 5 records), CCDC33 (Two-hybrid; 4 records), DCLRE1C (Affinity Capture-MS; 4 records), GATA1 (Two-hybrid; 4 records), GOLGA2 (Two-hybrid; 4 records), KLF15 (Two-hybrid; 4 records), MDFI (Two-hybrid; 4 records), PSMD11 (Two-hybrid; 4 records)

SIGNOR signaling

1 signaling interactions:

A	Effect	B	Mechanism
PRKAB2	“form complex”	AMPK	binding

Protein complexes (CORUM) (4)

Experimentally-characterized complexes this protein is a subunit of (★ = the complex contains a known drug target).

4 complexes by size:

Complex	Subunits	Members
★ AMPK (PRKAA1; PRKAB2; PRKAG3)	3	PRKAA1, PRKAB2, PRKAG3
AMPK (PRKAA2; PRKAB2; PRKAG3)	3	PRKAA2, PRKAB2, PRKAG3
★ AMPK (PRKAA1; PRKAB2; PRKAG1)	3	PRKAA1, PRKAB2, PRKAG1
AMPK (PRKAA2; PRKAB2; PRKAG1)	3	PRKAA2, PRKAB2, PRKAG1

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 186 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Energy dependent regulation of mTOR by LKB1-AMPK	6	21.1×	2e-05
Activation of AMPK downstream of NMDARs	6	20.4×	2e-05
MTOR signalling	7	16.6×	2e-05
Selective autophagy	5	12.4×	2e-03
AMPK-induced ERAD and lysosome mediated degradation of PD-L1(CD274)	7	12.1×	8e-05
Regulation of TP53 Activity	10	11.9×	2e-06
Post NMDA receptor activation events	6	10.9×	7e-04
TP53 Regulates Metabolic Genes	9	10.4×	2e-05

GO biological processes:

GO term	Partners	Fold	FDR
cellular response to nutrient levels	6	17.8×	6e-04
positive regulation of epidermal growth factor receptor signaling pathway	5	15.7×	3e-03
fatty acid biosynthetic process	6	13.3×	2e-03
cellular response to glucose starvation	6	12.8×	2e-03
negative regulation of apoptotic process	15	3.3×	6e-03

Disease & clinical

Genetic variants

Variant evidence for PRKAB2: 27 ClinVar records (3 pathogenic / likely pathogenic). Per-variant detail is on Sugi Variant.

ClinVar

27 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	3
Likely pathogenic	0
Uncertain significance	16
Likely benign	0
Benign	1

Top pathogenic / likely-pathogenic (3)

Showing all 3 pathogenic / likely-pathogenic ClinVar records, ranked by ClinVar review status (expert panel → multiple submitters → single submitter), then by number of submitting labs.

Variant ID	HGVS	Classification	Review	Submitters
565175	GRCh37/hg19 1q21.1-21.2(chr1:146470887-147845170)x1	Pathogenic	no assertion criteria provided	1
1708187	GRCh37/hg19 1q21.1-21.2(chr1:146105170-147830830)x1	Pathogenic	no assertion criteria provided	1
1708199	GRCh37/hg19 1q21.1-21.2(chr1:145157447-148016122)x1	Pathogenic	no assertion criteria provided	1

Per-variant reference — Sugi Variant

Explore PRKAB2’s pathogenic and likely-pathogenic variants individually — each with its ClinVar classification and conditions, applied ACMG criteria (ClinGen expert panel, where curated), the calibrated in-silico predictors (AlphaMissense, REVEL, SaProt, conservation), gnomAD frequency, and the predictor-disagreement QC signal — on Sugi Variant.

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 30 predictions of 748):

Position(s)	Effect	Δscore	Sites
1:147161710–147161711	donor_loss	1.0000	2
1:147161781–147161782	acceptor_loss	1.0000	4
1:147166940–147166941	acceptor_loss	1.0000	6
1:147171987–147171988	donor_loss	1.0000	3
1:147159482	donor_gain	0.9900
1:147161710–147161711	donor_loss	0.9900	3
1:147161781–147161782	acceptor_loss	0.9900	2
1:147166844–147166845	donor_loss	0.9900	5
1:147171987	donor_loss	0.9900
1:147162438–147162439	donor_loss	0.9800	3

AlphaMissense

860 missense substitutions predicted likely pathogenic (of 1,805 scored), across 175 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
M237	9	0.974	0.999
M251	9	0.904	0.999
H240	8	1.000	1.000
N218	8	0.998	1.000
H235	8	0.998	1.000
N151	8	0.987	1.000
D159	8	0.986	0.995
D169	8	0.981	0.991
F96	8	0.976	0.999
D226	8	0.975	0.998
N239	8	0.966	1.000
H211	8	0.962	0.999
D248	8	0.962	0.997
S254	8	0.962	1.000
F163	8	0.958	0.993
D130	8	0.953	0.998
S108	8	0.944	0.997
H123	8	0.941	0.999
F160	8	0.938	0.996
D220	8	0.934	0.983

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

3 prognostic cancer types:

Cancer	Prognostic	p-value
Kidney Renal Clear Cell Carcinoma (validation)	favorable	0.000228
Thyroid Carcinoma (TCGA)	unfavorable	0.000439
Breast Invasive Carcinoma (TCGA)	unfavorable	0.000791

Disease associations

OMIM: gene MIM:602741 | disease phenotypes:

GenCC curated gene-disease

1 curated gene-disease records:

Disease	Classification	Inheritance	Records
congenital heart disease	Disputed Evidence	Unknown

ClinGen Gene-Disease Validity

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

1 validity classifications:

Disease	Classification	Inheritance
congenital heart disease	Disputed	UD

Mondo (1): congenital heart disease (MONDO:0005453)

MeSH disease descriptors

1 disease descriptors:

Descriptor	Name	Tree numbers
D006330	Heart Defects, Congenital	C14.240.400; C14.280.400; C16.131.240.400

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (8): CHEMBL2096907 (PROTEIN COMPLEX GROUP), CHEMBL2117 (SINGLE PROTEIN), CHEMBL3038453 (PROTEIN COMPLEX), CHEMBL3038456 (PROTEIN COMPLEX), CHEMBL3038457 (PROTEIN COMPLEX), CHEMBL4106158 (PROTEIN COMPLEX), CHEMBL4106162 (PROTEIN COMPLEX), CHEMBL4106163 (PROTEIN COMPLEX)

Drugs acting on a complex or family that includes this protein

Curated ChEMBL mechanism-of-action drugs whose target is a protein complex or family of ≤10 members that includes PRKAB2 — the drug acts on the assembly or class, not necessarily on this subunit alone.

1 drugs via a complex or family:

Drug	Target (ChEMBL)	Members	Max phase
ACADESINE	AMP-activated protein kinase, AMPK	7	3

Molecules with ChEMBL bioactivity

Phase ≥1, by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 166,420 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

2 molecules by phase:

Molecule	Name	Phase	Patents
CHEMBL752	ADENOSINE PHOSPHATE	4	166,120
CHEMBL3115681	NARAZACICLIB	2	300

PharmGKB: 1 entry (CPIC guideline: no)

PharmGKB variant annotations

Per-publication pharmacogenomic findings for this gene (significant associations).

2 published findings:

Variant	Drug(s)	Category	Finding	PMID
rs3766522	antipsychotics, clozapine, olanzapine	Toxicity	Genotype TT is associated with decreased severity of Weight gain when treated with antipsychotics, clozapine or olanzapine in people with schizoaffective disorder or Schizophrenia as compared to genotypes AA + AT.	PMID:22305490
rs7541245	metformin	Efficacy	Allele A is associated with decreased response to metformin in people with Diabetes Mellitus, Type 2 as compared to allele C.	PMID:25991289

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: enzyme — AMPK subfamily

Most potent curated ligand interactions (1 total), top 1:

Ligand	Action	Affinity	Parameter
MT47-100	Negative	4.61	pKi

Binding affinities (BindingDB)

10 measured of 11 human assays (13 total across all organisms); most potent 10 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value	Patent
6-chloro-5-[4-(1-hydroxycyclobutyl)phenyl]-1H-indole-3-carboxylic acid	EC50	1.9 nM	US-9394285: Indole and indazole compounds that activate AMPK
CHEMBL4082745	EC50	8 nM
CHEMBL3957286	EC50	11 nM
6-chloro-5-[6-(dimethylamino)-2-methoxy-3-pyridinyl]-1H-indole-3-carboxylic acid	EC50	11.7 nM	US-9394285: Indole and indazole compounds that activate AMPK
CHEMBL4105032	EC50	22 nM
CHEMBL4249790	EC50	38 nM
CHEMBL4246000	EC50	59 nM
CHEMBL4250253	EC50	76 nM
CHEMBL5191686	EC50	1300 nM
CHEMBL5653589	KD	1440 nM

ChEMBL bioactivities

407 potent at pChembl≥5 of 457 total, top 50 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
9.30	EC50	0.5	nM	CHEMBL3986249
9.00	EC50	1	nM	CHEMBL4167177
9.00	EC50	1	nM	CHEMBL5179319
9.00	EC50	1	nM	CHEMBL5181529
9.00	EC50	1	nM	CHEMBL5183763
9.00	IC50	1	nM	CHEMBL5183579
8.77	EC50	1.7	nM	CHEMBL3975011
8.74	EC50	1.8	nM	CHEMBL3923669
8.70	EC50	2	nM	CHEMBL3957286
8.70	EC50	2	nM	CHEMBL4111692
8.70	EC50	2	nM	CHEMBL5194054
8.70	EC50	2	nM	CHEMBL5180431
8.64	EC50	2.3	nM	CHEMBL3953722
8.62	EC50	2.4	nM	CHEMBL3893781
8.59	EC50	2.602	nM	CHEMBL3970868
8.55	IC50	2.82	nM	CHEMBL3393137
8.54	EC50	2.9	nM	CHEMBL4107500
8.52	EC50	3	nM	CHEMBL5174868
8.40	EC50	4	nM	CHEMBL3957286
8.40	EC50	4	nM	CHEMBL5203262
8.38	EC50	4.2	nM	CHEMBL3891221
8.38	Ki	4.2	nM	CHEMBL1908392
8.37	EC50	4.3	nM	CHEMBL3979636
8.37	EC50	4.3	nM	CHEMBL3959268
8.35	EC50	4.5	nM	CHEMBL4648182
8.33	EC50	4.7	nM	CHEMBL4645351
8.31	Ki	4.9	nM	CHEMBL4089284
8.30	EC50	5	nM	CHEMBL5186795
8.25	EC50	5.6	nM	CHEMBL4111958
8.22	EC50	6	nM	CHEMBL5190451
8.22	EC50	6	nM	CHEMBL5183579
8.21	EC50	6.2	nM	CHEMBL3908241
8.20	EC50	6.3	nM	CHEMBL1688230
8.19	EC50	6.5	nM	CHEMBL3915611
8.18	EC50	6.56	nM	CHEMBL3980011
8.16	EC50	6.9	nM	CHEMBL3918798
8.15	EC50	7.1	nM	CHEMBL3894523
8.15	EC50	7.063	nM	CHEMBL3898048
8.15	IC50	7	nM	CHEMBL5179319
8.11	EC50	7.8	nM	CHEMBL3953722
8.10	EC50	7.9	nM	CHEMBL4636831
8.10	IC50	8	nM	CHEMBL5203450
8.08	EC50	8.3	nM	CHEMBL3936111
8.08	EC50	8.328	nM	CHEMBL3975761
8.05	EC50	9	nM	CHEMBL5205646
8.05	EC50	9	nM	CHEMBL5202027
8.04	Ki	9.2	nM	CHEMBL4062168
8.03	EC50	9.3	nM	CHEMBL4109075
8.03	EC50	9.33	nM	CHEMBL4109075
8.02	EC50	9.6	nM	CHEMBL3960657

PubChem BioAssay actives

179 with measured affinity, of 1204 total; 50 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
N-[1-[(4-cyanophenyl)methyl]piperidin-4-yl]-5-[4-[(4-fluorophenyl)methyl]piperazine-1-carbonyl]pyridine-2-carboxamide	1855898: Activation of AMPK in human HepG2 cells assessed as increase in ACC phosphorylation at Ser79 incubated for 1 hr	ec50	0.0010	uM
N-[1-[(4-cyanophenyl)methyl]piperidin-4-yl]-5-[4-[fluoro-(4-fluorophenyl)methyl]piperidine-1-carbonyl]pyridine-2-carboxamide	1855899: Activation of AMPK in human HepG2 cells assessed as reduction in mitochondrial ATP production incubated for 1 hr	ic50	0.0010	uM
N-[1-[(4-cyanophenyl)methyl]piperidin-4-yl]-5-[4-[(4-fluorophenyl)methyl]-3,3-dimethylpiperazine-1-carbonyl]pyridine-2-carboxamide	1855898: Activation of AMPK in human HepG2 cells assessed as increase in ACC phosphorylation at Ser79 incubated for 1 hr	ec50	0.0010	uM
N-[1-[(4-cyanophenyl)methyl]piperidin-4-yl]-5-[4-[(4-methoxyphenyl)methyl]piperidine-1-carbonyl]pyridine-2-carboxamide	1855898: Activation of AMPK in human HepG2 cells assessed as increase in ACC phosphorylation at Ser79 incubated for 1 hr	ec50	0.0010	uM
(3R,3aR,6R,6aR)-6-[[6-chloro-5-(4-phenylphenyl)-1H-imidazo[4,5-b]pyridin-2-yl]oxy]-2,3,3a,5,6,6a-hexahydrofuro[3,2-b]furan-3-ol	1552802: Activation of recombinant human AMPK expressed in Sf9 cells using SAMS peptide as substrate preincubated for 30 mins followed by substrate addition and measured after 60 mins by fluorescence based assay	ec50	0.0010	uM
2-[4-[2-[[(3R,3aR,6R,6aR)-3-hydroxy-2,3,3a,5,6,6a-hexahydrofuro[3,2-b]furan-6-yl]oxy]-6-chloro-1H-benzimidazol-5-yl]phenyl]benzene-1,3-diol	1320700: Activation of human recombinant AMPK alpha2/beta2/gamma1 expressed in African green monkey COS7 cells assessed as increase in biotinylated AAC (1 to 120 residues) peptide phosphorylation at Ser-79 residue measured after 60 mins by Alphascreen assay	ec50	0.0020	uM
N-[1-[(4-cyanophenyl)methyl]piperidin-4-yl]-5-[4-fluoro-4-(4-fluorobenzoyl)piperidine-1-carbonyl]pyridine-2-carboxamide	1855898: Activation of AMPK in human HepG2 cells assessed as increase in ACC phosphorylation at Ser79 incubated for 1 hr	ec50	0.0020	uM
N-[1-[(4-cyanophenyl)methyl]piperidin-4-yl]-5-[4-(4-fluorobenzoyl)piperidine-1-carbonyl]pyridine-2-carboxamide	1855898: Activation of AMPK in human HepG2 cells assessed as increase in ACC phosphorylation at Ser79 incubated for 1 hr	ec50	0.0020	uM
N-[1-[(4-cyanophenyl)methyl]piperidin-4-yl]-6-[4-(4-methoxybenzoyl)piperidine-1-carbonyl]pyridine-3-carboxamide	1855899: Activation of AMPK in human HepG2 cells assessed as reduction in mitochondrial ATP production incubated for 1 hr	ic50	0.0028	uM
5-[4-(4-cyanophenoxy)piperidine-1-carbonyl]-N-[1-[(4-cyanophenyl)methyl]piperidin-4-yl]pyridine-2-carboxamide	1855898: Activation of AMPK in human HepG2 cells assessed as increase in ACC phosphorylation at Ser79 incubated for 1 hr	ec50	0.0030	uM
N-[1-[(4-cyanophenyl)methyl]piperidin-4-yl]-5-[4-(2,4-difluorophenoxy)piperidine-1-carbonyl]pyridine-2-carboxamide	1855898: Activation of AMPK in human HepG2 cells assessed as increase in ACC phosphorylation at Ser79 incubated for 1 hr	ec50	0.0040	uM
N-[4-[[(2-hydroxy-1H-indol-3-yl)-phenylmethylidene]amino]phenyl]-N-methyl-2-(4-methylpiperazin-1-yl)acetamide	1474638: Inhibition of AMPK (unknown origin) using SAMS peptide as substrate measured after 30 mins in presence of [gamma32P]ATP by liquid scintillation counting method	ki	0.0042	uM
[4-[5-[1-[(6-methoxy-3-pyridinyl)methyl]piperidin-4-yl]-1,3,4-oxadiazol-2-yl]phenyl]-[4-[[4-(trifluoromethyl)phenyl]methyl]piperazin-1-yl]methanone;bis(4-methylbenzenesulfonic acid)	1666796: Activation of AMPK in human MDA-MB-435 cells measured after 2 hrs by anti-phospho-Acetyl-CoA Carboxylase (Ser79) antibody-based ELISA	ec50	0.0045	uM
4-[(4-methoxyphenyl)methyl]-N-[4-[4-[[4-(trifluoromethyl)phenyl]methyl]piperazine-1-carbonyl]phenyl]piperazine-1-carboxamide	1666796: Activation of AMPK in human MDA-MB-435 cells measured after 2 hrs by anti-phospho-Acetyl-CoA Carboxylase (Ser79) antibody-based ELISA	ec50	0.0047	uM
2-hydroxy-3-[N-[4-[methyl-[2-(4-methylpiperazin-1-yl)acetyl]amino]phenyl]-C-phenylcarbonimidoyl]-1H-indole-5-carboxylic acid	1474638: Inhibition of AMPK (unknown origin) using SAMS peptide as substrate measured after 30 mins in presence of [gamma32P]ATP by liquid scintillation counting method	ki	0.0049	uM
5-[4-(4-cyanobenzoyl)piperidine-1-carbonyl]-N-[1-[(4-cyanophenyl)methyl]piperidin-4-yl]pyridine-2-carboxamide	1855898: Activation of AMPK in human HepG2 cells assessed as increase in ACC phosphorylation at Ser79 incubated for 1 hr	ec50	0.0050	uM
N-[1-[(4-cyanophenyl)methyl]piperidin-4-yl]-5-[4-[2-(4-fluorophenyl)propan-2-yl]piperazine-1-carbonyl]pyridine-2-carboxamide	1855898: Activation of AMPK in human HepG2 cells assessed as increase in ACC phosphorylation at Ser79 incubated for 1 hr	ec50	0.0060	uM
bis(N-cyclohexylcyclohexanamine);[5-(5-oxo-2H-1,2-oxazol-3-yl)furan-2-yl]phosphonic acid	580978: Activation of human AMPK after 15 mins	ec50	0.0063	uM
4-[[4-(trifluoromethyl)phenyl]methyl]-N-[4-[4-[[4-(trifluoromethyl)phenyl]methyl]piperazine-1-carbonyl]phenyl]piperazine-1-carboxamide	1666796: Activation of AMPK in human MDA-MB-435 cells measured after 2 hrs by anti-phospho-Acetyl-CoA Carboxylase (Ser79) antibody-based ELISA	ec50	0.0079	uM
N-[1-[(4-cyanophenyl)methyl]piperidin-4-yl]-5-[4-(2,4-difluorobenzoyl)piperidine-1-carbonyl]pyridine-2-carboxamide	1855899: Activation of AMPK in human HepG2 cells assessed as reduction in mitochondrial ATP production incubated for 1 hr	ic50	0.0080	uM
6-[4-(4-methoxybenzoyl)piperidine-1-carbonyl]-N-[1-[[4-(trifluoromethoxy)phenyl]methyl]piperidin-4-yl]pyridine-3-carboxamide	1855898: Activation of AMPK in human HepG2 cells assessed as increase in ACC phosphorylation at Ser79 incubated for 1 hr	ec50	0.0090	uM
6-[4-(4-pyrrolidin-1-ylbenzoyl)piperidine-1-carbonyl]-N-[1-[[4-(trifluoromethoxy)phenyl]methyl]piperidin-4-yl]pyridine-3-carboxamide	1855898: Activation of AMPK in human HepG2 cells assessed as increase in ACC phosphorylation at Ser79 incubated for 1 hr	ec50	0.0090	uM
methyl 2-hydroxy-3-[N-[4-[methyl-[2-(4-methylpiperazin-1-yl)acetyl]amino]phenyl]-C-phenylcarbonimidoyl]-1H-indole-5-carboxylate	1474638: Inhibition of AMPK (unknown origin) using SAMS peptide as substrate measured after 30 mins in presence of [gamma32P]ATP by liquid scintillation counting method	ki	0.0092	uM
4-methyl-3-[(2-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2149069: Binding affinity to human PRKAB2 incubated for 45 mins by Kinobead based pull down assay	kd	0.0101	uM
1-[(4-methoxyphenyl)methyl]-N-[4-[4-[[4-(trifluoromethyl)phenyl]methyl]piperazine-1-carbonyl]phenyl]piperidine-4-carboxamide;dihydrochloride	1666796: Activation of AMPK in human MDA-MB-435 cells measured after 2 hrs by anti-phospho-Acetyl-CoA Carboxylase (Ser79) antibody-based ELISA	ec50	0.0110	uM
N-[1-[(4-cyanophenyl)methyl]piperidin-4-yl]-5-[4-(4-methoxyphenoxy)piperidine-1-carbonyl]pyridine-2-carboxamide	1855898: Activation of AMPK in human HepG2 cells assessed as increase in ACC phosphorylation at Ser79 incubated for 1 hr	ec50	0.0110	uM
1-[(6-methoxy-3-pyridinyl)methyl]-N-[4-[4-[[4-(trifluoromethyl)phenyl]methyl]piperazine-1-carbonyl]phenyl]piperidine-4-carboxamide	1666796: Activation of AMPK in human MDA-MB-435 cells measured after 2 hrs by anti-phospho-Acetyl-CoA Carboxylase (Ser79) antibody-based ELISA	ec50	0.0120	uM
N-[1-[(4-fluorophenyl)methyl]piperidin-4-yl]-6-[4-(4-pyrrolidin-1-ylbenzoyl)piperidine-1-carbonyl]pyridine-3-carboxamide	1855898: Activation of AMPK in human HepG2 cells assessed as increase in ACC phosphorylation at Ser79 incubated for 1 hr	ec50	0.0120	uM
N-[1-[(4-cyanophenyl)methyl]piperidin-4-yl]-6-[4-(2,4-difluorophenoxy)piperidine-1-carbonyl]pyridine-3-carboxamide	1855898: Activation of AMPK in human HepG2 cells assessed as increase in ACC phosphorylation at Ser79 incubated for 1 hr	ec50	0.0130	uM
5-[4-[(4-cyanophenyl)methyl]piperidine-1-carbonyl]-N-[1-[(4-cyanophenyl)methyl]piperidin-4-yl]pyridine-2-carboxamide	1855898: Activation of AMPK in human HepG2 cells assessed as increase in ACC phosphorylation at Ser79 incubated for 1 hr	ec50	0.0140	uM
2-[[5-[1-[(4-fluorophenyl)methyl]-3,6-dihydro-2H-pyridin-4-yl]-6-methyl-2-pyridinyl]oxymethyl]-3,5-dimethyl-1H-pyridin-4-one	1666796: Activation of AMPK in human MDA-MB-435 cells measured after 2 hrs by anti-phospho-Acetyl-CoA Carboxylase (Ser79) antibody-based ELISA	ec50	0.0160	uM
5-(4-benzylpiperazine-1-carbonyl)-N-(1-benzylpiperidin-4-yl)pyridine-2-carboxamide	1855898: Activation of AMPK in human HepG2 cells assessed as increase in ACC phosphorylation at Ser79 incubated for 1 hr	ec50	0.0160	uM
[6-[1-[(6-methoxy-3-pyridinyl)methyl]piperidin-4-yl]-1H-benzimidazol-2-yl]-[4-[[4-(trifluoromethyl)phenyl]methyl]piperazin-1-yl]methanone;bis(4-methylbenzenesulfonic acid)	1666796: Activation of AMPK in human MDA-MB-435 cells measured after 2 hrs by anti-phospho-Acetyl-CoA Carboxylase (Ser79) antibody-based ELISA	ec50	0.0180	uM
N-[1-[(4-cyanophenyl)methyl]piperidin-4-yl]-6-[4-(2,4-difluorobenzoyl)piperidine-1-carbonyl]pyridine-3-carboxamide	1855898: Activation of AMPK in human HepG2 cells assessed as increase in ACC phosphorylation at Ser79 incubated for 1 hr	ec50	0.0180	uM
[6-[1-[(6-methoxy-3-pyridinyl)methyl]piperidin-4-yl]-1H-benzimidazol-2-yl]-[4-[[4-(trifluoromethyl)phenyl]methyl]piperazin-1-yl]methanone	1866092: Activation of AMPK (unknown origin)	ec50	0.0180	uM
(4R)-4-(3-chloro-2-fluorophenyl)-5-fluoro-2-(4-fluoro-1-methylpyrazol-3-yl)-4-methyl-6-[[1-(1-methyl-2-oxopiperidin-3-yl)azetidin-3-yl]amino]-3H-2,7-naphthyridin-1-one	2233536: Activation of human AMPK (alpha2/beta2/gamma3) transiently transfected in HEK293 cells assessed as phosphorylation at gamma3-Thr172 incubated for 20 mins by AlphaLISA assay	ec50	0.0198	uM
N-[1-[(4-cyanophenyl)methyl]piperidin-4-yl]-6-[4-(4-pyrrolidin-1-ylbenzoyl)piperidine-1-carbonyl]pyridine-3-carboxamide	1855898: Activation of AMPK in human HepG2 cells assessed as increase in ACC phosphorylation at Ser79 incubated for 1 hr	ec50	0.0200	uM
N-[1-[(4-fluorophenyl)methyl]piperidin-4-yl]-6-[4-(4-pyrazol-1-ylbenzoyl)piperidine-1-carbonyl]pyridine-3-carboxamide	1855898: Activation of AMPK in human HepG2 cells assessed as increase in ACC phosphorylation at Ser79 incubated for 1 hr	ec50	0.0210	uM
(4R)-4-(3-chloro-2-fluorophenyl)-6-[[1-[(2S)-2-cyclopropyl-2-hydroxypropanoyl]azetidin-3-yl]amino]-5-fluoro-2-(4-fluoro-1-methylpyrazol-3-yl)-4-methyl-3H-2,7-naphthyridin-1-one	2233536: Activation of human AMPK (alpha2/beta2/gamma3) transiently transfected in HEK293 cells assessed as phosphorylation at gamma3-Thr172 incubated for 20 mins by AlphaLISA assay	ec50	0.0213	uM
4-[(4-methoxyphenyl)methyl]-N-[3-[4-[[4-(trifluoromethyl)phenyl]methyl]piperazine-1-carbonyl]phenyl]piperazine-1-carboxamide;dihydrochloride	1666796: Activation of AMPK in human MDA-MB-435 cells measured after 2 hrs by anti-phospho-Acetyl-CoA Carboxylase (Ser79) antibody-based ELISA	ec50	0.0220	uM
4-[(4-fluorophenyl)methyl]-N-[4-[4-[[4-(trifluoromethyl)phenyl]methyl]piperazine-1-carbonyl]phenyl]piperazine-1-carboxamide	1666796: Activation of AMPK in human MDA-MB-435 cells measured after 2 hrs by anti-phospho-Acetyl-CoA Carboxylase (Ser79) antibody-based ELISA	ec50	0.0220	uM
5-[[6-chloro-5-(4-phenylphenyl)-1H-benzimidazol-2-yl]oxy]-2-methylbenzoic acid	1471599: Agonist activity at human recombinant phosphorylated AMPK complex 11 alpha2/beta2/gamma2 expressed in baculovirus infected Sf21 cells assessed as phosphorylation of 5-FAM-labeled SAMS substrate preincubated for 30 mins in presence of AMPK activator followed by substrate addition measured after 60 mins	ec50	0.0230	uM
(4R)-4-(3-chloro-2-fluorophenyl)-2-[4-(difluoromethoxy)-2-pyridinyl]-5-fluoro-6-[[1-[(1S,2S)-2-fluorocyclopropanecarbonyl]azetidin-3-yl]amino]-4-methyl-3H-2,7-naphthyridin-1-one	2233536: Activation of human AMPK (alpha2/beta2/gamma3) transiently transfected in HEK293 cells assessed as phosphorylation at gamma3-Thr172 incubated for 20 mins by AlphaLISA assay	ec50	0.0240	uM
4-benzyl-N-[4-[4-[[4-(trifluoromethyl)phenyl]methyl]piperazine-1-carbonyl]phenyl]piperazine-1-carboxamide	1666796: Activation of AMPK in human MDA-MB-435 cells measured after 2 hrs by anti-phospho-Acetyl-CoA Carboxylase (Ser79) antibody-based ELISA	ec50	0.0270	uM
N-[1-[(4-fluorophenyl)methyl]piperidin-4-yl]-6-[4-(4-methoxybenzoyl)piperidine-1-carbonyl]pyridine-3-carboxamide	1855898: Activation of AMPK in human HepG2 cells assessed as increase in ACC phosphorylation at Ser79 incubated for 1 hr	ec50	0.0270	uM
4-(3-chloro-2-fluorophenyl)-5-fluoro-2-(4-fluoro-1-methylpyrazol-3-yl)-4-methyl-6-[[1-[(3S)-2-oxopiperidin-3-yl]azetidin-3-yl]amino]-3H-2,7-naphthyridin-1-one	2233536: Activation of human AMPK (alpha2/beta2/gamma3) transiently transfected in HEK293 cells assessed as phosphorylation at gamma3-Thr172 incubated for 20 mins by AlphaLISA assay	ec50	0.0272	uM
4-(3-chloro-2,4-difluorophenyl)-5-fluoro-2-[5-(hydroxymethyl)-2-pyridinyl]-4-methyl-6-[[1-[(1S,4S)-2-oxa-5-azabicyclo[2.2.1]heptane-5-carbonyl]azetidin-3-yl]amino]-3H-2,7-naphthyridin-1-one	2233536: Activation of human AMPK (alpha2/beta2/gamma3) transiently transfected in HEK293 cells assessed as phosphorylation at gamma3-Thr172 incubated for 20 mins by AlphaLISA assay	ec50	0.0275	uM
(4R)-4-(3-chloro-2-fluorophenyl)-5-fluoro-6-[[1-[(1S,2S)-2-fluorocyclopropanecarbonyl]azetidin-3-yl]amino]-2-(4-fluoro-1-methylpyrazol-3-yl)-4-methyl-3H-2,7-naphthyridin-1-one	2233536: Activation of human AMPK (alpha2/beta2/gamma3) transiently transfected in HEK293 cells assessed as phosphorylation at gamma3-Thr172 incubated for 20 mins by AlphaLISA assay	ec50	0.0299	uM
4-methyl-3-[(1-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2149069: Binding affinity to human PRKAB2 incubated for 45 mins by Kinobead based pull down assay	kd	0.0317	uM
(4R)-4-(3-chloro-2-fluorophenyl)-5-fluoro-2-(3-fluoro-2-pyridinyl)-6-[[1-(1-hydroxycyclopropanecarbonyl)azetidin-3-yl]amino]-4-methyl-3H-2,7-naphthyridin-1-one	2233536: Activation of human AMPK (alpha2/beta2/gamma3) transiently transfected in HEK293 cells assessed as phosphorylation at gamma3-Thr172 incubated for 20 mins by AlphaLISA assay	ec50	0.0336	uM

CTD chemical–gene interactions

60 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	decreases expression, affects cotreatment, increases abundance, increases expression	5
Benzo(a)pyrene	decreases expression, increases methylation	2
Tetrachlorodibenzodioxin	decreases expression	2
Valproic Acid	decreases expression, affects expression	2
Cyclosporine	decreases expression, increases expression	2
Cadmium Chloride	decreases expression	2
FR900359	increases phosphorylation	1
testosterone enanthate	affects expression	1
chloroacetaldehyde	decreases expression	1
methylmercuric chloride	increases expression	1
triphenyl phosphate	affects expression	1
tris(1,3-dichloro-2-propyl)phosphate	increases expression	1
nickel sulfate	decreases expression	1
coumarin	affects phosphorylation	1
phenethyl isothiocyanate	increases expression	1
di-n-butylphosphoric acid	affects expression	1
adefovir dipivoxil	decreases expression	1
nutlin 3	affects cotreatment, increases expression	1
2,2’,4,4’-tetrabromodiphenyl ether	increases expression	1
jinfukang	decreases expression	1
NSC 689534	affects binding, increases expression	1
Sunitinib	increases expression	1
Zoledronic Acid	decreases expression	1
Leflunomide	decreases expression	1
Cidofovir	decreases expression	1
Acetaminophen	decreases expression	1
Air Pollutants	increases abundance, increases expression	1
Arsenic	affects cotreatment, increases abundance, increases expression	1
Caffeine	decreases phosphorylation	1
Carbamazepine	affects expression	1

ChEMBL screening assays

322 unique, capped per target: 321 binding, 1 functional

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1053698	Binding	Induction of AMPK phosphorylation in human HepG2 cells by Western blot analysis in presence of 33 mM glucose	Palbinone and triterpenes from Moutan Cortex (Paeonia suffruticosa, Paeoniaceae) stimulate glucose uptake and glycogen synthesis via activation of AMPK in insulin-resistant human HepG2 Cells. — *Bioorg Med Chem Lett*
CHEMBL4649950	Functional	AMP-dependent Kinase enzyme assay. An in vitro enzyme assay that detects ADP turnover that is directly proportional to AMPK activity. This uses naive AMPK that is activated during the assay with MK-8722	University of Dundee, Small-Polar-MMV Screening Library

Cellosaurus cell lines

6 cell lines: 5 cancer cell line, 1 transformed cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_D7YC	Ubigene A-549 PRKAB2 KO	Cancer cell line	Male
CVCL_D8TT	Ubigene HCT 116 PRKAB2 KO	Cancer cell line	Male
CVCL_D9PF	Ubigene HEK293 PRKAB2 KO	Transformed cell line	Female
CVCL_E0LR	Ubigene HeLa PRKAB2 KO	Cancer cell line	Female
CVCL_TG68	HAP1 PRKAB2 (-) 1	Cancer cell line	Male
CVCL_TG69	HAP1 PRKAB2 (-) 2	Cancer cell line	Male

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

showing 60 of 300 trials:

NCT	Phase	Status	Title
NCT00668824	Phase 4	UNKNOWN	Improved Diagnosis of Congenital Heart Disease by Magnetic Resonance Imaging Using Vasovist
NCT01368705	Phase 4	COMPLETED	Nitrogen Balance in Infants After Post Cardiothoracic Surgery
NCT01619982	Phase 4	COMPLETED	Pre-operative Prophylaxis With Vancomycin and Cefazolin in Pediatric Cardiovascular Surgery Patients
NCT02122679	Phase 4	WITHDRAWN	Tranexamic Acid Effect on Platelet Aggregation Following Infant Cardiopulmonary Bypass
NCT02527811	Phase 4	UNKNOWN	Ulinastatin Injection in in Pediatric Patients Undergoing Open Heart Surgery
NCT03014700	Phase 4	COMPLETED	Fibrinogen Concentrate vs Cryoprecipitate
NCT03408340	Phase 4	TERMINATED	Paravertebral Nerve Blocks in Neonates
NCT03630796	Phase 4	UNKNOWN	Effect of Sevoflurane in Postoperative Troponin I Levels in Children Undergoing Congenital Heart Defects Surgery
NCT03667703	Phase 4	COMPLETED	Stress Ulcer Prophylaxis Versus Placebo in Critically Ill Infants With Congenital Heart Disease
NCT04453761	Phase 4	UNKNOWN	Thiamine Influenced on Substrate Energy Effectiveness in Indonesian Children Undergoing Cardiopulmonary Bypass
NCT06668389	Phase 4	RECRUITING	Sodium-Glucose Cotransporter 2 Inhibitors for Repaired Tetralogy of Fallot Patients for Enhancement of Cardio-Pulmonary Status Trial
NCT07499154	Phase 4	NOT_YET_RECRUITING	Perioperative Lidocaine for Lung Protection in Infants Undergoing Cardiac Surgery
NCT00000470	Phase 3	COMPLETED	Infant Heart Surgery: Central Nervous System Sequelae of Circulatory Arrest
NCT00000494	Phase 3	COMPLETED	Management of Patent Ductus in Premature Infants
NCT01134302	Phase 3	UNKNOWN	Hybrid Versus Norwood Management Strategies in Infants Undergoing Single Ventricle Palliation
NCT01607983	Phase 3	WITHDRAWN	Effects of Pulmonary Vasodilation Upon VA Coupling in Fontan Patients
NCT01662011	Phase 3	UNKNOWN	Application of Neurally Adjusted Ventilatory Assist to Children After Congenital Cardiac Surgery
NCT02320669	Phase 3	COMPLETED	Phase 3 Triiodothyronine Supplementation for Infants After Cardiopulmonary Bypass
NCT02615262	Phase 3	COMPLETED	Intraoperative Dexamethasone in Pediatric Cardiac Surgery
NCT03153137	Phase 3	COMPLETED	Clinical Study Assessing the Efficacy and Safety of Macitentan in Fontan-palliated Subjects
NCT03154476	Phase 3	COMPLETED	Role of Sildenafil for Fontan Associated Liver Disease (SiFALD) Study
NCT04536194	Phase 3	COMPLETED	Dopamine Versus Norepinephrine Under General Anesthesia
NCT04702373	Phase 3	UNKNOWN	Training in Exercise Activities and Motion for Growth (TEAM 4 Growth) RCT
NCT05049590	Phase 3	COMPLETED	Acute Normovolemic Hemodilution in Complex Cardiac Surgery
NCT06406517	Phase 3	UNKNOWN	Comparative Effectiveness of Gadopiclenol for Evaluation of Adult Congenital Heart Anatomy and Hemodynamics
NCT06693674	Phase 3	RECRUITING	Effect of Sacubitril-Valsartan on Cardiac Structure and Function
NCT06955260	Phase 3	RECRUITING	SGLT2 Inhibition With Empagliflozin in Fontan Circulatory Failure
NCT00115375	Phase 2	COMPLETED	Platelet Aggregation Inhibition in Children on Clopidogrel (PICOLO)
NCT00350220	Phase 2	COMPLETED	Transfusion Strategies in Pediatric Cardiothoracic Surgery
NCT00374088	Phase 2	COMPLETED	N-Acetylcysteine in Neonatal Congenital Heart Surgery (INACT Study)
NCT00538785	Phase 2	COMPLETED	A Study to Evaluate MEDI-524 In Children With Hemodynamically Significant Congenital Heart Disease
NCT00770705	Phase 2	WITHDRAWN	Parenteral Phenoxybenzamine During Congenital Heart Disease Surgery
NCT00919945	Phase 2	TERMINATED	Impact of Early Enteral Feeding on Splanchnic Blood Flow After Surgery for Critical Heart Disease in the Newborn
NCT01063712	Phase 2	COMPLETED	Safety and Effectiveness of the Device Nit-Occlud® PDA-R
NCT01069510	Phase 2	COMPLETED	Spironolactone in Adult Congenital Heart Disease
NCT01189981	Phase 2	COMPLETED	Effect of eHealth Encouragements to Intensive Exercise in Adolescents With Congenital Heart Disease
NCT01330433	Phase 2	COMPLETED	Effects of CoSeal on Bleeding & Adhesions in Pediatric Heart Surgery
NCT01662037	Phase 2	COMPLETED	Bosentan Therapy in Children With Functional Single Ventricle
NCT01668264	Phase 2	UNKNOWN	Imaging Assessment of Diastolic Function
NCT01827059	Phase 2	UNKNOWN	Bosentan In Exercise Induced Pulmonary Arterial Hypertension in CongenitaL Heart diseasE
NCT01841177	Phase 2	COMPLETED	Evaluating Precision of Therapy - Milrinone
NCT02046135	Phase 2	TERMINATED	Sodium Bicarbonate to Prevent Acute Kidney Injury in Children Undergoing Cardiac Surgery
NCT02133573	Phase 2	COMPLETED	Randomized Trial of Maternal Progesterone Therapy
NCT02232399	Phase 2	COMPLETED	Is Levosimendan Superior to Milrinone Regarding Acute Kidney Injury After Cardiac Surgery for Congenital Heart Disease?
NCT02492269	Phase 2	COMPLETED	Stress Response and Neurodevelopmental Outcome After Cardiac Surgery Utilizing CPB in Children: A Prospective, Double Blinded and Randomized Study
NCT02564796	Phase 2	TERMINATED	Erythropoietin to Prevent Unnecessary Transfusions In Patients With Cyanotic CHD - A Prospective Control Trial
NCT02618824	Phase 2	UNKNOWN	Role of Terminal Warm Blood Cardioplegia as Myocardial Protection in the Use of Histidine-Tryptophan-Ketoglutarate Cardioplegia in Complex Congenital Heart Surgery
NCT02769624	Phase 2	TERMINATED	Acute Effects of Inhaled Treprostinil in Fontan Patients
NCT02877238	Phase 2	COMPLETED	Remote Preconditioning and Myocardial Protection
NCT03082716	Phase 2	COMPLETED	Custodiol Versus Blood Cardioplegaia in Paediatric Cardiac Surgery
NCT03425734	Phase 2	UNKNOWN	The Effect of Dexmedetomidine on Kidney Perfusion in Paediatric Patients
NCT04434001	Phase 2	TERMINATED	ZEPLAST- PED: ZEro_PLASma Trial in Small Infants Undergoing Cardiac Surgery
NCT04807621	Phase 2	UNKNOWN	Platelets or Fibrinogen as First-line Treatment for Bleeding During Pedatric Heart Surgery
NCT05717049	Phase 2	COMPLETED	Theophylline Effects in the Fontan Circulation
NCT06080074	Phase 2	RECRUITING	Multicenter Trial of ECMO in Children With Severe Cardiac Failure Using the Cardiohelp System
NCT07498803	Phase 2	NOT_YET_RECRUITING	Sota-ES - Sotatercept in Patients With Congenital Heart Disease and Eisenmenger´s Syndrome
NCT01698567	Phase 1	TERMINATED	Antithrombin III in Infants With Cardiopulmonary Bypass (CPB)
NCT02549625	Phase 1	COMPLETED	Phase I Safety and Feasibility Study of Intracoronary Delivery of Autologous Bone Marrow Derived Mononuclear Cells
NCT03417999	Phase 1	TERMINATED	Pharmacokinetic Study of Intranasal Dexmedetomidine in Pediatric Patients With Congenital Heart Disease
NCT03946462	Phase 1	WITHDRAWN	Nitric Oxide During CPB to Reduce AKI in Neonates

Predicted chemistry — Sugi Predict

The predicted patent-compound landscape for PRKAB2 across ~30M SureChEMBL compounds — explore on Sugi Predict.