PROP1

Summary

PROP1 (PROP paired-like homeobox 1, HGNC:9455) is a protein-coding gene on chromosome 5q35.3, encoding Homeobox protein prophet of Pit-1 (O75360). Possibly involved in the ontogenesis of pituitary gonadotropes, as well as somatotropes, lactotropes and caudomedial thyrotropes.

This gene encodes a paired-like homeodomain transcription factor in the developing pituitary gland. Expression occurs prior to and is required for expression of pou domain transcription factor 1, which is responsible for pituitary development and hormone expression. Mutations in this gene have been associated with combined pituitary hormone deficiency-2 as well as deficiencies in luteinizing hormone, follicle-stimulating hormone, growth hormone, prolactin, and thyroid-stimulating hormone.

Source: NCBI Gene 5626 — RefSeq curated summary.

At a glance

• Gene–disease (curated): pituitary hormone deficiency, combined, 2 (Definitive, GenCC) — +3 more curated relationships
• Clinical variants (ClinVar): 352 total — 25 pathogenic, 54 likely-pathogenic
• Phenotypes (HPO): 84
• Dosage sensitivity (ClinGen): haploinsufficiency autosomal recessive, triplosensitivity no evidence
• Transcription factor: yes — 14 downstream targets (CollecTRI)
• MANE Select transcript: NM_006261

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:9455
Approved symbol	PROP1
Name	PROP paired-like homeobox 1
Location	5q35.3
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000175325
Ensembl biotype	protein_coding
OMIM	601538
Entrez	5626

Gene structure

Transcript identifiers

Ensembl transcripts: 1 — 1 protein_coding

ENST00000308304

RefSeq mRNA: 1 — MANE Select: NM_006261 NM_006261

CCDS: CCDS4430

Canonical transcript exons

ENST00000308304 — 3 exons

Exon	Start	End
ENSE00001194917	177994106	177994338
ENSE00001194924	177995825	177996242
ENSE00001312222	177992235	177993047

Expression profiles

Bgee: expression breadth tissue_specific, 4 present calls, max score 54.13.

Top tissues by expression

120 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
pituitary gland	UBERON:0000007	54.13	gold quality
adenohypophysis	UBERON:0002196	48.20	gold quality
bone marrow cell	CL:0002092	38.13	gold quality
lower esophagus mucosa	UBERON:0035834	38.08	gold quality
colonic epithelium	UBERON:0000397	37.20	gold quality
ventricular zone	UBERON:0003053	36.48	gold quality
cortical plate	UBERON:0005343	36.47	gold quality
granulocyte	CL:0000094	35.85	gold quality
superior frontal gyrus	UBERON:0002661	35.57	gold quality
ganglionic eminence	UBERON:0004023	35.49	gold quality
skeletal muscle tissue	UBERON:0001134	34.79	gold quality
bone marrow	UBERON:0002371	33.93	gold quality
body of pancreas	UBERON:0001150	33.09	gold quality
hindlimb stylopod muscle	UBERON:0004252	32.15	gold quality
muscle tissue	UBERON:0002385	32.09	gold quality
leukocyte	CL:0000738	32.02	gold quality
monocyte	CL:0000576	31.88	gold quality
prefrontal cortex	UBERON:0000451	31.18	gold quality
liver	UBERON:0002107	30.90	gold quality
primary visual cortex	UBERON:0002436	30.79	gold quality
tonsil	UBERON:0002372	30.53	gold quality
stromal cell of endometrium	CL:0002255	29.87	gold quality
brain	UBERON:0000955	29.55	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	28.91	gold quality
urinary bladder	UBERON:0001255	28.77	gold quality
duodenum	UBERON:0002114	28.14	gold quality
uterine cervix	UBERON:0000002	27.93	gold quality
Brodmann (1909) area 9	UBERON:0013540	27.84	gold quality
ovary	UBERON:0000992	27.59	gold quality
lymph node	UBERON:0000029	27.57	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	0.49

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

14 targets.

Target	Regulation
ADAM2
CASP3	Unknown
CGA	Unknown
FSHB	Activation
HESX1
LHB	Activation
NOTCH2	Unknown
POU1F1	Activation
PRL	Activation
PROP1
TLE1
TLE2	Unknown
TLE3
TSHB

JASPAR motifs

Motif	Name	Family
MA0715.1	PROP1	Paired-related HD factors

JASPAR matrix evidence (PMIDs): PMID:18585360

Upstream regulators (CollecTRI, top): HESX1, POU1F1, PROP1, ZFHX3

miRNA regulators (miRDB)

19 targeting PROP1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4725-3P	99.96	69.53	2520
HSA-MIR-6780B-5P	99.96	69.60	2562
HSA-MIR-4778-3P	99.93	70.40	1818
HSA-MIR-4697-3P	99.89	67.09	1123
HSA-MIR-4271	99.88	68.32	2244
HSA-MIR-2116-3P	99.74	64.32	889
HSA-MIR-3202	99.66	67.70	2737
HSA-MIR-513A-3P	99.39	70.63	3620
HSA-MIR-513C-3P	99.39	70.63	3620
HSA-MIR-5190	99.15	67.76	1234
HSA-MIR-6757-5P	98.08	65.50	724
HSA-MIR-6802-3P	97.29	65.42	613
HSA-MIR-134-5P	97.11	66.52	976
HSA-MIR-3118	97.11	66.58	984
HSA-MIR-1306-5P	97.11	64.04	755
HSA-MIR-6886-3P	96.96	66.36	844
HSA-MIR-4695-3P	96.71	67.21	836
HSA-MIR-541-3P	96.07	66.11	1271
HSA-MIR-654-5P	96.07	66.18	1280

Functional genomics

ClinGen dosage: haploinsufficiency 30 (autosomal recessive), triplosensitivity 0 (no evidence). ClinGen Gene Dosage Map

Literature-anchored findings (GeneRIF, showing 40)

• deletion in the PROP1 gene can cause pituitary pseudotumor (PMID:11822586)
• mutation causes familial combined pituitary hormone deficiency (PMID:12006708)
• Mutations in the PROP1 gene are responsible for a high proportion of cases of multiple or combined anterior pituitary hormone deficiencies in humans. (PMID:12464226)
• pituitary hormone deficiency due to novel mutation R99Q in hot spot region of PROP-1 causing growth disorder; mutant PROP-1 displays a decrease in DNA binding on a paired box response element and trans-activation of a luciferase reporter gene (PMID:12519826)
• PROP-1 which is required for generation of hormone producing cells in the anterior pituitary gland, have proved to be important in the cause of hypopituitarism in humans– REVIEW (PMID:12717343)
• “PIT1 mutations in man are associated with…thyroid stimulating hormone and growth hormone deficiency…” p. 278 (PMID:14646405)
• “Mutations within PROP1 are associated with growth hormone, prolactin, thyroid stimulating hormone, gonadotrophin and variable cortisol deficiency.” p. 207 (PMID:14714741)
• Significant number of young patients with Prop1 gene mutations demonstrate pituitary enlargement with subsequent regression. (PMID:15126542)
• Patients with Prop1 gene mutations constitute a unique model for studying the role of somatropin and prolactin in ovulation, pregnancy, and fetal growth. (PMID:15302300)
• anterior pituitary function in patients with PROP1 mutations deteriorates progressively and includes adrenal insufficiency (PMID:15472232)
• PROP1 mutations should be considered among the growing number of genetic causes of initially isolated hypogonadotropic hypogonadism. (PMID:15941866)
• Combined pituitary hormone deficiency caused by a sequence deletion mutation in PROP1. (PMID:16703408)
• PROP1 gene mutations can be detected in a high proportion of Hungarian patients with non-acquired childhood-onset growth hormone deficiency combined with at least one other anterior pituitary hormone defect. (PMID:17526936)
• remarkable phenotypic variability in combined pituitary hormone deficiency in siblings with the R120C mutation (PMID:17526949)
• the prevalence of PROP1 mutations was higher when only consanguineous families were considered (44%, 4/9). Patients with idiopathic CPHD and NPPP, born from consanguineous parents, are the strong candidates for PROP1 mutations. (PMID:18157385)
• The novel functioning binding elements of Prop1 in human Pit-1 gene. (PMID:18653712)
• We have described four novel mutations in PROP1 in 3 pedigrees, all resulting in PROP1 deficiency by different mechanisms. (PMID:19128366)
• Studies suggest that TLE1 and TLE3 might also play roles independent of HESX1 by interacting with other transcription factors like PROP1. (PMID:20181723)
• These results support the inference that W194XProp1 is unable to increase POU1F1 gene expression by the defect of transactivating domain and that S156insTProp1 is unable to increase due to the loss of DNA-binding activity. (PMID:20381582)
• the largest genomic deletion including PROP1 gene associated with CPHDis reported. The 7.7-kb segment upstream of the transcription of PROP1 probably harbors a fragile site that favors the occurrence of breakpoints. (PMID:20395664)
• Mutations in the PROP1 and HESX1 genes were not identified in these patients with sporadic growth hormone defiency, combined pituitary hormone deficiency and septo-optic dysplasia. (PMID:20694410)
• Among two sibling pairs, one pair that presented with complete anterior pituitary insufficiency, had a compound heterozygous PROP1 gene mutation with a phenotype of very late onset ACTH-insufficiency. (PMID:21132537)
• Data show no mutations in HESX1, PROP1, and POU1F1 genes, seven different mutations in CTNNB1 in 8/16 patients, and hyperexpression of miR-150. (PMID:21761366)
• Although pituitary size was increased in a number of PROP1-deficient patients, none of them suffered permanent damage from pituitary mass; therefore, any proposed surgery should be postponed as long as possible. (PMID:22024773)
• PROP1 dysregulation was not likely involved in the pathogenesis of adamantinomatous craniopharyngiomas in this cohort of patients. (PMID:22086512)
• Variations with a functional significance conferring susceptibility to combined growth hormone deficiency have been identified in the PROP1 gene (PMID:22745233)
• Peculiar prolactinomas in patients with pituitary developmental PROP1 gene mutations (PMID:22801565)
• Case Report: unfavourable long-term course of an untreated patient with PROP-1 gene mutation-associated combined pituitary horme deficiency. (PMID:23624138)
• A homozygous frameshift mutation of PROP1 (296delGA) was identified in siblings. Defects in PROP1 cause progressive deficiency of multiple pituitary hormones; PROP1 deficiency may present as isolated central hypothyroidism at a very young age (PMID:23652424)
• mutations in the PROP-1 gene in cases with CPHD were expected to be more prevalent in our population due to consanguinity, but it was found that these mutations were far less than expected and that it was rare in non-familial cases. (PMID:23692781)
• AES binds to PROP1 and represses its expression; PROP1 mutation is a likely cause of combined pituitary hormone deficiency. (PMID:23732115)
• High prevalence of PROP1 defects in Lithuania is due to 296delGA mutation, suggesting a founder effect. (PMID:24178788)
• The various levels of specific miRNAs, particularly miR-593 and miR-511 whose direct target is the PROP1 gene, may serve as a non-invasive diagnostic biomarkers for children with CPHD. (PMID:25434367)
• investigated the specific mutations in PROP1, POU1F1, LHX3, and HESX1 genes in patients with combined pituitary hormone deficiency (CPHD) in Turkey (PMID:25500790)
• The p.R73C PROP1 mutation was the most frequent mutation in Congenital hypopituitarism in a Moroccan cohort. (PMID:25557026)
• The c.301_302delAG homozygous genotype had a high frequency of 38%, reaching 100% in group with familial cases of multiple pituitary hormone deficiency and 16% in group with sporadic forms of MPHD. (PMID:25581745)
• the most frequent variants in the PROP1 gene are not a consequence of variant hot spots as previously assumed, but are founder variants. (PMID:26059845)
• A novel heterozygous mutation in the HESX1 gene and a novel homozygous mutation in the PROP1 gene were detected in 2 pedigrees with combined pituitary hormone deficiency (PMID:26111865)
• A compound heterozygosity in the PROP1 gene has been identified for both probands. The first change represents a mutational hot spot (c.150delA, p.R53fsX164), whereas the second is a novel alteration (p.R112X) that leads to protein disruption. The resulting clinical phenotype was surprisingly distinct compared to most patients with genetic alterations in PROP1. (PMID:26608600)
• Data show that human paired like homeodomain factor 1 (PROP1) can substitute functionally for mouse Prop1. (PMID:26812162)

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Prop1	ENSMUSG00000044542
rattus_norvegicus	Prop1	ENSRNOG00000003671

Paralogs (50): ARX (ENSG00000004848), PAX6 (ENSG00000007372), PAX7 (ENSG00000009709), ALX4 (ENSG00000052850), GSC2 (ENSG00000063515), PITX1 (ENSG00000069011), PAX2 (ENSG00000075891), RHOXF1 (ENSG00000101883), CRX (ENSG00000105392), EVX1 (ENSG00000106038), PAX4 (ENSG00000106331), NOBOX (ENSG00000106410), PITX3 (ENSG00000107859), PHOX2B (ENSG00000109132), OTX1 (ENSG00000115507), PRRX1 (ENSG00000116132), VSX2 (ENSG00000119614), ESX1 (ENSG00000123576), PAX8 (ENSG00000125618), PAX1 (ENSG00000125813), RHOXF2 (ENSG00000131721), GSC (ENSG00000133937), RAX (ENSG00000134438), PAX3 (ENSG00000135903), ALX3 (ENSG00000156150), HESX1 (ENSG00000163666), PITX2 (ENSG00000164093), UNCX (ENSG00000164853), PHOX2A (ENSG00000165462), OTX2 (ENSG00000165588), DRGX (ENSG00000165606), PRRX2 (ENSG00000167157), SHOX2 (ENSG00000168779), OTP (ENSG00000171540), RAX2 (ENSG00000173976), EVX2 (ENSG00000174279), ISX (ENSG00000175329), ALX1 (ENSG00000180318), MIXL1 (ENSG00000185155), SHOX (ENSG00000185960)

Protein

Protein identifiers

Homeobox protein prophet of Pit-1 — O75360 (reviewed: O75360)

Alternative names: Pituitary-specific homeodomain factor

All UniProt accessions (1): O75360

UniProt curated annotations — full annotation on UniProt →

Function. Possibly involved in the ontogenesis of pituitary gonadotropes, as well as somatotropes, lactotropes and caudomedial thyrotropes.

Subcellular location. Nucleus.

Tissue specificity. Expressed specifically in embryonic pituitary.

Disease relevance. Pituitary hormone deficiency, combined, 2 (CPHD2) [MIM:262600] Combined pituitary hormone deficiency is defined as the impaired production of growth hormone and one or more of the other five anterior pituitary hormones. CPHD2 is characterized by pleiotropic deficiencies of growth hormone, thyroid-stimulating hormone, follicle-stimulating hormone, luteinizing hormone, prolactin and adrenocorticotropic hormone. The disease is caused by variants affecting the gene represented in this entry.

Similarity. Belongs to the paired homeobox family.

RefSeq proteins (1): NP_006252* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000047	HTH_motif	Conserved_site
IPR001356	HD	Domain
IPR009057	Homeodomain-like_sf	Homologous_superfamily
IPR017970	Homeobox_CS	Conserved_site
IPR042412	PROP1	Family

Pfam: PF00046

UniProt features (16 total): sequence variant 9, compositionally biased region 3, region of interest 2, chain 1, DNA-binding region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O75360-F1	70.74	0.27

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 282 (showing top): GSE45365_CD8A_DC_VS_CD11B_DC_IFNAR_KO_UP, GSE45365_HEALTHY_VS_MCMV_INFECTION_CD8_TCELL_IFNAR_KO_UP, GSE45365_NK_CELL_VS_CD8A_DC_MCMV_INFECTION_DN, GOBP_GLAND_MORPHOGENESIS, GOBP_FOREBRAIN_MORPHOGENESIS, GOBP_PITUITARY_GLAND_DEVELOPMENT, GOBP_DORSAL_VENTRAL_PATTERN_FORMATION, GOBP_FOREBRAIN_DEVELOPMENT, GOBP_HYPOTHALAMUS_DEVELOPMENT, GOBP_ANIMAL_ORGAN_MORPHOGENESIS, NF1_Q6_01, MODULE_123, GOBP_HEAD_DEVELOPMENT, GOBP_DIENCEPHALON_DEVELOPMENT, RYTTCCTG_ETS2_B

GO Biological Process (18): blood vessel development (GO:0001568), regulation of transcription by RNA polymerase II (GO:0006357), apoptotic process (GO:0006915), central nervous system development (GO:0007417), dorsal/ventral pattern formation (GO:0009953), cell migration (GO:0016477), hypothalamus cell differentiation (GO:0021979), negative regulation of apoptotic process (GO:0043066), hypophysis morphogenesis (GO:0048850), somatotropin secreting cell differentiation (GO:0060126), negative regulation of transcription by RNA polymerase II (GO:0000122), regulation of DNA-templated transcription (GO:0006355), nervous system development (GO:0007399), animal organ morphogenesis (GO:0009887), pituitary gland development (GO:0021983), adenohypophysis development (GO:0021984), positive regulation of transcription by RNA polymerase II (GO:0045944), gland development (GO:0048732)

GO Molecular Function (9): RNA polymerase II cis-regulatory region sequence-specific DNA binding (GO:0000978), DNA-binding transcription factor activity, RNA polymerase II-specific (GO:0000981), DNA-binding transcription repressor activity, RNA polymerase II-specific (GO:0001227), DNA-binding transcription activator activity, RNA polymerase II-specific (GO:0001228), chromatin binding (GO:0003682), beta-catenin binding (GO:0008013), sequence-specific double-stranded DNA binding (GO:1990837), DNA binding (GO:0003677), protein binding (GO:0005515)

GO Cellular Component (3): chromatin (GO:0000785), nucleus (GO:0005634), transcription regulator complex (GO:0005667)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
RNA polymerase II transcription regulatory region sequence-specific DNA binding	4
transcription by RNA polymerase II	3
regulation of transcription by RNA polymerase II	3
anatomical structure development	2
system development	2
cell differentiation	2
pituitary gland development	2
animal organ development	2
DNA-binding transcription factor activity, RNA polymerase II-specific	2
binding	2
vasculature development	1
regulation of DNA-templated transcription	1
programmed cell death	1
apoptotic signaling pathway	1
execution phase of apoptosis	1
nervous system development	1
regionalization	1
cell motility	1
hypothalamus development	1
apoptotic process	1
regulation of apoptotic process	1
negative regulation of programmed cell death	1
gland morphogenesis	1
diencephalon morphogenesis	1
adenohypophysis development	1
negative regulation of DNA-templated transcription	1
DNA-templated transcription	1
regulation of gene expression	1
regulation of RNA biosynthetic process	1
anatomical structure morphogenesis	1
diencephalon development	1
endocrine system development	1
gland development	1
positive regulation of DNA-templated transcription	1
cis-regulatory region sequence-specific DNA binding	1
chromatin	1
DNA-binding transcription factor activity	1
negative regulation of transcription by RNA polymerase II	1
DNA-binding transcription repressor activity	1
DNA-binding transcription activator activity	1

Protein interactions and networks

STRING

894 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
PROP1	POU1F1	P28069	971
PROP1	GHRHR	Q02643	916
PROP1	PRL	P01236	869
PROP1	GHRH	P01286	816
PROP1	CTNNB1	P35222	778
PROP1	POMC	P01189	777
PROP1	GHR	P10912	756
PROP1	GH1	P01241	706
PROP1	IGF1	P01343	683
PROP1	SOX3	P35714	674
PROP1	TBX19	O60806	656
PROP1	GHSR	Q92847	634
PROP1	TSHB	P01222	628
PROP1	PROKR2	Q8NFJ6	620
PROP1	FSHB	P01225	575

IntAct

203 interactions, top by confidence:

A	B	Type	Score
	PROP1	psi-mi:“MI:0915”(physical association)	0.600
PROP1		psi-mi:“MI:0915”(physical association)	0.600
PROP1	FAM168A	psi-mi:“MI:0915”(physical association)	0.560
PROP1	POU6F2	psi-mi:“MI:0915”(physical association)	0.560
PROP1	C1orf94	psi-mi:“MI:0915”(physical association)	0.560
PROP1	EFEMP2	psi-mi:“MI:0915”(physical association)	0.560
PROP1	UBE2I	psi-mi:“MI:0915”(physical association)	0.560
PROP1	MAGED1	psi-mi:“MI:0915”(physical association)	0.560
KRTAP6-3	PROP1	psi-mi:“MI:0915”(physical association)	0.560
CYSRT1	PROP1	psi-mi:“MI:0915”(physical association)	0.560
PROP1	COX6B2	psi-mi:“MI:0915”(physical association)	0.560
PROP1	C6orf15	psi-mi:“MI:0915”(physical association)	0.560
PROP1	TEKT5	psi-mi:“MI:0915”(physical association)	0.560
PROP1	BATF2	psi-mi:“MI:0915”(physical association)	0.560
PROP1	SMUG1	psi-mi:“MI:0915”(physical association)	0.560
PROP1	ACTMAP	psi-mi:“MI:0915”(physical association)	0.560
PROP1	OLIG3	psi-mi:“MI:0915”(physical association)	0.560
PROP1	TBX22	psi-mi:“MI:0915”(physical association)	0.560
	PROP1	psi-mi:“MI:0915”(physical association)	0.560
PROP1	KRTAP8-1	psi-mi:“MI:0915”(physical association)	0.560
PROP1	P4HA3	psi-mi:“MI:0915”(physical association)	0.560
PROP1	INTS11	psi-mi:“MI:0915”(physical association)	0.560
PROP1	DAZAP2	psi-mi:“MI:0915”(physical association)	0.560
PROP1	ARSA	psi-mi:“MI:0915”(physical association)	0.560
PSMB11	PROP1	psi-mi:“MI:0915”(physical association)	0.560
PROP1	ABHD11	psi-mi:“MI:0915”(physical association)	0.560
PROP1	TMEM42	psi-mi:“MI:0915”(physical association)	0.560
PROP1	OXER1	psi-mi:“MI:0915”(physical association)	0.560
METTL15	PROP1	psi-mi:“MI:0915”(physical association)	0.560

BioGRID (63): PROP1 (Two-hybrid), PROP1 (Two-hybrid), PROP1 (Two-hybrid), PROP1 (Two-hybrid), PROP1 (Two-hybrid), PROP1 (Two-hybrid), PROP1 (Two-hybrid), PROP1 (Two-hybrid), PROP1 (Two-hybrid), PROP1 (Two-hybrid), PROP1 (Two-hybrid), PROP1 (Two-hybrid), PROP1 (Two-hybrid), PROP1 (Two-hybrid), PROP1 (Two-hybrid)

ESM2 similar proteins: A1YEV8, A1YF08, A1YG25, A1YG85, A2T756, A6NJT0, O14813, O15499, O15522, O35602, O70218, O73592, O75360, P0CJ85, P0CJ86, P0CJ87, P0CJ88, P0CJ89, P0CJ90, P19601, P35713, P52945, P56916, P82976, Q13461, Q15270, Q3LU41, Q62066, Q62782, Q63250, Q6RFH8, Q7RTU5, Q7YRX0, Q8TAK6, Q8WY41, Q96IS3, Q99811, Q9C009, Q9DE09, Q9ET58

Diamond homologs: A0A1W2PPF3, A1YEY5, A1YFI3, A1YG57, A2T733, A2T7P4, A6NLW8, A6NNA5, F1NEA7, G5EBU4, G5EDS1, O18381, O35137, O35160, O42250, O43186, O43316, O43812, O54751, O70137, O73917, O75360, O75364, O95076, P09088, P0CJ85, P0CJ86, P0CJ87, P0CJ88, P0CJ89, P0CJ90, P21711, P22810, P26367, P26630, P29454, P32242, P32243, P34764, P34765

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 57 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Keratinization	5	9.9×	6e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

352 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	25
Likely pathogenic	54
Uncertain significance	83
Likely benign	136
Benign	15

Top pathogenic / likely-pathogenic (30)

Variant ID	HGVS	Classification
1070216	NM_006261.5(PROP1):c.109+1G>C	Pathogenic
1070901	NM_006261.5(PROP1):c.63del (p.Leu22fs)	Pathogenic
1364865	NM_006261.5(PROP1):c.115_116insCCGTTCTGCAGTGCTCTCTCCGTTCTGCA (p.Ser39fs)	Pathogenic
1431103	NM_006261.5(PROP1):c.583del (p.Tyr195fs)	Pathogenic
1454453	NM_006261.5(PROP1):c.352C>T (p.Gln118Ter)	Pathogenic
2127143	NM_006261.5(PROP1):c.463del (p.Tyr155fs)	Pathogenic
2678071	NM_006261.5(PROP1):c.109+1G>A	Pathogenic
2694409	NM_006261.5(PROP1):c.129C>A (p.Cys43Ter)	Pathogenic
2729647	NM_006261.5(PROP1):c.1A>G (p.Met1Val)	Pathogenic
2732155	NM_006261.5(PROP1):c.115_116insCCCTGCAGAAGGCACCCTCA (p.Ser39fs)	Pathogenic
2862658	NM_006261.5(PROP1):c.218_225del (p.Arg73fs)	Pathogenic
3010199	NM_006261.5(PROP1):c.90delinsAA (p.Thr31fs)	Pathogenic
371145	NM_006261.5(PROP1):c.343-2A>T	Pathogenic
371561	NM_006261.5(PROP1):c.557del (p.Ala186fs)	Pathogenic
558722	NM_006261.5(PROP1):c.340C>T (p.Gln114Ter)	Pathogenic
8097	NM_006261.5(PROP1):c.150_151del (p.Gly52fs)	Pathogenic
8100	NM_006261.5(PROP1):c.263T>C (p.Phe88Ser)	Pathogenic
8101	NM_006261.5(PROP1):c.112_124del (p.Ser38fs)	Pathogenic
8102	NM_006261.5(PROP1):c.150del (p.Arg53fs)	Pathogenic
8103	NM_006261.5(PROP1):c.218G>A (p.Arg73His)	Pathogenic
8104	NM_006261.5(PROP1):c.217C>T (p.Arg73Cys)	Pathogenic
8105	NM_006261.5(PROP1):c.295C>T (p.Arg99Ter)	Pathogenic
8107	NM_006261.5(PROP1):c.582G>A (p.Trp194Ter)	Pathogenic
831587	NC_000005.10:g.(?177992699)(177995943_?)del	Pathogenic
965760	NM_006261.5(PROP1):c.113_114delinsT (p.Ser38fs)	Pathogenic
1523184	NM_006261.5(PROP1):c.629del (p.Pro210fs)	Likely pathogenic
161433	NM_006261.5(PROP1):c.274C>T (p.Gln92Ter)	Likely pathogenic
1705572	NM_006261.5(PROP1):c.343-1G>A	Likely pathogenic
2678072	NM_006261.5(PROP1):c.568C>T (p.Gln190Ter)	Likely pathogenic
2752750	NM_006261.5(PROP1):c.581G>A (p.Trp194Ter)	Likely pathogenic

SpliceAI

298 predictions. Top by Δscore:

Variant	Effect	Δscore
5:177994076:T:A	donor_gain	0.9900
5:177994121:A:AC	donor_gain	0.9600
5:177994122:C:CC	donor_gain	0.9600
5:177994334:CGAGT:C	acceptor_gain	0.9500
5:177994339:C:CC	acceptor_gain	0.9400
5:177994092:T:TA	donor_gain	0.9200
5:177995824:CCCA:C	donor_gain	0.9200
5:177993045:GACC:G	acceptor_loss	0.8900
5:177993048:CTGA:C	acceptor_loss	0.8900
5:177994338:TC:T	acceptor_loss	0.8900
5:177994339:CTGA:C	acceptor_loss	0.8900
5:177993046:ACCTG:A	acceptor_gain	0.8800
5:177994051:A:AC	donor_gain	0.8600
5:177994341:G:C	acceptor_loss	0.8600
5:177995823:AC:A	donor_gain	0.8600
5:177995824:CC:C	donor_gain	0.8600
5:177994100:CATCA:C	donor_loss	0.8500
5:177994101:ATCAC:A	donor_loss	0.8500
5:177994102:TCACC:T	donor_loss	0.8500
5:177994103:CACC:C	donor_loss	0.8500
5:177994104:A:AG	donor_loss	0.8500
5:177994105:CCTGG:C	donor_loss	0.8500
5:177994106:C:G	donor_loss	0.8500
5:177993058:G:C	acceptor_loss	0.8400
5:177994107:T:A	donor_loss	0.8400
5:177994337:GT:G	acceptor_gain	0.8400
5:177995818:CACT:C	donor_loss	0.8300
5:177995819:ACTC:A	donor_loss	0.8300
5:177995820:C:G	donor_loss	0.8300
5:177995822:CACC:C	donor_loss	0.8300

AlphaMissense

1438 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
5:177993039:G:C	F117L	1.000
5:177993039:G:T	F117L	1.000
5:177993041:A:G	F117L	1.000
5:177993031:C:G	R120P	0.999
5:177993021:C:A	K123N	0.998
5:177993021:C:G	K123N	0.998
5:177993027:T:A	R121S	0.998
5:177993027:T:G	R121S	0.998
5:177993035:T:C	N119D	0.998
5:177993040:A:C	F117C	0.998
5:177993040:A:G	F117S	0.998
5:177993041:A:C	F117V	0.998
5:177994170:T:C	Y93C	0.998
5:177994184:A:C	F88L	0.998
5:177994184:A:T	F88L	0.998
5:177994186:A:G	F88L	0.998
5:177994220:G:C	F76L	0.998
5:177994220:G:T	F76L	0.998
5:177994222:A:G	F76L	0.998
5:177993033:G:C	N119K	0.997
5:177993033:G:T	N119K	0.997
5:177993034:T:A	N119I	0.997
5:177993034:T:C	N119S	0.997
5:177993034:T:G	N119T	0.997
5:177993041:A:T	F117I	0.997
5:177993028:C:G	R121T	0.996
5:177993042:C:A	W116C	0.996
5:177993042:C:G	W116C	0.996
5:177993044:A:G	W116R	0.996
5:177993044:A:T	W116R	0.996

dbSNP variants (sampled 300 via entrez): RS1000118577 (5:177994501 G>T), RS1000341050 (5:177995477 T>A,C), RS1001053513 (5:177994187 G>T), RS1001960567 (5:177994455 TGAGACAGAGTCTTGCTCTGTCTCCCA>T), RS1002080273 (5:177995151 G>A), RS1002344172 (5:177993382 G>A), RS1002467395 (5:177996433 A>G), RS1003057476 (5:177996718 C>T), RS1003459491 (5:177991742 C>A), RS10039307 (5:177994935 T>A,C), RS1004811529 (5:177995235 G>T), RS1004925961 (5:177995037 C>T), RS1005634216 (5:177992067 T>G), RS1005811643 (5:177993871 T>A), RS1005926584 (5:177993656 G>A,C)

Disease associations

OMIM: gene MIM:601538 | disease phenotypes: MIM:262600, MIM:613038

GenCC curated gene-disease

Disease	Classification	Inheritance
pituitary hormone deficiency, combined, 2	Definitive	Autosomal recessive
hypothyroidism due to deficient transcription factors involved in pituitary development or function	Supportive	Autosomal dominant
panhypopituitarism	Supportive	Autosomal recessive
combined pituitary hormone deficiencies, genetic form	Supportive	Autosomal dominant

Mondo (7): pituitary hormone deficiency, combined, 2 (MONDO:0009878), disorder of sexual differentiation (MONDO:0002145), amenorrhea (MONDO:0001836), combined pituitary hormone deficiencies, genetic form (MONDO:0013099), 46,XY partial gonadal dysgenesis (MONDO:0016674), hypothyroidism due to deficient transcription factors involved in pituitary development or function (MONDO:0016411), panhypopituitarism (MONDO:0019591)

Orphanet (3): Difference of sex development (Orphanet:90771), Combined pituitary hormone deficiencies, genetic forms (Orphanet:95494), 46,XY partial gonadal dysgenesis (Orphanet:251510)

HPO phenotypes

84 total (30 of 84 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000044	Hypogonadotropic hypogonadism
HP:0000135	Hypogonadism
HP:0000141	Amenorrhea
HP:0000158	Macroglossia
HP:0000270	Delayed cranial suture closure
HP:0000282	Facial edema
HP:0000407	Sensorineural hearing impairment
HP:0000457	Depressed nasal ridge
HP:0000470	Short neck
HP:0000478	Abnormality of the eye
HP:0000609	Optic nerve hypoplasia
HP:0000789	Infertility
HP:0000821	Hypothyroidism
HP:0000823	Delayed puberty
HP:0000824	Decreased response to growth hormone stimulation test
HP:0000839	Pituitary dwarfism
HP:0000846	Adrenal insufficiency
HP:0000871	Panhypopituitarism
HP:0000938	Osteopenia
HP:0001161	Hand polydactyly
HP:0001250	Seizure
HP:0001252	Hypotonia
HP:0001254	Lethargy
HP:0001265	Hyporeflexia
HP:0001274	Agenesis of corpus callosum
HP:0001317	Abnormal cerebellum morphology
HP:0001331	Absent septum pellucidum
HP:0001360	Holoprosencephaly
HP:0001510	Growth delay

GWAS associations

0 associations (top):

MeSH disease descriptors (3)

Descriptor	Name	Tree numbers
D000568	Amenorrhea	C23.550.568.500
D012734	Disorders of Sex Development	C12.050.351.875.253; C12.200.706.316; C12.800.316; C16.131.939.316; C19.391.119
C563172	Pituitary Hormone Deficiency, Combined, 2 (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

6 total (human), top 6 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
cupric oxide	increases expression	1
Resveratrol	decreases expression, affects cotreatment	1
Benzo(a)pyrene	affects methylation, increases methylation	1
Estradiol	decreases expression	1
Plant Extracts	affects cotreatment, decreases expression	1
Copper Sulfate	increases expression	1

Clinical trials (associated diseases)

54 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00144391	PHASE4	COMPLETED	Testosterone Gel Applied to Women With Pituitary Gland Problems
NCT00373386	PHASE4	COMPLETED	Growth Hormone and Endothelial Function in Children
NCT04897802	PHASE4	COMPLETED	Identification and Clinical Relevance of an Oxytocin Deficient State (GLP1 Study)
NCT04902235	PHASE4	COMPLETED	Identification and Clinical Relevance of an Oxytocin Deficient State (CRH Study)
NCT01103518	PHASE4	UNKNOWN	Ethinyl Estradiol and Cyproterone Acetate in Irregular Menstruation
NCT01206153	PHASE4	COMPLETED	Metformin for Treatment Antipsychotic Induced Amenorrhea in Female Schizophrenic Patients
NCT02393482	PHASE4	UNKNOWN	Psychological Impact of Amenorrhea in Women With Endometriosis
NCT00827151	PHASE3	WITHDRAWN	Bone Mass Accrual in Adolescent Athletes
NCT00130117	PHASE2	COMPLETED	Study of Leptin for the Treatment of Hypothalamic Amenorrhea
NCT00152282	PHASE2	COMPLETED	A Study to Evaluate the Safety and Effectiveness of Asoprisnil and Estrogen Administration to Postmenopausal Women
NCT00196391	PHASE2	COMPLETED	A Trial to Evaluate DR-2021 in Women With Secondary Amenorrhea
NCT00383656	PHASE2	UNKNOWN	Pulsatile GnRH in Anovulatory Infertility
NCT00429494	PHASE2	COMPLETED	GnRH Analogue for Ovarian Function Preservation in Hematopoietic Stem Cell Transplantation Patients
NCT03718234	PHASE1	COMPLETED	Subcutaneous Hydrocortisone Children With Congenital Adrenal Hyperplasia
NCT00881608	PHASE1	TERMINATED	Study to Evaluate Menses Induction in Women Administered Proellex
NCT07152730	PHASE1	WITHDRAWN	A Study to Measure Pharmacokinetic (PK) Concentrations of Gonadotropin-Releasing Hormone Delivered by the OmniPod Pump
NCT06217848	EARLY_PHASE1	UNKNOWN	The Effect of GLP-1 Agonist in Patients With Hypothalamic Obesity: Prospective, Pilot Study
NCT00001595	Not specified	RECRUITING	An Investigation of Pituitary Tumors and Related Hypothalmic Disorders
NCT00144404	Not specified	WITHDRAWN	Baseline Sexual Function, Cognitive Function, Body Composition and Muscle Parameters and Pharmacokinetics of Transdermal Testosterone Gel in Women With Hypopituitarism
NCT05687474	Not specified	COMPLETED	Baby Detect : Genomic Newborn Screening
NCT00485186	Not specified	WITHDRAWN	Gene Polymorphisms Influencing Steroid Synthesis and Action
NCT01875640	Not specified	COMPLETED	Decision Support for Parents Receiving Information About Child’s Rare Disease
NCT02784184	Not specified	UNKNOWN	COPENHAGEN Minipuberty Study
NCT03102554	Not specified	ENROLLING_BY_INVITATION	Genetics of Differences of Sex Development and Hypospadias
NCT03283852	Not specified	RECRUITING	Identifying New Genetic Causes to Development Disorders
NCT04195490	Not specified	UNKNOWN	Evaluation of Outcomes of Feminizing Genitoplasty in Children With Disorders of Sex Development
NCT04463316	Not specified	RECRUITING	GROWing Up With Rare GENEtic Syndromes
NCT04717349	Not specified	RECRUITING	Data Collection Study of Pediatric and Adolescent Gynecology Conditions
NCT05058781	Not specified	RECRUITING	Minipuberty in Infants Born With Potential Hypogonadism Hypogonadotrope
NCT06692049	Not specified	RECRUITING	Gonadal Tissue Cryopreservation for Fertility Preservation in Children with a Disorder of Sex Development
NCT06989593	Not specified	RECRUITING	Breaking Silence Through Story: A Narrative Medicine Intervention for Parents of Children With Urogenital Conditions
NCT03916978	PHASE2/PHASE3	RECRUITING	Autologous PRP Intra Ovarian Infusion to Restore Ovarian Function in Menopausal Women
NCT00556400	PHASE1/PHASE2	TERMINATED	Treatment of Menorrhagia in Women With Thrombocytopenia Using Platelets or Platelets and Hormones
NCT01187043	PHASE1/PHASE2	COMPLETED	Determination of the Lowest, Safe and Effective Dose of Proellex
NCT00001275	Not specified	COMPLETED	Ovarian Follicle Function in Patients With Primary Ovarian Failure
NCT00011388	Not specified	COMPLETED	Reproductive Effects of Pesticide, PCB and Mercury Exposure in Laotian Immigrants
NCT00243607	Not specified	COMPLETED	Hydrotherapy Against Menopausal Symptoms in Breast Cancer Survivors
NCT00260286	Not specified	COMPLETED	Effects of Gynecological Age on LH Sensitivity to Energy Availability
NCT00456274	Not specified	UNKNOWN	Baselines in Reproductive Disorders
NCT00589654	Not specified	ACTIVE_NOT_RECRUITING	Menstrual Cycle Maintenance and Quality of Life: A Prospective Study