PRKCZ

Summary

PRKCZ (protein kinase C zeta, HGNC:9412) is a protein-coding gene on chromosome 1p36.33, encoding Protein kinase C zeta type (Q05513). Calcium- and diacylglycerol-independent serine/threonine-protein kinase that functions in phosphatidylinositol 3-kinase (PI3K) pathway and mitogen-activated protein (MAP) kinase cascade, and is involved in NF-kappa-B activation, mitogenic signaling, cell proliferation, cell pola….

Protein kinase C (PKC) zeta is a member of the PKC family of serine/threonine kinases which are involved in a variety of cellular processes such as proliferation, differentiation and secretion. Unlike the classical PKC isoenzymes which are calcium-dependent, PKC zeta exhibits a kinase activity which is independent of calcium and diacylglycerol but not of phosphatidylserine. Furthermore, it is insensitive to typical PKC inhibitors and cannot be activated by phorbol ester. Unlike the classical PKC isoenzymes, it has only a single zinc finger module. These structural and biochemical properties indicate that the zeta subspecies is related to, but distinct from other isoenzymes of PKC. Alternative splicing results in multiple transcript variants encoding different isoforms.

Source: NCBI Gene 5590 — RefSeq curated summary.

At a glance

• GWAS associations: 13
• Clinical variants (ClinVar): 29 total — 1 pathogenic
• GTEx eGene: eQTL in 20 tissues, sQTL in 10 (q < 0.05)
• Phenotypes (HPO): 99
• ChEMBL bioactivity: 16 clinical-phase molecules tested; no curated mechanism-of-action drug
• Constraint (gnomAD): pLI 0.05 (LoF-tolerant), LOEUF 0.58 (moderately constrained)
• MANE Select transcript: NM_002744

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:9412
Approved symbol	PRKCZ
Name	protein kinase C zeta
Location	1p36.33
Locus type	gene with protein product
Status	Approved
Aliases	PKC2
Ensembl gene	ENSG00000067606
Ensembl biotype	protein_coding
OMIM	176982
Entrez	5590

Gene structure

Transcript identifiers

Ensembl transcripts: 45 — 27 protein_coding, 10 nonsense_mediated_decay, 5 protein_coding_CDS_not_defined, 3 retained_intron

MANE Select: ENST00000378567

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 3, TSL 2: 7, TSL 3: 7, TSL 4: 6, TSL 5: 3

ENST00000378567, ENST00000400921, ENST00000419838, ENST00000461106, ENST00000461465, ENST00000466352, ENST00000466651, ENST00000468310, ENST00000470511, ENST00000470596, ENST00000470986, ENST00000471018, ENST00000472017, ENST00000478770, ENST00000479263, ENST00000479566, ENST00000481140, ENST00000482686, ENST00000484419, ENST00000486681, ENST00000495347, ENST00000496325, ENST00000497183, ENST00000503297, ENST00000503672, ENST00000505322, ENST00000877862, ENST00000877863, ENST00000877864, ENST00000926524, ENST00000965048, ENST00000974815, ENST00001012031, ENST00001012032, ENST00001012034, ENST00001012035, ENST00001012036, ENST00001012037, ENST00001012038, ENST00001012039, ENST00001070366, ENST00001070367, ENST00001105799, ENST00001117679, ENST00001145794

RefSeq mRNA: 8 — MANE Select: NM_002744 NM_001033581, NM_001033582, NM_001242874, NM_001350803, NM_001350804, NM_001350805, NM_001350806, NM_002744

CCDS: CCDS37, CCDS41229, CCDS55563

Canonical transcript exons

ENST00000378567 — 18 exons

Exon	Start	End
ENSE00002316473	2050411	2050701
ENSE00003481487	2172301	2172388
ENSE00003513439	2169518	2169604
ENSE00003525770	2155995	2156092
ENSE00003561737	2174754	2174833
ENSE00003563170	2055441	2055562
ENSE00003563212	2056484	2056573
ENSE00003609132	2175224	2175313
ENSE00003612876	2184583	2184698
ENSE00003626317	2184922	2185395
ENSE00003640274	2173897	2174016
ENSE00003653496	2135262	2135347
ENSE00003656964	2144210	2144341
ENSE00003659235	2172055	2172190
ENSE00003783979	2150790	2150978
ENSE00003784140	2146027	2146108
ENSE00003789547	2059541	2059591
ENSE00003791533	2148872	2148924

Expression profiles

Bgee: expression breadth ubiquitous, 242 present calls, max score 98.95.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 12.8181 / max 443.6639, expressed in 1177 samples.

Highest expression (Bgee): hemisphere of cerebellum, cerebellar hemisphere, middle temporal gyrus, cerebellar cortex, cerebellum.

Genetic regulation across tissues (GTEx eQTL / sQTL)

PRKCZ is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 20 tissues and its splicing (sQTL) in 10 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 30 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Thyroid	eqtl	5.3e-124	+0.93	1:2061538:G:T
Testis	sqtl	1.6e-62	-1.37	1:2181827:G:A
Skin Sun Exposed Lower leg	sqtl	1.6e-31	+0.64	1:2162307:G:T
Skin Not Sun Exposed Suprapubic	sqtl	1.1e-27	+0.68	1:2127141:G:C
Thyroid	sqtl	2.4e-20	-0.83	1:2061538:G:T
Lung	eqtl	3.6e-14	+0.19	1:2061538:G:T
Whole Blood	eqtl	1.3e-12	+0.17	1:2137041:C:T
Testis	eqtl	1.4e-12	+0.32	1:2111555:C:G
Liver	eqtl	3.0e-06	-0.36	1:2047418:A:G
Cells EBV-transformed lymphocytes	eqtl	3.6e-06	+0.44	1:2050397:C:T
Small Intestine Terminal Ileum	sqtl	1.8e-05	+0.74	1:2162307:G:T
Pituitary	eqtl	1.7e-03	-0.30	1:2071051:C:CACCTGGGCGTGTGACCTGGGCGTGTG
Stomach	sqtl	2.1e-03	-0.45	1:2210427:C:T
Brain Cortex	sqtl	2.9e-03	-0.54	1:2163759:T:C
Colon Sigmoid	sqtl	4.4e-03	-1.97	1:1167413:G:T
Brain Caudate basal ganglia	eqtl	5.6e-03	-0.10	1:2090659:G:A
Cells Cultured fibroblasts	eqtl	6.2e-03	+0.22	1:1176929:T:C
Brain Nucleus accumbens basal ganglia	eqtl	7.0e-03	-0.10	1:2089845:T:A
Brain Spinal cord cervical c-1	eqtl	1.2e-02	+0.21	1:2092065:T:C
Esophagus Mucosa	eqtl	1.6e-02	+0.24	1:2050574:C:T

FANTOM5 promoters

showing 10 of 18 alternative TSS:

Promoter ID	TPM avg	Samples expressed
165	3.7024	886
166	3.3058	174
164	1.5442	695
171	1.0432	123
167	1.0277	158
173	0.5630	93
174	0.5360	53
177	0.3245	155
168	0.2571	84
172	0.1718	70

Top tissues by expression

showing 100 of 284 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
right hemisphere of cerebellum	UBERON:0014890	98.95	gold quality
cerebellar hemisphere	UBERON:0002245	98.91	gold quality
middle temporal gyrus	UBERON:0002771	98.81	gold quality
cerebellar cortex	UBERON:0002129	98.78	gold quality
cerebellum	UBERON:0002037	98.51	gold quality
right frontal lobe	UBERON:0002810	98.21	gold quality
substantia nigra pars compacta	UBERON:0001965	98.10	gold quality
lateral nuclear group of thalamus	UBERON:0002736	98.02	gold quality
Brodmann (1909) area 9	UBERON:0013540	98.02	gold quality
prefrontal cortex	UBERON:0000451	97.88	gold quality
substantia nigra pars reticulata	UBERON:0001966	97.88	gold quality
Brodmann (1909) area 23	UBERON:0013554	97.81	gold quality
primary visual cortex	UBERON:0002436	97.75	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	97.50	gold quality
occipital lobe	UBERON:0002021	97.38	gold quality
frontal cortex	UBERON:0001870	97.25	gold quality
nucleus accumbens	UBERON:0001882	97.24	gold quality
superior frontal gyrus	UBERON:0002661	97.19	gold quality
pons	UBERON:0000988	97.18	gold quality
putamen	UBERON:0001874	97.15	gold quality
neocortex	UBERON:0001950	96.97	gold quality
parietal lobe	UBERON:0001872	96.89	gold quality
cerebral cortex	UBERON:0000956	96.87	gold quality
postcentral gyrus	UBERON:0002581	96.81	gold quality
telencephalon	UBERON:0001893	96.73	gold quality
cingulate cortex	UBERON:0003027	96.71	gold quality
Ammon’s horn	UBERON:0001954	96.62	gold quality
right testis	UBERON:0004534	96.62	gold quality
lateral globus pallidus	UBERON:0002476	96.59	gold quality
anterior cingulate cortex	UBERON:0009835	96.59	gold quality
left testis	UBERON:0004533	96.56	gold quality
amygdala	UBERON:0001876	96.55	gold quality
cortical plate	UBERON:0005343	96.55	gold quality
temporal lobe	UBERON:0001871	96.53	gold quality
entorhinal cortex	UBERON:0002728	96.53	gold quality
caudate nucleus	UBERON:0001873	96.38	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	96.29	gold quality
hypothalamus	UBERON:0001898	96.28	gold quality
brain	UBERON:0000955	96.23	gold quality
central nervous system	UBERON:0001017	96.20	gold quality
Brodmann (1909) area 46	UBERON:0006483	96.14	gold quality
forebrain	UBERON:0001890	96.13	gold quality
orbitofrontal cortex	UBERON:0004167	96.11	gold quality
substantia nigra	UBERON:0002038	96.00	gold quality
midbrain	UBERON:0001891	95.89	gold quality
CA1 field of hippocampus	UBERON:0003881	95.41	gold quality
placenta	UBERON:0001987	95.38	gold quality
spinal cord	UBERON:0002240	95.36	gold quality
superior vestibular nucleus	UBERON:0007227	95.01	gold quality
adult organism	UBERON:0007023	94.70	gold quality
paraflocculus	UBERON:0005351	94.62	gold quality
Brodmann (1909) area 10	UBERON:0013541	94.48	gold quality
ileal mucosa	UBERON:0000331	94.45	silver quality
ventral tegmental area	UBERON:0002691	94.41	gold quality
testis	UBERON:0000473	94.25	gold quality
right lung	UBERON:0002167	94.23	gold quality
upper lobe of left lung	UBERON:0008952	94.22	gold quality
dorsal plus ventral thalamus	UBERON:0001897	94.07	gold quality
corpus callosum	UBERON:0002336	94.06	gold quality
upper lobe of lung	UBERON:0008948	93.99	gold quality
frontal pole	UBERON:0002795	93.93	gold quality
medulla oblongata	UBERON:0001896	93.81	gold quality
sperm	CL:0000019	93.74	gold quality
male germ cell	CL:0000015	93.46	gold quality
inferior vagus X ganglion	UBERON:0005363	93.46	gold quality
endothelial cell	CL:0000115	93.28	gold quality
inferior olivary complex	UBERON:0002127	93.10	gold quality
subthalamic nucleus	UBERON:0001906	92.29	gold quality
duodenum	UBERON:0002114	92.25	gold quality
jejunal mucosa	UBERON:0000399	92.20	gold quality
mucosa of transverse colon	UBERON:0004991	92.16	gold quality
amniotic fluid	UBERON:0000173	91.75	gold quality
lower esophagus mucosa	UBERON:0035834	91.40	gold quality
left lobe of thyroid gland	UBERON:0001120	91.28	gold quality
dorsal motor nucleus of vagus nerve	UBERON:0002870	91.19	gold quality
lung	UBERON:0002048	90.70	gold quality
right lobe of thyroid gland	UBERON:0001119	90.40	gold quality
ganglionic eminence	UBERON:0004023	90.40	gold quality
thyroid gland	UBERON:0002046	90.36	gold quality
adenohypophysis	UBERON:0002196	90.36	gold quality
pituitary gland	UBERON:0000007	90.02	gold quality
stromal cell of endometrium	CL:0002255	89.79	gold quality
epithelium of bronchus	UBERON:0002031	89.70	gold quality
bronchus	UBERON:0002185	89.29	gold quality
gingival epithelium	UBERON:0001949	88.96	silver quality
cranial nerve II	UBERON:0000941	88.94	silver quality
bronchial epithelial cell	CL:0002328	88.74	gold quality
epithelium of esophagus	UBERON:0001976	88.31	gold quality
esophagus squamous epithelium	UBERON:0006920	88.31	gold quality
middle frontal gyrus	UBERON:0002702	88.13	gold quality
tibia	UBERON:0000979	88.02	gold quality
adult mammalian kidney	UBERON:0000082	87.81	gold quality
dorsal root ganglion	UBERON:0000044	87.73	silver quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	87.69	gold quality
esophagus mucosa	UBERON:0002469	87.26	gold quality
small intestine	UBERON:0002108	87.18	gold quality
nephron tubule	UBERON:0001231	87.12	silver quality
small intestine Peyer’s patch	UBERON:0003454	86.83	gold quality
cortex of kidney	UBERON:0001225	86.62	gold quality
gingiva	UBERON:0001828	85.88	silver quality

Single-cell (SCXA)

Detected in 3 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-MTAB-6701	yes	41.39
E-MTAB-6142	no	1.95
E-ANND-3	no	0.00

HPA expression

RNA tissue specificity: Tissue enhanced

showing 60 of 77 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Caudate putamen	tissue	180.7
Cerebral cortex	tissue	158.2	medium
Somatosensory cortex	tissue	158.2
Motor cortex	tissue	152.2
Frontal cortex	tissue	150.1
Occipital cortex	tissue	145.5
Prefrontal cortex	tissue	143.9
Temporal cortex	tissue	132.1
Putamen	tissue	131.0
Hippocampal formation	tissue	127.9
Entorhinal cortex	tissue	127.9
Postcentral gyrus	tissue	126.6
Insular cortex	tissue	126.3
Retrosplenial and cingulate cortex	tissue	123.4
Retrosplenial cortex	tissue	121.8
Basal ganglia	tissue	109.8	not detected
Nucleus accumbens	tissue	104.2
Ventral forebrain	tissue	103.3
Locus coeruleus	tissue	101.2
Thalamus	tissue	100.9
Cerebellum	tissue	99.1	high
Pons	tissue	94.9
Hippocampus	tissue	94.7	not detected
Midbrain	tissue	93.0
Superior colliculi	tissue	92.2
Corpus callosum	tissue	91.5
Amygdala	tissue	85.2
Medulla oblongata	tissue	79.7
Septum	tissue	77.3
Substantia nigra	tissue	74.5
Spinal cord	tissue	71.4
Hypothalamus	tissue	69.6
Periaqueductal gray	tissue	59.3
Olfactory bulb	tissue	58.2
Placenta	tissue	41.2	medium
Choroid plexus	tissue	36.8
Lung	tissue	28.5	not detected
Duodenum	tissue	27.6	medium
Small intestine	tissue	26.4	medium
Testis	tissue	19.1	low
Thyroid gland	tissue	15.2	low
Kidney	tissue	14.9	high
Pituitary gland	tissue	14.2
Parathyroid gland	tissue	13.8	not detected
Retina	tissue	13.7	medium
Skin 1	tissue	12.6	not detected
Colon	tissue	12.4	medium
Esophagus	tissue	12.2	not detected
Pancreas	tissue	11.8	medium
Rectum	tissue	10.6	medium
Adrenal gland	tissue	10.5	medium
Salivary gland	tissue	9.5	medium
Heart muscle	tissue	9.1	not detected
Fallopian tube	tissue	9.0	medium
Liver	tissue	8.7	not detected
Stomach 1	tissue	8.4	not detected
Spleen	tissue	8.4	not detected
Prostate	tissue	7.6	medium
Lymph node	tissue	7.5	not detected
Epididymis	tissue	7.3	medium

Brain sub-regions (HPA Brain Atlas): detected in 191; highest nTPM — Flocculonodular lobe (188.9), Cerebellar cortex (180.2), Vermis (167.5), Precentral gyrus (153.3), Temporo-occipital transitional zone (128.3).

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): NR1I2, PPARG, SP1

miRNA regulators (miRDB)

Targeting PRKCZ by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

12 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-221-5P	99.86	65.45	1052
HSA-MIR-8073	99.86	65.21	1118
HSA-MIR-148A-3P	99.74	73.77	1700
HSA-MIR-148B-3P	99.74	73.75	1700
HSA-MIR-152-3P	99.74	73.75	1703
HSA-MIR-582-5P	99.47	70.79	2635
HSA-MIR-4691-5P	98.41	66.77	1343
HSA-MIR-6792-3P	98.41	66.86	1359
HSA-MIR-132-5P	96.61	65.79	115
HSA-MIR-3622B-5P	94.62	64.58	835
HSA-MIR-6774-3P	89.14	65.20	68
HSA-MIR-1307-3P	66.08	59.35	14

Functional genomics

gnomAD constraint: pLI 0.05, LOEUF 0.576, missense Z 2.93 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD)

ENST00000378567 splits into 4 regions with different missense tolerance; 0 are missense-constrained. Missense variants in a constrained region (low observed/expected) are more likely to be pathogenic. gnomAD

Region (GRCh38)	Missense obs / exp	o/e	Constrained
1:2,050,631–2,144,238	228 / 211.6	1.08	no
1:2,144,239–2,144,316	16 / 37.4	0.43	no
1:2,144,317–2,150,845	91 / 97.5	0.93	no
1:2,150,846–2,185,006	243 / 467.0	0.52	no

Literature-anchored findings (GeneRIF, showing 40)

• Isoforms of protein kinase C and their distribution in human adrenal cortex and tumors (PMID:11740573)
• Investigation of the inhibitory effects of chelerythrine chloride on the translocation of the protein kinase C betaI, betaII, zeta in human neutrophils (PMID:11765038)
• PKC-zeta is required in EGF protection of microtubules and intestinal barrier integrity against oxidant injury. (PMID:11960776)
• role of PKCzeta in T cells through the control of NFAT function by modulating the activity of its transactivation domain (PMID:12021260)
• PKC zeta expressed in human neutrophils can phosphorylate p47phox and induce both its translocation and NADPH oxidase activation as well as the binding of p47phox to the cytosolic fragment of p22phox. (PMID:12056906)
• REVIEW:Interaction of protein kinase C isozymes with membranes containing anionic phospholipids utilizing fluorescent phorbol esters to probe the properties of the C1 domains (PMID:12093536)
• shows for the first time that topoisomerase II beta is a substrate for PKC zeta, and that PKC zeta may significantly influence topoisomerase II inhibitor-induced cytotoxicity by altering topoisomerase II beta activity through its kinase function (PMID:12105221)
• EGF protects against oxidative disruption of the intestinal barrier by stabilizing the cytoskeleton in large part through the activation of PKC-zeta and downregulation of iNOS (PMID:12223351)
• The adapter protein ZIP binds Grb14 and regulates its inhibitory action on insulin signaling by recruiting protein kinase Czeta. (PMID:12242277)
• catalytic domain of PKC zeta is intrinsically inactive and dependent on the transphosphorylation of the activation lo (PMID:12244101)
• the role of PKCzeta in the negative regulation of drug-induced SM-CER pathway. (PMID:12435813)
• Protein kinase C zeta-GATA-2 signaling regulates VCAM1 stimulation by thrombin in endothelial cells (PMID:12493764)
• hypoxia decreases Na,K-ATPase activity in alveolar epithelial cells by triggering its endocytosis through mitochondrial reactive oxygen species and PKC-zeta-mediated phosphorylation of the Na,K-ATPase alpha(1) subunit (PMID:12671055)
• PKC zeta has a role in the actin organization in ET-1-stimulated cells may play a role in myometrial contraction in pregnant women. (PMID:12748064)
• The novel varepsilon and eta and atypical zeta, but not the conventional alpha and beta and the novel delta PKCs, may be involved in the signaling pathways involved in thrombin-induced human platelet P-selectin expression (PMID:12783114)
• PKCzeta has a role in regulating cell survival in tumor cells (PMID:12791393)
• Defective aPKC activation contributes to skeletal muscle insulin resistance in glucose intolerance and type 2 diabetes (PMID:12882907)
• enteropathogenic E coli infection of intestinal epithelial cells activates several signaling pathways including PKC zeta and ERK that lead to NF-kappa B activation, thus ensuring the proinflammatory response. (PMID:12900386)
• disregulation of the function of atypical zeta PKC might be involved in the acquisition of an invasive and metastatic phenotype in pancreatic adenocarcinoma cells. (PMID:12920244)
• PRKCZ gene may be associated with type 2 diabetes in Han population in North China. The haplotypes at five SNP sites in this gene may be responsible for this association. (PMID:12970910)
• protein kinase C iota/lambda binds to Rab 2, which inhibits aPKCiota/lambda-dependent GADPH phosphorylation [Protein kinase C lambda] (PMID:14570876)
• PKCzeta is responsible for the activation of HIF-alpha by inhibiting the mRNA expression of FIH-1 thus promoting the transcription of hypoxia-inducible genes. (PMID:14744756)
• phosphorylation of Ser(318) by PKC-zeta might contribute to the inhibitory effect of prolonged hyperinsulinemia on IRS-1 function. (PMID:15069075)
• identification of neuronal protein KIBRA as a novel substrate (PMID:15081397)
• There was expression of protein kinase C zeta in abnormal muscle fibers. Protein kinase C isoforms may play a role in the pathogenesis of myofibrillar myopathy. (PMID:15159477)
• involvement of PKC zeta in thrombin-induced permeability changes in human umbilical vein endothelial cells (PMID:15172966)
• GTPase RhoA and atypical protein kinase Czeta are required for TLR2-mediated gene transcription. (PMID:15210811)
• PKCzeta activity is regulated by nucleotide exchange factor ECT2 (PMID:15254234)
• Single nucleotide polymorphisms in protein kinase Cz (PKCZ) gene probably play a role in the susceptibility to type 2 diabetes by affecting the expression level of the relevant genes. (PMID:15285019)
• PKC-zeta, is critical to regulation of LPS-induced TLR4 lipid raft mobilization within macrophages. (PMID:15313379)
• PKCzeta could act as a modulator of nucleotide excision repair activity by regulating the expression of XPC/hHR23B heterodimer (PMID:15358551)
• The differential regulation of protein kinase C-zeta by enteropathogenic E. coli and enterohemorrhagic E. coli may in part explain the less profound effect of the latter on the barrier function of tight junctions. (PMID:15362041)
• We analyzed the dependence of the expression of some selected protein kinase C isoenzymes on the availability and/or action of androgens. (PMID:15499829)
• Disruption of the cellular environment through genetic mutation, disease, injury, or exposure to pro-oxidants, alcohol, or other insults can induce pathological PKC activation. (PMID:15544481)
• A role for PKCzeta in relaxin-mediated stimulation of cAMP was demonstrated. (PMID:15604116)
• stromal cell-derived factor 1 triggered PKC-zeta phosphorylation, translocation to the plasma membrane, and kinase activity (PMID:15630457)
• Results indicate that protein kinase C (PKC) zeta modulates hMutS alpha (MSH2, MSH6)stability and protein levels, and suggest a role for PKC zeta in genome stability by regulating mismatch repair activity. (PMID:15808853)
• Ajuba is a new cytosolic component of the IL-1 signaling pathway modulating IL-1-induced NF-kappaB activation by influencing the assembly and activity of the aPKC/p62/TRAF6 multiprotein signaling complex (PMID:15870274)
• PKCZ mediates opposing effects on Na(+)-K(+)-Exchanging ATPase activity in a breast neoplasm cell line. (PMID:15887250)
• data support the notion that PKCzeta is essential for LPS-induced NF-kB p65 subunit nuclear translocation in human myometrial cells (PMID:15935276)

Cross-species orthologs

10 orthologs

Organism	Symbol	Gene ID
danio_rerio	prkcz	ENSDARG00000043332
mus_musculus	Prkcz	ENSMUSG00000029053
rattus_norvegicus	Prkcz	ENSRNOG00000015480
drosophila_melanogaster	Pkc53E	FBGN0003091
drosophila_melanogaster	inaC	FBGN0004784
drosophila_melanogaster	Pkn	FBGN0020621
drosophila_melanogaster	Pkcdelta	FBGN0287828
caenorhabditis_elegans		WBGENE00004033
caenorhabditis_elegans		WBGENE00006599
caenorhabditis_elegans		WBGENE00009793

Paralogs (9): PRKCH (ENSG00000027075), PKN2 (ENSG00000065243), PKN1 (ENSG00000123143), PRKCG (ENSG00000126583), PRKCA (ENSG00000154229), PKN3 (ENSG00000160447), PRKCI (ENSG00000163558), PRKCB (ENSG00000166501), PRKCE (ENSG00000171132)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:97602) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 14 distinct phenotype terms.

Mouse phenotype (MP)	Records
increased circulating alkaline phosphatase level	2
abnormal Peyer’s patch morphology	1
persistence of hyaloid vascular system	1
decreased anxiety-related response	1
abnormal coat/hair pigmentation	1
abnormal spleen marginal zone morphology	1
abnormal Peyer’s patch follicle morphology	1
abnormal melanocyte morphology	1
increased circulating alanine transaminase level	1
decreased B cell number	1
increased circulating aspartate transaminase level	1
small Peyer’s patches	1
increased circulating iron level	1
decreased spleen B cell follicle size	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Mycobacterium tuberculosis variant bovis AF2122/97	P65729	100.0%	Diamond
Mycobacterium tuberculosis CDC1551	P9WI72	100.0%	Diamond
Mycobacterium tuberculosis H37Rv	P9WI73	100.0%	Diamond
Pongo abelii	Q5R7A7	100.0%	Diamond
Oryza sativa Indica Group	A2YBX5	99.7%	Diamond
Oryza sativa Japonica Group	Q0DCT8	99.7%	Diamond
Oryctolagus cuniculus	P05772	99.4%	Diamond
Macaca fascicularis	Q4R4U2	99.4%	Diamond
Bos taurus	P05126	99.3%	Diamond
Xenopus tropicalis	Q5BKK4	99.0%	Diamond
Xenopus laevis	Q6GPN6	98.8%	Diamond
Gallus gallus	Q6U1I9	95.8%	Diamond
Caenorhabditis briggsae	A8WUG4	93.5%	Diamond
AKT8 murine leukemia virus	P31748	100.0%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
PRKCZ-DT	ncRNA	105378591
FAAP20	protein-coding	199990
PRKCZ-AS1	ncRNA	100506504
GABRD	protein-coding	2563
SKI	protein-coding	6497
CFAP74	protein-coding	85452

Protein

Protein identifiers

Protein kinase C zeta type — Q05513 (reviewed: Q05513)

Alternative names: nPKC-zeta

All UniProt accessions (16): D6RAN5, D6RAU1, D6RBD4, D6RC84, D6RCN4, D6RD31, D6RDM0, D6REZ8, D6RG01, D6RGG1, D6RJG4, E9PBE1, Q05513, F2Z2H9, F2Z3C5, J3KRP7

UniProt curated annotations — full annotation on UniProt →

Function. Calcium- and diacylglycerol-independent serine/threonine-protein kinase that functions in phosphatidylinositol 3-kinase (PI3K) pathway and mitogen-activated protein (MAP) kinase cascade, and is involved in NF-kappa-B activation, mitogenic signaling, cell proliferation, cell polarity, inflammatory response and maintenance of long-term potentiation (LTP). Upon lipopolysaccharide (LPS) treatment in macrophages, or following mitogenic stimuli, functions downstream of PI3K to activate MAP2K1/MEK1-MAPK1/ERK2 signaling cascade independently of RAF1 activation. Required for insulin-dependent activation of AKT3, but may function as an adapter rather than a direct activator. Upon insulin treatment may act as a downstream effector of PI3K and contribute to the activation of translocation of the glucose transporter SLC2A4/GLUT4 and subsequent glucose transport in adipocytes. In EGF-induced cells, binds and activates MAP2K5/MEK5-MAPK7/ERK5 independently of its kinase activity and can activate JUN promoter through MEF2C. Through binding with SQSTM1/p62, functions in interleukin-1 signaling and activation of NF-kappa-B with the specific adapters RIPK1 and TRAF6. Participates in TNF-dependent transactivation of NF-kappa-B by phosphorylating and activating IKBKB kinase, which in turn leads to the degradation of NF-kappa-B inhibitors. In migrating astrocytes, forms a cytoplasmic complex with PARD6A and is recruited by CDC42 to function in the establishment of cell polarity along with the microtubule motor and dynein. In association with FEZ1, stimulates neuronal differentiation in PC12 cells. In the inflammatory response, is required for the T-helper 2 (Th2) differentiation process, including interleukin production, efficient activation of JAK1 and the subsequent phosphorylation and nuclear translocation of STAT6. May be involved in development of allergic airway inflammation (asthma), a process dependent on Th2 immune response. In the NF-kappa-B-mediated inflammatory response, can relieve SETD6-dependent repression of NF-kappa-B target genes by phosphorylating the RELA subunit at ‘Ser-311’. Phosphorylates VAMP2 in vitro. Phosphorylates and activates LRRK1, which phosphorylates RAB proteins involved in intracellular trafficking. Involved in late synaptic long term potention phase in CA1 hippocampal cells and long term memory maintenance.

Subunit / interactions. Forms a ternary complex with SQSTM1 and KCNAB2. Forms another ternary complex with SQSTM1 and GABRR3. Forms a complex with SQSTM1 and MAP2K5. Interacts with PARD6A, PARD6B, PARD6G and SQSTM1. Part of a complex with PARD3, PARD6A or PARD6B or PARD6G and CDC42 or RAC1. Interacts with ADAP1/CENTA1. Forms a ternary complex composed of SQSTM1 and PAWR. Interacts directly with SQSTM1. Interacts with IKBKB. Interacts (via the protein kinase domain) with WWC1. Forms a tripartite complex with WWC1 and DDR1, but predominantly in the absence of collagen. Component of the Par polarity complex, composed of at least phosphorylated PRKCZ, PARD3 and TIAM1. Interacts with PDPK1 (via N-terminal region). Interacts with WDFY2 (via WD repeats 1-3). Interacts with VAMP2. Forms a complex with WDFY2 and VAMP2. Interacts with APPL1. Interacts with WWC1, WWC2 and WWC3.

Subcellular location. Cytoplasm. Endosome. Cell junction. Membrane Cytoplasm.

Tissue specificity. Expressed in brain, and to a lesser extent in lung, kidney and testis.

Post-translational modifications. CDH5 is required for its phosphorylation at Thr-410. Phosphorylated by protein kinase PDPK1; phosphorylation is inhibited by the apoptotic C-terminal cleavage product of PKN2. Phosphorylation at Thr-410 by PI3K activates the kinase.

Activity regulation. Atypical PKCs (PRKCI and PRKCZ) exhibit an elevated basal enzymatic activity (that may be due to the interaction with SMG1 or SQSTM1) and are not regulated by diacylglycerol, phosphatidylserine, phorbol esters or calcium ions. Two specific sites, Thr-410 (activation loop of the kinase domain) and Thr-560 (turn motif), need to be phosphorylated for its full activation. Phosphatidylinositol 3,4,5-trisphosphate might be a physiological activator. Isoform 2: Constitutively active.

Domain organisation. The PB1 domain mediate mutually exclusive interactions with SQSTM1 and PARD6B. The C1 domain does not bind the diacylglycerol (DAG).

Miscellaneous. Produced by alternative promoter usage.

Similarity. Belongs to the protein kinase superfamily. AGC Ser/Thr protein kinase family. PKC subfamily.

Isoforms (3)

UniProt ID	Names	Canonical?
Q05513-1	1	yes
Q05513-2	2, PKMzeta
Q05513-3	3

RefSeq proteins (8): NP_001028753, NP_001028754, NP_001229803, NP_001337732, NP_001337733, NP_001337734, NP_001337735, NP_002735* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000270	PB1_dom	Domain
IPR000719	Prot_kinase_dom	Domain
IPR000961	AGC-kinase_C	Domain
IPR002219	PKC_DAG/PE	Domain
IPR008271	Ser/Thr_kinase_AS	Active_site
IPR011009	Kinase-like_dom_sf	Homologous_superfamily
IPR012233	PKC	Family
IPR017441	Protein_kinase_ATP_BS	Binding_site
IPR017892	Pkinase_C	Domain
IPR020454	DAG/PE-bd	Domain
IPR034662	aPKC_zeta	Domain
IPR034877	PB1_aPKC	Domain
IPR046349	C1-like_sf	Homologous_superfamily
IPR047314	C1_aPKC_zeta	Domain
IPR053793	PB1-like	Domain

Pfam: PF00069, PF00130, PF00433, PF00564

Enzyme classification (BRENDA)

• EC 2.7.11.13 — protein kinase C (BRENDA: 25 organisms, 203 substrates, 258 inhibitors, 20 Km, 1 kcat entries)

Substrate kinetics (BRENDA)

4 substrates with measured Km, best-characterized 4. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
FKKQGSFAKKK	0.0166–0.0599	10
ATP	0.0001–0.0828	4
N6-PHENYL-ATP	0.0124	1
S6-(229-239) PEPTIDE	0.0036	1

Catalyzed reactions (Rhea)

• L-seryl-[protein] + ATP = O-phospho-L-seryl-[protein] + ADP + H(+) (RHEA:17989)
• L-threonyl-[protein] + ATP = O-phospho-L-threonyl-[protein] + ADP + H(+) (RHEA:46608)

UniProt features (28 total): sequence conflict 7, sequence variant 4, domain 3, modified residue 3, mutagenesis site 3, splice variant 2, binding site 2, chain 1, zinc finger region 1, region of interest 1, active site 1

Structure

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q05513-F1	79.50	0.39

Human Protein Atlas

Protein class: Enzymes, ENZYME proteins, Transferases, Kinases, AGC Ser/Thr protein kinases, Predicted intracellular proteins, Plasma proteins, FDA approved drug targets, Small molecule drugs

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): cytosol; basal body; end piece; flagellar centriole; mid piece; plasma membrane

Antibody reliability (HPA): IH enhanced · IF supported

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1)

Position	Role
376	proton acceptor

Ligand- & substrate-binding residues (2)

Position	Role
258–266	ATP
281	ATP

Post-translational modifications (3)

Type	Positions
Phosphothreonine	560, 410
Phosphoserine	591

Mutagenesis-validated functional residues (3)

Position	Phenotype
19	no effect on interaction with sqstm1 and pard6b.
62	loss of interaction with sqstm1 and pard6b.
66	loss of interaction with sqstm1 and pard6b.

Function

Pathways and Gene Ontology

Reactome pathways

2 curated (TAS) of 19; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

19 pathways:

ID	Pathway	Evidence
R-HSA-5668599	RHO GTPases Activate NADPH Oxidases	curated
R-HSA-5218921	VEGFR2 mediated cell proliferation	curated
R-HSA-8939211	ESR-mediated signaling	—
R-HSA-9634635	Estrogen-stimulated signaling through PRKCZ	electronic
R-HSA-9009391	Extra-nuclear estrogen signaling	—
R-HSA-114604	GPVI-mediated activation cascade	electronic
R-HSA-109582	Hemostasis	—
R-HSA-76002	Platelet activation, signaling and aggregation	—
R-HSA-195258	RHO GTPase Effectors	—
R-HSA-162582	Signal Transduction	—
R-HSA-9006931	Signaling by Nuclear Receptors	—
R-HSA-9006934	Signaling by Receptor Tyrosine Kinases	—
R-HSA-194315	Signaling by Rho GTPases	—
R-HSA-9716542	Signaling by Rho GTPases, Miro GTPases and RHOBTB3	—
R-HSA-170834	Signaling by TGF-beta Receptor Complex	—
R-HSA-9006936	Signaling by TGFB family members	—
R-HSA-194138	Signaling by VEGF	—
R-HSA-2173791	TGF-beta receptor signaling in EMT (epithelial to mesenchymal transition)	electronic
R-HSA-4420097	VEGFA-VEGFR2 Pathway	—

MSigDB gene sets: 647 (showing top): GSE45365_NK_CELL_VS_CD11B_DC_UP, GOBP_REGULATION_OF_CELL_ACTIVATION, GOBP_NEGATIVE_REGULATION_OF_PROTEIN_CONTAINING_COMPLEX_ASSEMBLY, GOBP_RESPONSE_TO_NITROGEN_COMPOUND, GOBP_POSITIVE_REGULATION_OF_ADAPTIVE_IMMUNE_RESPONSE, REACTOME_SIGNALING_BY_TGF_BETA_RECEPTOR_COMPLEX, GOBP_REGULATION_OF_ALPHA_BETA_T_CELL_ACTIVATION, GOBP_POSITIVE_REGULATION_OF_HEMOPOIESIS, GOBP_ESTABLISHMENT_OR_MAINTENANCE_OF_CELL_POLARITY, GOBP_NEURON_PROJECTION_EXTENSION, GOBP_INFLAMMATORY_RESPONSE, GOBP_T_CELL_ACTIVATION_INVOLVED_IN_IMMUNE_RESPONSE, GOBP_REGULATION_OF_ADAPTIVE_IMMUNE_RESPONSE, REACTOME_PLATELET_ACTIVATION_SIGNALING_AND_AGGREGATION, BHATI_G2M_ARREST_BY_2METHOXYESTRADIOL_DN

GO Biological Process (20): protein phosphorylation (GO:0006468), inflammatory response (GO:0006954), signal transduction (GO:0007165), establishment of cell polarity (GO:0030010), negative regulation of protein-containing complex assembly (GO:0031333), positive regulation of interleukin-10 production (GO:0032733), positive regulation of interleukin-13 production (GO:0032736), positive regulation of interleukin-4 production (GO:0032753), positive regulation of interleukin-5 production (GO:0032754), cellular response to insulin stimulus (GO:0032869), intracellular signal transduction (GO:0035556), negative regulation of apoptotic process (GO:0043066), positive regulation of T-helper 2 cell differentiation (GO:0045630), negative regulation of insulin receptor signaling pathway (GO:0046627), positive regulation of insulin receptor signaling pathway (GO:0046628), long-term synaptic potentiation (GO:0060291), positive regulation of ERK1 and ERK2 cascade (GO:0070374), protein localization to plasma membrane (GO:0072659), positive regulation of excitatory postsynaptic potential (GO:2000463), positive regulation of T-helper 2 cell cytokine production (GO:2000553)

GO Molecular Function (13): protein kinase activity (GO:0004672), protein serine/threonine kinase activity (GO:0004674), diacylglycerol-dependent serine/threonine kinase activity (GO:0004697), calcium,diacylglycerol-dependent serine/threonine kinase activity (GO:0004698), ATP binding (GO:0005524), zinc ion binding (GO:0008270), insulin receptor substrate binding (GO:0043560), protein serine kinase activity (GO:0106310), nucleotide binding (GO:0000166), protein binding (GO:0005515), kinase activity (GO:0016301), transferase activity (GO:0016740), metal ion binding (GO:0046872)

GO Cellular Component (22): nuclear envelope (GO:0005635), cytoplasm (GO:0005737), endosome (GO:0005768), microtubule organizing center (GO:0005815), cytosol (GO:0005829), plasma membrane (GO:0005886), cell-cell junction (GO:0005911), bicellular tight junction (GO:0005923), cilium (GO:0005929), membrane (GO:0016020), apical plasma membrane (GO:0016324), nuclear matrix (GO:0016363), cell junction (GO:0030054), vesicle (GO:0031982), myelin sheath abaxonal region (GO:0035748), axon hillock (GO:0043203), apical cortex (GO:0045179), extracellular exosome (GO:0070062), tight junction (GO:0070160), nucleus (GO:0005634), cell cortex (GO:0005938), anchoring junction (GO:0070161)

Reactome top-level categories

14 top-level categories:

Category	Pathways
Signal Transduction	4
Platelet activation, signaling and aggregation	1
Signaling by TGF-beta Receptor Complex	1
VEGFA-VEGFR2 Pathway	1
RHO GTPase Effectors	1
Extra-nuclear estrogen signaling	1
Signaling by TGFB family members	1
Signaling by Receptor Tyrosine Kinases	1
Signaling by Rho GTPases, Miro GTPases and RHOBTB3	1
Signaling by Rho GTPases	1
Signaling by VEGF	1
Hemostasis	1
Signaling by Nuclear Receptors	1
ESR-mediated signaling	1

GO top-level categories

showing 60 of 94 GO namespaces:

Category	Terms
cellular anatomical structure	8
positive regulation of cytokine production	4
intracellular anatomical structure	2
positive regulation of type 2 immune response	2
insulin receptor signaling pathway	2
regulation of insulin receptor signaling pathway	2
positive regulation of signal transduction	2
protein kinase activity	2
endomembrane system	2
membrane-bounded organelle	2
phosphorylation	1
protein modification process	1
defense response	1
cell communication	1
cellular process	1
signaling	1
regulation of cellular process	1
cellular response to stimulus	1
establishment or maintenance of cell polarity	1
regulation of protein-containing complex assembly	1
negative regulation of cellular component organization	1
protein-containing complex assembly	1
interleukin-10 production	1
regulation of interleukin-10 production	1
interleukin-13 production	1
regulation of interleukin-13 production	1
interleukin-4 production	1
regulation of interleukin-4 production	1
interleukin-5 production	1
regulation of interleukin-5 production	1
response to insulin	1
cellular response to peptide hormone stimulus	1
signal transduction	1
apoptotic process	1
regulation of apoptotic process	1
negative regulation of programmed cell death	1
positive regulation of immune effector process	1
T-helper 2 cell differentiation	1
positive regulation of T-helper cell differentiation	1
regulation of T-helper 2 cell differentiation	1
negative regulation of signal transduction	1
negative regulation of cellular response to insulin stimulus	1
positive regulation of cellular response to insulin stimulus	1
regulation of synaptic plasticity	1
positive regulation of synaptic transmission	1
positive regulation of MAPK cascade	1
ERK1 and ERK2 cascade	1
regulation of ERK1 and ERK2 cascade	1
protein localization to membrane	1
protein localization to cell periphery	1
excitatory postsynaptic potential	1
modulation of excitatory postsynaptic potential	1
positive regulation of T cell cytokine production	1
T-helper 2 cell cytokine production	1
regulation of T-helper 2 cell cytokine production	1
kinase activity	1
phosphotransferase activity, alcohol group as acceptor	1
catalytic activity, acting on a protein	1
protein serine/threonine kinase activity	1
diacylglycerol-dependent serine/threonine kinase activity	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 12 of 55 annotations. The rest are phylogenetic / computational / electronic (IEA).

12 experimentally-supported GO terms:

GO term	NS	Evidence
negative regulation of insulin receptor signaling pathway	BP	mutant phenotype
negative regulation of protein-containing complex assembly	BP	mutant phenotype
positive regulation of ERK1 and ERK2 cascade	BP	mutant phenotype
protein phosphorylation	BP	direct assay
cell-cell junction	CC	direct assay
cytosol	CC	direct assay
extracellular exosome	CC	high-throughput assay
vesicle	CC	direct assay
calcium,diacylglycerol-dependent serine/threonine kinase activity	MF	experiment
insulin receptor substrate binding	MF	direct assay
protein kinase activity	MF	direct assay
protein serine/threonine kinase activity	MF	direct assay

Protein interactions and networks

STRING

showing 15 of 1,670 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
PRKCZ	PARD6A	Q9NPB6	850
PRKCZ	PARD6B	Q9BYG5	849
PRKCZ	PARD3	Q8TEW0	810
PRKCZ	PARD6G	Q9BYG4	785
PRKCZ	CDC42	P21181	779
PRKCZ	TJP1	Q07157	645
PRKCZ	PIK3CB	P42338	638
PRKCZ	PIK3CD	O00329	637
PRKCZ	KCNAB2	Q13303	636
PRKCZ	RHOA	P06749	636
PRKCZ	CFAP74	Q9C0B2	612
PRKCZ	PIK3C3	Q8NEB9	610
PRKCZ	WWC1	Q8IX03	607
PRKCZ	SCRIB	Q14160	593
PRKCZ	DVL1	O14640	586

IntAct

Human interaction partners of PRKCZ in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

showing 30 of 32 partners by confidence:

Partner	Interaction type	MIscore	Records
PARD6B	physical association	0.950	7
PARD6A	physical association	0.910	5
PRKCI	association	0.890	5
PARD6G	physical association	0.890	1
NIPSNAP2	association	0.730	2
C1QBP	physical association	0.670	1
AGER	physical association	0.610	4
NUMB	physical association	0.600	4
PRKCQ	physical association	0.580	3
NCF1	physical association	0.560	3
EGFR	physical association	0.550	2
AKT1	physical association	0.540	2
F11R	proximity	0.540	2
IPO5	association	0.530	1
BCL10	colocalization	0.520	3
HSP90AB1	physical association	0.520	2
VHL	physical association	0.460	3
DENND5A	physical association	0.370	1
NMT2	physical association	0.370	1
UTP14A	physical association	0.370	1
VMA22	physical association	0.370	1
YWHAB	physical association	0.370	1
ZNF71	physical association	0.370	1
MAP2K4	association	0.350	1
PGRMC1	association	0.350	1
POLRMT	association	0.350	1
WWC1	association	0.350	1
RELA	phosphorylation reaction	0.310	1
AKT3	proximity	0.270	1
GRM5	proximity	0.270	1

BioGRID (577 interactions; top human partners by supporting records): SQSTM1 (Affinity Capture-MS; 19 records), PARD6B (Affinity Capture-MS; 13 records), PARD6A (Affinity Capture-MS; 11 records), LLGL2 (Affinity Capture-MS; 8 records), PDPK1 (Two-hybrid; 8 records), PARD6G (Affinity Capture-MS; 7 records), PRKCI (Affinity Capture-MS; 7 records), C1QBP (Affinity Capture-MS; 6 records), LLGL1 (Affinity Capture-MS; 6 records), PAWR (Two-hybrid; 6 records), WWC1 (Two-hybrid; 6 records), AKT1 (Affinity Capture-Western; 5 records), AKT3 (Co-localization; 5 records), CSNK2B (Affinity Capture-MS; 4 records), GBAS (Affinity Capture-MS; 4 records)

SIGNOR signaling

showing 41 of 77 signaling interactions:

A	Effect	B	Mechanism
PRKCZ	down-regulates	GSK3B	phosphorylation
PRKCZ	down-regulates	IRS1	phosphorylation
PRKCZ	down-regulates	MARK2	phosphorylation
PRKCZ	down-regulates	MARK3	phosphorylation
PRKCZ	up-regulates	CHAT	phosphorylation
PRKCZ	down-regulates	ADD2	phosphorylation
PRKCZ	down-regulates	CASP9	phosphorylation
PRKCZ	down-regulates	MYH10	phosphorylation
PRKCZ	up-regulates	SP1	phosphorylation
PRKCZ	up-regulates	RELA	phosphorylation
PRKCZ	“down-regulates activity”	BAX	phosphorylation
PRKCZ	“up-regulates activity”	STK11	phosphorylation
PRKCZ	up-regulates	AQP9	phosphorylation
PRKCZ	up-regulates	NR1H4	phosphorylation
PRKCZ	unknown	TRAF2	phosphorylation
PRKCZ	up-regulates	STK11	phosphorylation
PRKCZ	up-regulates	NfKb-p65/p50	phosphorylation
PRKCZ	“down-regulates quantity by destabilization”	IRS1	phosphorylation
1,2-diacyl-sn-glycerol	“up-regulates activity”	PRKCZ	binding
PRKCZ	“up-regulates activity”	AKT3	phosphorylation
PRKCZ	“up-regulates activity”	IKBKB	phosphorylation
PRKCZ	“up-regulates activity”	PSEN1	phosphorylation
PRKCZ	“down-regulates activity”	HABP4	phosphorylation
PRKCZ	“up-regulates activity”	PPP1R14A	phosphorylation
PRKCZ	“down-regulates activity”	NOS3	phosphorylation
PRKCZ	“up-regulates activity”	ATP1A1	phosphorylation
PRKCZ	“down-regulates quantity by destabilization”	NREP	phosphorylation
PRKCZ	“up-regulates quantity by stabilization”	PARD6A	phosphorylation
PRKCZ	“down-regulates quantity by destabilization”	YAP1	phosphorylation
PRKCZ	“down-regulates quantity by destabilization”	CTNNB1	phosphorylation
PRKCZ	“up-regulates activity”	ADARB1	phosphorylation
PRKCZ	“down-regulates quantity by destabilization”	SNAI1	phosphorylation
PRKCZ	“up-regulates activity”	PLA2G4A	phosphorylation
PRKCZ	“up-regulates activity”	VIM	phosphorylation
PRKCZ	“up-regulates activity”	ARHGDIA	phosphorylation
PRKCZ	“down-regulates activity”	MAPK7	phosphorylation
PRKCZ	up-regulates	ADD1	phosphorylation
calcium(2+)	up-regulates	PRKCZ	“chemical activation”
PDPK1	up-regulates	PRKCZ	phosphorylation
PRKCZ	up-regulates	PRKCZ	phosphorylation
PRKCZ	up-regulates	NCF1	phosphorylation

Protein complexes (CORUM) (7)

Experimentally-characterized complexes this protein is a subunit of (★ = the complex contains a known drug target).

7 complexes by size:

Complex	Subunits	Members
MutS-alpha-PK-zeta complex	3	MSH2, MSH6, PRKCZ
DDR1-PRKCZ-WWC1 complex	3	DDR1, PRKCZ, WWC1
PRKCZ-VAMP2-WDFY2 complex	3	PRKCZ, VAMP2, WDFY2
PRKCZ-SQSTM-TRAF6 complex	3	PRKCZ, SQSTM1, TRAF6
PAWR-PRKCZ-SQSTM1 complex	3	PAWR, PRKCZ, SQSTM1
PRKCZ-PDPK1-PRG2 complex	3	PDPK1, PRG2, PRKCZ
NHERF1-PRKCZ complex	2	NHERF1, PRKCZ

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 32 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Tight junction interactions	5	57.6×	8e-06
Apoptosis	5	26.2×	2e-04
Programmed Cell Death	5	22.9×	2e-04
Cellular response to chemical stress	5	22.3×	2e-04
Cellular responses to stress	6	6.9×	2e-03
Adaptive Immune System	7	6.5×	1e-03
Cellular responses to stimuli	6	5.9×	4e-03

GO biological processes:

GO term	Partners	Fold	FDR
negative regulation of apoptotic process	8	8.7×	4e-04
intracellular signal transduction	6	7.2×	6e-03
inflammatory response	6	7.1×	6e-03

Disease & clinical

Genetic variants

Variant evidence for PRKCZ: 29 ClinVar records (1 pathogenic / likely pathogenic); 13 GWAS associations. Per-variant detail is on Sugi Variant.

ClinVar

29 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	0
Uncertain significance	6
Likely benign	6
Benign	3

Top pathogenic / likely-pathogenic (1)

Showing all 1 pathogenic / likely-pathogenic ClinVar records, ranked by ClinVar review status (expert panel → multiple submitters → single submitter), then by number of submitting labs.

Variant ID	HGVS	Classification	Review	Submitters
394133	GRCh37/hg19 1p36.33(chr1:1538143-2140271)x1	Pathogenic	no assertion criteria provided	1

Per-variant reference — Sugi Variant

Explore PRKCZ’s pathogenic and likely-pathogenic variants individually — each with its ClinVar classification and conditions, applied ACMG criteria (ClinGen expert panel, where curated), the calibrated in-silico predictors (AlphaMissense, REVEL, SaProt, conservation), gnomAD frequency, and the predictor-disagreement QC signal — on Sugi Variant.

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 36 predictions of 3,197):

Position(s)	Effect	Δscore	Sites
1:2146106	donor_gain	1.0000
1:2150788–2150789	acceptor_loss	1.0000	5
1:2150979–2150980	donor_loss	1.0000	3
1:2169605–2169606	donor_loss	1.0000	5
1:2172053–2172054	acceptor_loss	1.0000	5
1:2172191–2172192	donor_loss	1.0000	3
1:2172389–2172390	donor_loss	1.0000	5
1:2173895–2173896	acceptor_loss	1.0000	5
1:2173896	acceptor_gain	1.0000
1:2174017–2174018	donor_loss	1.0000	3

AlphaMissense

2,117 missense substitutions predicted likely pathogenic (of 3,960 scored), across 418 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
M397	9	0.992	1.000
M339	9	0.986	1.000
M444	9	0.980	1.000
M342	9	0.974	0.999
D337	8	1.000	1.000
D376	8	1.000	1.000
D380	8	1.000	1.000
N381	8	1.000	1.000
D394	8	1.000	1.000
D433	8	0.999	1.000
F548	8	0.997	1.000
D293	8	0.996	0.999
H368	8	0.996	0.999
F451	8	0.996	1.000
F552	8	0.996	1.000
D549	8	0.995	0.998
F575	8	0.995	1.000
F578	8	0.995	1.000
F304	8	0.994	0.999
F411	8	0.994	1.000

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

3 prognostic cancer types:

Cancer	Prognostic	p-value
Kidney Renal Clear Cell Carcinoma (TCGA)	favorable	2.71e-10
Glioblastoma Multiforme (validation)	favorable	0.000335
Liver Hepatocellular Carcinoma (validation)	unfavorable	0.000615

Disease associations

OMIM: gene MIM:176982 | disease phenotypes:

HPO phenotypes

showing 60 of 99 phenotypes (HPO-id order):

HPO	Term
HP:0000028	Cryptorchidism
HP:0000047	Hypospadias
HP:0000055	Abnormal female external genitalia morphology
HP:0000077	Abnormality of the kidney
HP:0000107	Renal cyst
HP:0000126	Hydronephrosis
HP:0000135	Hypogonadism
HP:0000160	Narrow mouth
HP:0000248	Brachycephaly
HP:0000252	Microcephaly
HP:0000270	Delayed cranial suture closure
HP:0000286	Epicanthus
HP:0000307	Pointed chin
HP:0000343	Long philtrum
HP:0000358	Posteriorly rotated ears
HP:0000405	Conductive hearing impairment
HP:0000407	Sensorineural hearing impairment
HP:0000431	Wide nasal bridge
HP:0000457	Depressed nasal ridge
HP:0000464	Abnormality of the neck
HP:0000486	Strabismus
HP:0000490	Deeply set eye
HP:0000504	Abnormality of vision
HP:0000505	Visual impairment
HP:0000518	Cataract
HP:0000534	Abnormal eyebrow morphology
HP:0000639	Nystagmus
HP:0000648	Optic atrophy
HP:0000708	Atypical behavior
HP:0000717	Autism
HP:0000733	Motor stereotypy
HP:0000750	Delayed speech and language development
HP:0000821	Hypothyroidism
HP:0000878	11 pairs of ribs
HP:0000892	Bifid ribs
HP:0000902	Rib fusion
HP:0001009	Telangiectasia
HP:0001107	Ocular albinism
HP:0001156	Brachydactyly
HP:0001249	Intellectual disability
HP:0001250	Seizure
HP:0001252	Hypotonia
HP:0001263	Global developmental delay
HP:0001274	Agenesis of corpus callosum
HP:0001288	Gait disturbance
HP:0001344	Absent speech
HP:0001385	Hip dysplasia
HP:0001387	Joint stiffness
HP:0001392	Abnormality of the liver
HP:0001397	Hepatic steatosis
HP:0001508	Failure to thrive
HP:0001513	Obesity
HP:0001636	Tetralogy of Fallot
HP:0001643	Patent ductus arteriosus
HP:0001644	Dilated cardiomyopathy
HP:0001654	Abnormal heart valve morphology
HP:0001671	Abnormal cardiac septum morphology
HP:0001734	Annular pancreas
HP:0001743	Abnormality of the spleen
HP:0001773	Short foot

GWAS associations

13 associations:

Study	Trait	p-value
GCST010700_27	Cortical thickness (MOSTest)	7e-44
GCST010697_42	Cortical surface area (min-P)	4e-20
GCST010702_170	Subcortical volume (MOSTest)	4e-18
GCST010698_17	Subcortical volume (min-P)	2e-17
GCST010699_106	Brain morphology (min-P)	3e-17
GCST010701_92	Cortical surface area (MOSTest)	1e-14
GCST010696_11	Cortical thickness (min-P)	2e-10
GCST010703_334	Brain morphology (MOSTest)	9e-9
GCST000817_173	Height	2e-8
GCST007325_29	General risk tolerance (MTAG)	2e-8
GCST005951_44	Body mass index	3e-8
GCST005951_45	Body mass index	4e-8
GCST000885_3	Response to antipsychotic treatment in schizophrenia (reasoning)	1e-6

EFO canonical traits (from GWAS)

5 canonical traits:

EFO ID	Trait name
EFO:0004350	reasoning
EFO:0004340	body mass index
EFO:0008579	risk-taking behaviour
EFO:0004346	neuroimaging measurement
EFO:0004840	cortical thickness

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (3): CHEMBL2093867 (PROTEIN FAMILY), CHEMBL3438 (SINGLE PROTEIN), CHEMBL3885627 (PROTEIN FAMILY)

Molecules with ChEMBL bioactivity

Phase ≥1, by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 288,216 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

16 molecules by phase:

Molecule	Name	Phase	Patents
CHEMBL1863513	INGENOL MEBUTATE	4	1,527
CHEMBL608533	MIDOSTAURIN	4	7,641
CHEMBL83	TAMOXIFEN	4	173,287
CHEMBL428690	ALVOCIDIB	3	28,145
CHEMBL300138	ENZASTAURIN	3	3,401
CHEMBL38380	FASUDIL	3	12,137
CHEMBL265502	SURAMIN	3	37,133
CHEMBL1967878	CENISERTIB	2	373
CHEMBL28509	EDELFOSINE	2	10,657
CHEMBL1980715	LAUROGUADINE	2	294
CHEMBL279115	PHORBOL MYRISTATE ACETATE	2	1,427
CHEMBL2107832	PIMASERTIB	2	3,627
CHEMBL565612	SOTRASTAURIN	2	1,414
CHEMBL572878	TOZASERTIB	2	3,128
CHEMBL574737	UCN-01	2	2,319
CHEMBL3137336	UPROSERTIB	2	1,706

PharmGKB: 1 entry (CPIC guideline: no)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: enzyme — Iota subfamily

Most potent curated ligand interactions (3 total), top 3:

Ligand	Action	Affinity	Parameter
compound 3 [PMID: 19097791]	Inhibition	8.65	pIC50
Gö 6983	Inhibition	7.22	pIC50
balanol	Inhibition	5.23	pIC50

Binding affinities (BindingDB)

448 measured of 581 human assays (604 total across all organisms); most potent 50 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value	Patent
CHEMBL4442196	IC50	0.09 nM
CHEMBL4635482	IC50	0.1 nM
CHEMBL4528495	IC50	0.15 nM
CHEMBL4538431	IC50	0.17 nM
CHEMBL4443190	IC50	0.18 nM
CHEMBL3741746	EC50	0.19 nM
CHEMBL4636488	IC50	0.2 nM
CHEMBL4435580	IC50	0.22 nM
CHEMBL4646995	IC50	0.5 nM
CHEMBL4587471	EC50	0.55 nM
CHEMBL4575056	EC50	0.6 nM
CHEMBL4644939	IC50	0.6 nM
CHEMBL4636337	IC50	0.8 nM
CHEMBL4632523	IC50	0.9 nM
ethyl 2-amino-4-(4-aminophenyl)thiophene-3-carboxylate	EC50	1 nM	US-8889672: Compounds, formulations, and methods of protein kinase C inhibition
CHEMBL4643553	IC50	1.1 nM
Compound K-252a(epi)	IC50	1.2 nM
CHEMBL4642166	IC50	1.4 nM
CHEMBL4637452	IC50	1.4 nM
benzyl 2-amino-4-(3,4-dimethoxyphenyl)thiophene-3-carboxylate	EC50	2 nM	US-8889672: Compounds, formulations, and methods of protein kinase C inhibition
CHEMBL83790	IC50	2.2 nM
corilagin	EC50	3.2 nM
CHEMBL4647780	IC50	3.4 nM
indazole-benzimidazole, 3	IC50	4.1 nM
CHEMBL4643470	IC50	4.1 nM
3-methoxy-2-methyl-4-(methylamino)-29-oxa-1,7,17-triazaoctacyclo[12.12.2.12,6.07,28.08,13.015,19.020,27.021,26]nonacosa-8,10,12,14,19,21,23,25,27-nonaen-16-one	IC50	5.6 nM	US-8822500: Tyrosine kinase inhibitors
CHEMBL4641918	IC50	6.4 nM
Staurosporine, 8	IC50	6.5 nM
NB-506 Analogue	EC50	8 nM
CHEMBL4465866	KD	8 nM
CHEMBL4576489	KD	8 nM
CHEMBL4632384	IC50	9.7 nM
ethyl 2-amino-4-(2-fluoro-4-methoxyphenyl)thiophene-3-carboxylate	EC50	10 nM	US-8889672: Compounds, formulations, and methods of protein kinase C inhibition
4-(2-Carboxy-6-hydroxy-benzoyl)-3,5-dihydroxy-benzoic acid (1R,2R,4S)-2-(4-hydroxy-benzoylamino)-4-hydroxymethyl-cyclopentyl ester	IC50	10 nM
CHEMBL329274	IC50	10 nM
4-(2-Carboxy-6-hydroxy-benzoyl)-3,5-dihydroxy-benzoic acid (3S,5R)-2-((S)-4-hydroxy-benzoylamino)-4-hydroxymethyl-cyclopentyl ester	IC50	10 nM
CHEMBL3732444	IC50	12 nM
CHEMBL4644763	IC50	13 nM
CHEMBL4642061	IC50	13 nM
indazole-benzimidazole, 4	IC50	13.3 nM
CHEMBL4634517	IC50	15 nM
CHEMBL4441825	IC50	16 nM
NB-506 Analogue	EC50	17 nM
(Rebeccamycin)1,11-dichloro-12-(3,4-dihydroxy-6-hydroxymethyl-5-methoxytetrahydro-2H-2-pyranyl)-6,7,12,13-tetrahydro-5H-indolo[2,3-a]pyrrolo[3,4-c]carbazole-5,7-dione	IC50	19 nM
4-(2-Carboxy-6-hydroxy-benzoyl)-3,5-dihydroxy-benzoic acid (1R,2R,4R)-4-amino-2-(4-hydroxy-benzoylamino)-cyclopentyl ester	IC50	20 nM
4-(2-Carboxy-6-hydroxy-benzoyl)-3,5-dihydroxy-benzoic acid (1R,2R,4S)-4-aminomethyl-2-(4-hydroxy-benzoylamino)-cyclopentyl ester	IC50	20 nM
4-(2-Carboxy-6-hydroxy-benzoyl)-3,5-dihydroxy-benzoic acid (1R,2R,4R)-4-aminomethyl-2-(4-hydroxy-benzoylamino)-cyclopentyl ester	IC50	20 nM
NB-506 Analogue	EC50	20 nM
4-(2-Carboxy-6-hydroxy-benzoyl)-3,5-dihydroxy-benzoic acid (3R,5R)-4-amino-2-((S)-4-hydroxy-benzoylamino)-cyclopentyl ester	IC50	20 nM

ChEMBL bioactivities

506 potent at pChembl≥5 of 677 total, top 50 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
10.10	IC50	0.08	nM	STAUROSPORINE
10.05	IC50	0.09	nM	CHEMBL4442196
10.00	IC50	0.1	nM	CHEMBL4635482
9.89	IC50	0.13	nM	CHEMBL3741746
9.85	IC50	0.14	nM	CHEMBL4575056
9.82	IC50	0.15	nM	CHEMBL4528495
9.77	IC50	0.17	nM	CHEMBL4538431
9.74	IC50	0.18	nM	CHEMBL4443190
9.72	EC50	0.19	nM	CHEMBL3741746
9.70	IC50	0.2	nM	CHEMBL4636488
9.66	IC50	0.22	nM	CHEMBL4435580
9.44	IC50	0.36	nM	CHEMBL4587471
9.30	IC50	0.5	nM	CHEMBL4646995
9.26	EC50	0.55	nM	CHEMBL4587471
9.22	EC50	0.6	nM	CHEMBL4575056
9.22	IC50	0.6	nM	CHEMBL4644939
9.22	IC50	0.6	nM	STAUROSPORINE
9.10	IC50	0.8	nM	CHEMBL4636337
9.05	IC50	0.9	nM	CHEMBL4632523
9.00	EC50	1	nM	CHEMBL2393448
9.00	EC50	1	nM	CHEMBL2393447
9.00	EC50	1	nM	CHEMBL2393431
9.00	IC50	1	nM	STAUROSPORINE
8.96	IC50	1.1	nM	CHEMBL4643553
8.85	IC50	1.4	nM	CHEMBL4642166
8.85	IC50	1.4	nM	CHEMBL4637452
8.77	IC50	1.7	nM	CHEMBL291126
8.70	IC50	2	nM	CHEMBL162621
8.70	IC50	2	nM	STAUROSPORINE
8.70	EC50	2	nM	CHEMBL2393450
8.70	EC50	2	nM	CHEMBL2393427
8.66	IC50	2.2	nM	CHEMBL83790
8.65	IC50	2.26	nM	CHEMBL514197
8.57	IC50	2.7	nM	STAUROSPORINE
8.52	IC50	3	nM	STAUROSPORINE
8.52	EC50	3	nM	CHEMBL200027
8.52	EC50	3	nM	CHEMBL2393423
8.47	IC50	3.4	nM	CHEMBL4647780
8.39	IC50	4.1	nM	UCN-01
8.39	IC50	4.1	nM	CHEMBL4643470
8.30	IC50	5	nM	CHEMBL538718
8.29	IC50	5.18	nM	CHEMBL480391
8.28	Ki	5.3	nM	BALANOL
8.25	IC50	5.6	nM	CHEMBL473631
8.22	Kd	6	nM	CHEMBL27768
8.22	IC50	6	nM	STAUROSPORINE
8.19	IC50	6.4	nM	CHEMBL4641918
8.19	IC50	6.5	nM	STAUROSPORINE
8.15	IC50	7	nM	STAUROSPORINE
8.12	IC50	7.5	nM	STAUROSPORINE

PubChem BioAssay actives

330 with measured affinity, of 2589 total; 50 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
[(1R,2S,4R,5R,6S,7S,9R,10S,11S,12S,13S,14S,15R,22R,25R)-12-benzoyloxy-10,11,22-trihydroxy-9-(hydroxymethyl)-13,15-dimethyl-4-prop-1-en-2-yl-8,24,26,27-tetraoxaheptacyclo[12.10.1.14,23.15,23.01,6.07,9.011,25]heptacosan-2-yl]methyl benzoate	1576882: Agonist activity at Protein kinase C in human MT4 cells infected with HIV-1 NL4-3 assessed as inhibition of viral replication measured on day 3 post-infection by Nano-Glo luciferase assay	ic50	0.0001	uM
[(1R,2S,4R,5R,6S,7S,9R,10S,11S,12S,13S,14S,15R,22R,25R)-22-acetyloxy-12-benzoyloxy-10,11-dihydroxy-9-(hydroxymethyl)-13,15-dimethyl-4-prop-1-en-2-yl-8,24,26,27-tetraoxaheptacyclo[12.10.1.14,23.15,23.01,6.07,9.011,25]heptacosan-2-yl]methyl benzoate	1576882: Agonist activity at Protein kinase C in human MT4 cells infected with HIV-1 NL4-3 assessed as inhibition of viral replication measured on day 3 post-infection by Nano-Glo luciferase assay	ic50	0.0001	uM
[(1R,2S,4R,5R,6S,7S,9R,10S,11S,12S,13S,14S,15R,22R,25R)-2-(benzoyloxymethyl)-10,11,22-trihydroxy-9-(hydroxymethyl)-13,15-dimethyl-4-prop-1-en-2-yl-8,24,26,27-tetraoxaheptacyclo[12.10.1.14,23.15,23.01,6.07,9.011,25]heptacosan-12-yl] naphthalene-2-carboxylate	1576882: Agonist activity at Protein kinase C in human MT4 cells infected with HIV-1 NL4-3 assessed as inhibition of viral replication measured on day 3 post-infection by Nano-Glo luciferase assay	ic50	0.0001	uM
[(1R,2S,4R,5R,6S,7S,9R,10S,11S,12S,13S,14S,15R,25R)-12-benzoyloxy-10,11-dihydroxy-9-(hydroxymethyl)-13,15-dimethyl-22-oxo-4-prop-1-en-2-yl-8,24,26,27-tetraoxaheptacyclo[12.10.1.14,23.15,23.01,6.07,9.011,25]heptacosan-2-yl]methyl benzoate	1576882: Agonist activity at Protein kinase C in human MT4 cells infected with HIV-1 NL4-3 assessed as inhibition of viral replication measured on day 3 post-infection by Nano-Glo luciferase assay	ic50	0.0001	uM
7-(4-amino-2-fluorophenyl)-N-[(3S)-azepan-3-yl]isoquinolin-5-amine	1658843: Inhibition of recombinant human PKCzeta using biotin-KKKKRFSFKKSFK substrate and ATP incubated for 30 mins by TR-FRET method	ic50	0.0001	uM
(2S,3R,4R,6R)-3-methoxy-2-methyl-4-(methylamino)-29-oxa-1,7,17-triazaoctacyclo[12.12.2.12,6.07,28.08,13.015,19.020,27.021,26]nonacosa-8,10,12,14,19,21,23,25,27-nonaen-16-one	165147: Inhibition Protein kinase C (PKC)	ic50	0.0001	uM
[(1R,2S,4R,5R,6S,7S,9R,10S,11S,12S,13S,14S,15R,22R,25R)-2-(benzoyloxymethyl)-10,11,22-trihydroxy-9-(hydroxymethyl)-13,15-dimethyl-4-prop-1-en-2-yl-8,24,26,27-tetraoxaheptacyclo[12.10.1.14,23.15,23.01,6.07,9.011,25]heptacosan-12-yl] 4-nitrobenzoate	1576882: Agonist activity at Protein kinase C in human MT4 cells infected with HIV-1 NL4-3 assessed as inhibition of viral replication measured on day 3 post-infection by Nano-Glo luciferase assay	ic50	0.0002	uM
[(1R,2S,4R,5R,6S,7S,9R,10S,11S,12S,13S,14S,15R,22R,25R)-12-benzoyloxy-10,11,22-trihydroxy-9-(hydroxymethyl)-13,15-dimethyl-4-propan-2-yl-8,24,26,27-tetraoxaheptacyclo[12.10.1.14,23.15,23.01,6.07,9.011,25]heptacosan-2-yl]methyl benzoate	1576882: Agonist activity at Protein kinase C in human MT4 cells infected with HIV-1 NL4-3 assessed as inhibition of viral replication measured on day 3 post-infection by Nano-Glo luciferase assay	ic50	0.0002	uM
[(1R,2S,4R,5R,6S,7S,9R,10S,11S,12S,13S,14S,15R,22R,25R)-2-(benzoyloxymethyl)-10,11,22-trihydroxy-9-(hydroxymethyl)-13,15-dimethyl-4-prop-1-en-2-yl-8,24,26,27-tetraoxaheptacyclo[12.10.1.14,23.15,23.01,6.07,9.011,25]heptacosan-12-yl] 4-methoxybenzoate	1576882: Agonist activity at Protein kinase C in human MT4 cells infected with HIV-1 NL4-3 assessed as inhibition of viral replication measured on day 3 post-infection by Nano-Glo luciferase assay	ic50	0.0002	uM
7-phenyl-N-[(3S)-piperidin-3-yl]isoquinolin-5-amine	1658843: Inhibition of recombinant human PKCzeta using biotin-KKKKRFSFKKSFK substrate and ATP incubated for 30 mins by TR-FRET method	ic50	0.0002	uM
[(1R,2S,4R,5R,6S,7S,9R,10S,11S,12S,13S,14S,15R,22R,25R)-2-(benzoyloxymethyl)-10,11,22-trihydroxy-9-(hydroxymethyl)-13,15-dimethyl-4-prop-1-en-2-yl-8,24,26,27-tetraoxaheptacyclo[12.10.1.14,23.15,23.01,6.07,9.011,25]heptacosan-12-yl] pyridine-4-carboxylate	1576882: Agonist activity at Protein kinase C in human MT4 cells infected with HIV-1 NL4-3 assessed as inhibition of viral replication measured on day 3 post-infection by Nano-Glo luciferase assay	ic50	0.0004	uM
7-(4-aminophenyl)-N-piperidin-3-ylisoquinolin-5-amine	1658843: Inhibition of recombinant human PKCzeta using biotin-KKKKRFSFKKSFK substrate and ATP incubated for 30 mins by TR-FRET method	ic50	0.0005	uM
4-[5-(piperidin-3-ylamino)isoquinolin-7-yl]phenol	1658843: Inhibition of recombinant human PKCzeta using biotin-KKKKRFSFKKSFK substrate and ATP incubated for 30 mins by TR-FRET method	ic50	0.0006	uM
7-(4-amino-2,3-difluorophenyl)-N-[(3S)-azepan-3-yl]isoquinolin-5-amine	1658843: Inhibition of recombinant human PKCzeta using biotin-KKKKRFSFKKSFK substrate and ATP incubated for 30 mins by TR-FRET method	ic50	0.0008	uM
7-(6-amino-3-pyridinyl)-N-[(3S)-azepan-3-yl]isoquinolin-5-amine	1658843: Inhibition of recombinant human PKCzeta using biotin-KKKKRFSFKKSFK substrate and ATP incubated for 30 mins by TR-FRET method	ic50	0.0009	uM
ethyl 2-amino-4-(4-aminophenyl)thiophene-3-carboxylate	752123: Inhibition of atypical PKCzeta in HEK293 cells assessed as TNF-induced NFkappaB activation incubated for 3 hrs prior to TNF induction measured after 5 hrs by bright-glo luciferase reporter gene assay	ec50	0.0010	uM
ethyl 2-amino-4-[4-(dimethylamino)phenyl]thiophene-3-carboxylate	752123: Inhibition of atypical PKCzeta in HEK293 cells assessed as TNF-induced NFkappaB activation incubated for 3 hrs prior to TNF induction measured after 5 hrs by bright-glo luciferase reporter gene assay	ec50	0.0010	uM
(3-methoxyphenyl)methyl 2-amino-4-(3,4-dimethoxyphenyl)thiophene-3-carboxylate	752123: Inhibition of atypical PKCzeta in HEK293 cells assessed as TNF-induced NFkappaB activation incubated for 3 hrs prior to TNF induction measured after 5 hrs by bright-glo luciferase reporter gene assay	ec50	0.0010	uM
7-(6-amino-2-fluoro-3-pyridinyl)-N-[(3S)-azepan-3-yl]isoquinolin-5-amine	1658843: Inhibition of recombinant human PKCzeta using biotin-KKKKRFSFKKSFK substrate and ATP incubated for 30 mins by TR-FRET method	ic50	0.0011	uM
7-(4-amino-2,5-difluorophenyl)-N-[(3S)-azepan-3-yl]isoquinolin-5-amine	1658843: Inhibition of recombinant human PKCzeta using biotin-KKKKRFSFKKSFK substrate and ATP incubated for 30 mins by TR-FRET method	ic50	0.0014	uM
7-(4-aminophenyl)-N-[(3S)-azepan-3-yl]isoquinolin-5-amine	1658843: Inhibition of recombinant human PKCzeta using biotin-KKKKRFSFKKSFK substrate and ATP incubated for 30 mins by TR-FRET method	ic50	0.0014	uM
(15R,16R,18S)-16-(hydroxymethyl)-28-oxa-4,14,19-triazaoctacyclo[12.11.2.115,18.02,6.07,27.08,13.019,26.020,25]octacosa-1,6,8,10,12,20,22,24,26-nonaene-3,5-dione	155717: In vitro inhibition of protein kinase C (PKC)	ic50	0.0017	uM
ethyl 2-amino-4-(1,3-benzodioxol-5-yl)thiophene-3-carboxylate	752123: Inhibition of atypical PKCzeta in HEK293 cells assessed as TNF-induced NFkappaB activation incubated for 3 hrs prior to TNF induction measured after 5 hrs by bright-glo luciferase reporter gene assay	ec50	0.0020	uM
benzyl 2-amino-4-(3,4-dimethoxyphenyl)thiophene-3-carboxylate	752123: Inhibition of atypical PKCzeta in HEK293 cells assessed as TNF-induced NFkappaB activation incubated for 3 hrs prior to TNF induction measured after 5 hrs by bright-glo luciferase reporter gene assay	ec50	0.0020	uM
2-methoxy-4-[3-[4-(4-methylpiperazin-1-yl)-1H-benzimidazol-2-yl]-1H-indazol-6-yl]phenol	1799297: PKC Enzyme Assay from Article 10.1016/j.bmcl.2008.11.105: “2-(6-Phenyl-1H-indazol-3-yl)-1H-benzo[d]imidazoles: design and synthesis of a potent and isoform selective PKC-zeta inhibitor.”	ic50	0.0023	uM
propan-2-yl 2-amino-4-(3,4-dimethoxyphenyl)thiophene-3-carboxylate	752123: Inhibition of atypical PKCzeta in HEK293 cells assessed as TNF-induced NFkappaB activation incubated for 3 hrs prior to TNF induction measured after 5 hrs by bright-glo luciferase reporter gene assay	ec50	0.0030	uM
[4-[[4-(1-benzothiophen-2-yl)pyrimidin-2-yl]amino]phenyl]-(4-pyrrolidin-1-ylpiperidin-1-yl)methanone	752123: Inhibition of atypical PKCzeta in HEK293 cells assessed as TNF-induced NFkappaB activation incubated for 3 hrs prior to TNF induction measured after 5 hrs by bright-glo luciferase reporter gene assay	ec50	0.0030	uM
7-(6-amino-4-fluoro-3-pyridinyl)-N-[(3S)-azepan-3-yl]isoquinolin-5-amine	1658843: Inhibition of recombinant human PKCzeta using biotin-KKKKRFSFKKSFK substrate and ATP incubated for 30 mins by TR-FRET method	ic50	0.0034	uM
N’-(7-phenylisoquinolin-5-yl)ethane-1,2-diamine	1658843: Inhibition of recombinant human PKCzeta using biotin-KKKKRFSFKKSFK substrate and ATP incubated for 30 mins by TR-FRET method	ic50	0.0041	uM
4-[3-[4-(4-methylpiperazin-1-yl)-1H-benzimidazol-2-yl]-1H-indazol-6-yl]aniline	1799297: PKC Enzyme Assay from Article 10.1016/j.bmcl.2008.11.105: “2-(6-Phenyl-1H-indazol-3-yl)-1H-benzo[d]imidazoles: design and synthesis of a potent and isoform selective PKC-zeta inhibitor.”	ic50	0.0052	uM
2-[2,6-dihydroxy-4-[(3R,4R)-3-[(4-hydroxybenzoyl)amino]azepan-4-yl]oxycarbonylbenzoyl]-3-hydroxybenzoic acid	254306: Inhibitory constant against protein kinase C	ki	0.0053	uM
4-[3-[4-(4-methylpiperazin-1-yl)-1H-benzimidazol-2-yl]-1H-indazol-6-yl]phenol	1799297: PKC Enzyme Assay from Article 10.1016/j.bmcl.2008.11.105: “2-(6-Phenyl-1H-indazol-3-yl)-1H-benzo[d]imidazoles: design and synthesis of a potent and isoform selective PKC-zeta inhibitor.”	ic50	0.0056	uM
[(1S,2S,6R,10S,11R,13S,14R,15R)-13-butanoyloxy-1,6-dihydroxy-8-(hydroxymethyl)-4,12,12,15-tetramethyl-5-oxo-14-tetracyclo[8.5.0.02,6.011,13]pentadeca-3,8-dienyl] butanoate	2150891: Binding affinity to PKC (unknown origin) assessed as dissociation constant	kd	0.0060	uM
7-phenyl-N-piperidin-3-ylisoquinolin-5-amine	1658843: Inhibition of recombinant human PKCzeta using biotin-KKKKRFSFKKSFK substrate and ATP incubated for 30 mins by TR-FRET method	ic50	0.0064	uM
[(1S,2S,6R,10S,11R,13S,14R,15R)-13-acetyloxy-1,6-dihydroxy-8-(hydroxymethyl)-4,12,12,15-tetramethyl-5-oxo-14-tetracyclo[8.5.0.02,6.011,13]pentadeca-3,8-dienyl] tetradecanoate	1459482: Activation of PKC in human platelet assessed as induction of platelet aggregation measured within 15 mins by tribidimetric method	ec50	0.0095	uM
N-[(3S)-azepan-3-yl]-7-phenylisoquinolin-5-amine	1658843: Inhibition of recombinant human PKCzeta using biotin-KKKKRFSFKKSFK substrate and ATP incubated for 30 mins by TR-FRET method	ic50	0.0097	uM
1-(6-methoxy-2,3-dihydro-1H-isoindol-5-yl)-6-(1H-pyrrolo[2,3-b]pyridin-4-yl)benzimidazole	1375387: Inhibition of full-length N-terminal GST-fused human PKC-zeta expressed in baculovirus expression system using (5FAM) RFARKGSLRQKNV as substrate after 60 mins by caliper assay	ic50	0.0100	uM
ethyl 2-amino-4-(2-fluoro-4-methoxyphenyl)thiophene-3-carboxylate	752123: Inhibition of atypical PKCzeta in HEK293 cells assessed as TNF-induced NFkappaB activation incubated for 3 hrs prior to TNF induction measured after 5 hrs by bright-glo luciferase reporter gene assay	ec50	0.0100	uM
4-piperazin-1-yl-2-pyridin-4-yl-5,6,7,8-tetrahydro-[1]benzothiolo[2,3-d]pyrimidine	1662458: Inhibition of recombinant full-length human aPKCzeta expressed in Sf21 insect cells using 5FAM-ERMRPRKRQGSVRRRV-NH2 as substrate in presence of ATP after 60 mins by IMAP fluorescence polarization analysis	ic50	0.0120	uM
N-[4-[5-(piperidin-3-ylamino)isoquinolin-7-yl]phenyl]acetamide	1658843: Inhibition of recombinant human PKCzeta using biotin-KKKKRFSFKKSFK substrate and ATP incubated for 30 mins by TR-FRET method	ic50	0.0130	uM
6-[(3S)-pyrrolidin-3-yl]oxy-4-(1H-pyrrolo[2,3-b]pyridin-5-yl)isoquinoline	1658843: Inhibition of recombinant human PKCzeta using biotin-KKKKRFSFKKSFK substrate and ATP incubated for 30 mins by TR-FRET method	ic50	0.0130	uM
N-[(3S)-azepan-3-yl]-7-(2,6-difluorophenyl)isoquinolin-5-amine	1658843: Inhibition of recombinant human PKCzeta using biotin-KKKKRFSFKKSFK substrate and ATP incubated for 30 mins by TR-FRET method	ic50	0.0152	uM
5-chloro-4-(4-chloro-1-methylpyrazol-5-yl)-N-[(3S,4S,6S)-4-(3,4-difluorophenyl)-6-(2-hydroxyethyl)piperidin-3-yl]furan-2-carboxamide	1608042: Inhibition of PKC (unknown origin)	ic50	0.0160	uM
3-methoxy-4-[3-[4-(4-methylpiperazin-1-yl)-1H-benzimidazol-2-yl]-1H-indazol-6-yl]phenol	1799297: PKC Enzyme Assay from Article 10.1016/j.bmcl.2008.11.105: “2-(6-Phenyl-1H-indazol-3-yl)-1H-benzo[d]imidazoles: design and synthesis of a potent and isoform selective PKC-zeta inhibitor.”	ic50	0.0220	uM
3-methoxy-4-[3-[4-(4-methylpiperazin-1-yl)-1H-benzimidazol-2-yl]-1H-indazol-6-yl]aniline	1799297: PKC Enzyme Assay from Article 10.1016/j.bmcl.2008.11.105: “2-(6-Phenyl-1H-indazol-3-yl)-1H-benzo[d]imidazoles: design and synthesis of a potent and isoform selective PKC-zeta inhibitor.”	ic50	0.0233	uM
(2S,5S)-9-decyl-5-(hydroxymethyl)-1-methyl-2-propan-2-yl-2,4,5,6-tetrahydro-1,4-benzodiazocin-3-one	2163933: Activation of PKC in human ACH-2 cells infected with latent HIV-1 assessed as reversal of HIV-1 latency by measuring increase in p24 antigen level incubated for 48 hrs by chemiluminescent enzyme immunoassay	ec50	0.0250	uM
4-[6-[(3S)-pyrrolidin-3-yl]oxyisoquinolin-4-yl]aniline	1658843: Inhibition of recombinant human PKCzeta using biotin-KKKKRFSFKKSFK substrate and ATP incubated for 30 mins by TR-FRET method	ic50	0.0330	uM
4-[[[6-methoxy-4-methyl-5-[3-(trifluoromethyl)phenoxy]quinolin-8-yl]amino]methyl]phenol	1180278: Inhibition of PKC (unknown origin) using C1 peptide substrate	ic50	0.0350	uM
7-phenyl-N-[(3R)-piperidin-3-yl]isoquinolin-5-amine	1658843: Inhibition of recombinant human PKCzeta using biotin-KKKKRFSFKKSFK substrate and ATP incubated for 30 mins by TR-FRET method	ic50	0.0350	uM
N-[(1R,2S)-2-aminocyclohexyl]-4-[6-(1-methylpyrazol-4-yl)pyrazolo[1,5-a]pyrimidin-3-yl]thiophene-2-carboxamide	1637128: Inhibition of full-length recombinant human PRKCZ expressed in baculovirus expression system by Z’-LYTE assay	ic50	0.0400	uM

CTD chemical–gene interactions

68 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Aflatoxin B1	affects expression, decreases expression, increases methylation	4
Benzo(a)pyrene	affects methylation, decreases expression	3
Valproic Acid	affects expression, increases expression, increases methylation	3
sodium arsenite	increases expression, decreases expression	2
2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one	affects localization, decreases phosphorylation	2
Tetradecanoylphorbol Acetate	affects localization, increases expression	2
Cyclosporine	increases expression, decreases methylation	2
Cadmium Chloride	decreases expression, increases expression	2
triphenyl phosphate	affects expression	1
pirinixic acid	affects binding, decreases expression, increases activity	1
bisphenol A	affects cotreatment, increases methylation, decreases methylation	1
2,2’-methylenebis(4-methyl-6-tert-butylphenol)	affects expression, affects response to substance	1
trichostatin A	decreases reaction, affects expression	1
mono-(2-ethylhexyl)phthalate	increases abundance, increases methylation	1
afimoxifene	decreases response to substance	1
11-nor-delta(9)-tetrahydrocannabinol-9-carboxylic acid	affects methylation, increases abundance	1
tris(1,3-dichloro-2-propyl)phosphate	increases expression	1
benzo(e)pyrene	decreases methylation	1
cyclotene	increases expression	1
aflatoxin B2	increases methylation	1
dibenzo(a,l)pyrene	decreases expression	1
beta-methylcholine	affects expression	1
ethyl maltol	increases expression	1
phenethyl isothiocyanate	decreases expression, decreases phosphorylation	1
CGP 52608	affects binding, increases reaction	1
K 7174	increases expression	1
2,2’,4,4’,5-brominated diphenyl ether	affects localization	1
(N)-methanocarba-2MeSADP	decreases reaction, increases activity, increases phosphorylation	1
bisphenol S	decreases methylation	1
jinfukang	increases reaction, increases expression	1

ChEMBL screening assays

638 unique, capped per target: 626 binding, 10 functional, 2 admet

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1000235	Binding	Activation of PKC in PMA-stimulated human LNCAP cells assessed as ERK phosphorylation at 1 nM to 10 uM by Western blot relative to PMA	Conformationally constrained analogues of diacylglycerol (DAG). 31. Modulation of the biological properties of diacylgycerol lactones (DAG-lactones) containing rigid-rod acyl groups separated from the core lactone by spacer units of different lengths. — *J Med Chem*
CHEMBL688555	Functional	Retained protein kinase C activity in the presence of 1.25 uM compound	Synthesis and biological activity of novel quaternary ammonium derivatives of alkylglycerols as potent inhibitors of protein kinase C. — *J Med Chem*
CHEMBL4407592	ADMET	Inhibition of recombinant human full-length untagged PRKCZ expressed in baculovirus expression system at 25 uM using FRET-labeled Ser/Thr 07 peptide as substrate measured after 1 hr by Z’-lyte assay relative to control	Optimization and Mechanistic Characterization of Pyridopyrimidine Inhibitors of Bacterial Biotin Carboxylase. — *J Med Chem*

Cellosaurus cell lines

9 cell lines: 6 cancer cell line, 3 transformed cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B3EX	Abcam HEK293T PRKCZ KO 1	Transformed cell line	Female
CVCL_B3EY	Abcam HEK293T PRKCZ KO 2	Transformed cell line	Female
CVCL_D7YL	Ubigene A-549 PRKCZ KO	Cancer cell line	Male
CVCL_D8U0	Ubigene HCT 116 PRKCZ KO	Cancer cell line	Male
CVCL_D9PQ	Ubigene HEK293 PRKCZ KO	Transformed cell line	Female
CVCL_E0LY	Ubigene HeLa PRKCZ KO	Cancer cell line	Female
CVCL_TG93	HAP1 PRKCZ (-) 1	Cancer cell line	Male
CVCL_TG94	HAP1 PRKCZ (-) 2	Cancer cell line	Male
CVCL_TG95	HAP1 PRKCZ (-) 3	Cancer cell line	Male

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

Predicted chemistry — Sugi Predict

The predicted patent-compound landscape for PRKCZ across ~30M SureChEMBL compounds — explore on Sugi Predict.