PRPS2

Summary

PRPS2 (phosphoribosyl pyrophosphate synthetase 2, HGNC:9465) is a protein-coding gene on chromosome Xp22.2, encoding Ribose-phosphate pyrophosphokinase 2 (P11908). Catalyzes the synthesis of phosphoribosylpyrophosphate (PRPP) that is essential for nucleotide synthesis.

This gene encodes a phosphoribosyl pyrophosphate synthetase that plays a central role in the synthesis of purines and pyrimidines. The encoded protein catalyzes the synthesis of 5-phosphoribosyl 1-pyrophosphate from ATP and D-ribose 5-phosphate. Alternate splicing results in multiple transcript variants.

Source: NCBI Gene 5634 — RefSeq curated summary.

At a glance

• GWAS associations: 3
• Clinical variants (ClinVar): 66 total
• MANE Select transcript: NM_002765

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:9465
Approved symbol	PRPS2
Name	phosphoribosyl pyrophosphate synthetase 2
Location	Xp22.2
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000101911
Ensembl biotype	protein_coding
OMIM	311860
Entrez	5634

Gene structure

Transcript identifiers

Ensembl transcripts: 7 — 7 protein_coding

ENST00000380663, ENST00000380668, ENST00000398491, ENST00000461630, ENST00000489404, ENST00000925699, ENST00000962522

RefSeq mRNA: 2 — MANE Select: NM_002765 NM_001039091, NM_002765

CCDS: CCDS14150, CCDS43918

Canonical transcript exons

ENST00000380668 — 7 exons

Exon	Start	End
ENSE00000665302	12799207	12799390
ENSE00001485803	12822704	12824222
ENSE00001485819	12791412	12791619
ENSE00001703704	12809234	12809332
ENSE00003350343	12819507	12819680
ENSE00003356906	12820644	12820803
ENSE00003417655	12810022	12810146

Expression profiles

Bgee: expression breadth ubiquitous, 279 present calls, max score 97.68.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 42.1707 / max 1025.6229, expressed in 1820 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
195526	42.1707	1820

Top tissues by expression

293 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
seminal vesicle	UBERON:0000998	97.68	gold quality
oocyte	CL:0000023	97.09	gold quality
right testis	UBERON:0004534	96.93	gold quality
secondary oocyte	CL:0000655	96.66	gold quality
left ovary	UBERON:0002119	96.22	gold quality
left testis	UBERON:0004533	95.97	gold quality
adult organism	UBERON:0007023	95.91	gold quality
testis	UBERON:0000473	95.54	gold quality
ovary	UBERON:0000992	94.84	gold quality
right ovary	UBERON:0002118	94.55	gold quality
caput epididymis	UBERON:0004358	94.29	gold quality
endometrium	UBERON:0001295	93.79	gold quality
cauda epididymis	UBERON:0004360	93.74	gold quality
epithelium of nasopharynx	UBERON:0001951	93.73	gold quality
corpus epididymis	UBERON:0004359	93.27	gold quality
esophagus squamous epithelium	UBERON:0006920	93.27	gold quality
right adrenal gland cortex	UBERON:0035827	92.83	gold quality
sperm	CL:0000019	92.67	gold quality
palpebral conjunctiva	UBERON:0001812	92.66	gold quality
male germ cell	CL:0000015	92.49	gold quality
rectum	UBERON:0001052	92.37	gold quality
body of pancreas	UBERON:0001150	92.34	gold quality
right adrenal gland	UBERON:0001233	92.15	gold quality
endocervix	UBERON:0000458	92.02	gold quality
gall bladder	UBERON:0002110	91.93	gold quality
tibial nerve	UBERON:0001323	91.79	gold quality
lymph node	UBERON:0000029	91.62	gold quality
left adrenal gland	UBERON:0001234	91.45	gold quality
adrenal cortex	UBERON:0001235	91.38	gold quality
uterus	UBERON:0000995	91.37	gold quality

Single-cell (SCXA)

Detected in 3 experiment(s), a significant marker in 3.

Experiment	Marker?	Max mean expression
E-GEOD-134144	yes	2300.78
E-HCAD-10	yes	25.79
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): MYC

miRNA regulators (miRDB)

81 targeting PRPS2, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4668-3P	100.00	68.74	2635
HSA-MIR-4776-3P	100.00	68.73	1340
HSA-MIR-9-5P	100.00	72.28	2361
HSA-MIR-4682	100.00	68.89	1258
HSA-MIR-4283	100.00	66.42	2097
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-5696	99.98	72.36	4487
HSA-MIR-103A-3P	99.98	69.14	1595
HSA-MIR-107	99.98	69.14	1595
HSA-MIR-520D-5P	99.98	73.34	4883
HSA-MIR-524-5P	99.98	73.43	4882
HSA-MIR-570-3P	99.96	72.41	4910
HSA-MIR-3912-5P	99.95	66.11	925
HSA-MIR-651-3P	99.94	73.48	5177
HSA-MIR-8063	99.91	69.76	3146
HSA-MIR-5680	99.91	69.83	3421
HSA-MIR-9902	99.89	69.15	2250
HSA-MIR-380-3P	99.89	70.18	1978
HSA-MIR-3919	99.87	69.45	2489
HSA-MIR-659-3P	99.85	70.69	1620
HSA-MIR-4698	99.84	71.41	4303
HSA-MIR-4307	99.82	70.45	3374
HSA-MIR-3133	99.81	70.92	3506
HSA-MIR-200A-5P	99.76	69.10	949
HSA-MIR-200B-5P	99.76	69.05	948
HSA-MIR-4766-5P	99.75	69.23	2662
HSA-MIR-33A-3P	99.70	70.27	3362
HSA-MIR-4729	99.69	72.18	4233
HSA-MIR-1284	99.67	73.56	1353
HSA-MIR-651-5P	99.64	68.49	1104

Literature-anchored findings (GeneRIF, showing 10)

• increased activity of this gene leads to gout (PMID:18409517)
• Analysis of in vivo C-MYC interactions with TS, IMPDH2 and PRPS2 genes confirmed that they are direct C-MYC targets. (PMID:18677108)
• Meta-analysis of genome-wide association studies identifies a novel variant in PRPS2 on Xp22.3 as susceptibility locus for systemic lupus erythematosus. (PMID:25149475)
• The expression of different genes encoding subunits of PRPS enzyme is affected by hypoxia in tumor glioma cells, but the effect of hypoxia is modified by suppression of endoplasmic reticulum stress signaling enzyme ERN1. (PMID:25816608)
• PRPS2 expression correlates with Sertoli-cell only syndrome and inhibits the apoptosis of TM4 Sertoli cells via the p53/Bcl-2/caspases signaling pathway. (PMID:26004865)
• PRPS2 promotes the migration and invasion of cultured colorectal cancer cells through regulating the activity of MMP-9 and the expression of E-cadherin. (PMID:30908912)
• Molecular mechanism of c-Myc and PRPS1/2 against thiopurine resistance in Burkitt’s lymphoma. (PMID:32391636)
• [Expression of phosphoribosyl pyrophosphate synthase 2 in human testis tissue]. (PMID:33346415)
• PRPS1-mediated purine biosynthesis is critical for pluripotent stem cell survival and stemness. (PMID:33493137)
• Role of PRPS2 as a prognostic and therapeutic target in osteosarcoma. (PMID:33589531)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
mus_musculus	Prps2	ENSMUSG00000025742
rattus_norvegicus	Prps2	ENSRNOG00000004160
drosophila_melanogaster	Prps	FBGN0036030
caenorhabditis_elegans		WBGENE00020107

Paralogs (4): PRPSAP2 (ENSG00000141127), PRPS1 (ENSG00000147224), PRPSAP1 (ENSG00000161542), PRPS1L1 (ENSG00000229937)

Protein

Protein identifiers

Ribose-phosphate pyrophosphokinase 2 — P11908 (reviewed: P11908)

Alternative names: PPRibP, Phosphoribosyl pyrophosphate synthase II

All UniProt accessions (5): P11908, A0A140VK41, A6NMS2, D3YTJ7, H7C540

UniProt curated annotations — full annotation on UniProt →

Function. Catalyzes the synthesis of phosphoribosylpyrophosphate (PRPP) that is essential for nucleotide synthesis.

Subunit / interactions. Homodimer. The active form is probably a hexamer composed of 3 homodimers.

Activity regulation. Activated by magnesium and inorganic phosphate. Competitively or non-competitively inhibited by ADP, 2,3-bisphosphoglyceride or GDP.

Pathway. Metabolic intermediate biosynthesis; 5-phospho-alpha-D-ribose 1-diphosphate biosynthesis; 5-phospho-alpha-D-ribose 1-diphosphate from D-ribose 5-phosphate (route I): step 1/1.

Similarity. Belongs to the ribose-phosphate pyrophosphokinase family.

Isoforms (2)

UniProt ID	Names	Canonical?
P11908-1	1	yes
P11908-2	2

RefSeq proteins (2): NP_001034180, NP_002756* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000836	PRTase_dom	Domain
IPR000842	PRib_PP_synth_CS	Conserved_site
IPR005946	Rib-P_diPkinase	Family
IPR029057	PRTase-like	Homologous_superfamily
IPR029099	Pribosyltran_N	Domain
IPR037515	Rib-P_diPkinase_bac	Family

Pfam: PF13793, PF14572

Catalyzed reactions (Rhea), 1 shown:

• D-ribose 5-phosphate + ATP = 5-phospho-alpha-D-ribose 1-diphosphate + AMP + H(+) (RHEA:15609)

UniProt features (42 total): strand 18, helix 11, binding site 6, turn 3, initiator methionine 1, chain 1, region of interest 1, splice variant 1

Structure

Experimental structures (PDB)

3 structures.

PDB	Method	Resolution (Å)
8YPY	X-RAY DIFFRACTION	2.74
7YK1	ELECTRON MICROSCOPY	3.08
8YI9	ELECTRON MICROSCOPY	3.4

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P11908-F1	95.27	0.91

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (6): 96–101; 128; 130; 130; 139; 143

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-73843	5-Phosphoribose 1-diphosphate biosynthesis

MSigDB gene sets: 240 (showing top): RNGTGGGC_UNKNOWN, BORCZUK_MALIGNANT_MESOTHELIOMA_UP, MORF_ESPL1, E2F4DP1_01, MODULE_56, GOBP_NADPPLUS_METABOLIC_PROCESS, STARK_PREFRONTAL_CORTEX_22Q11_DELETION_DN, MORF_UBE2N, GOBP_ORGANOPHOSPHATE_METABOLIC_PROCESS, MORF_HDAC2, GOBP_NUCLEOSIDE_PHOSPHATE_BIOSYNTHETIC_PROCESS, GOBP_ORGANOPHOSPHATE_BIOSYNTHETIC_PROCESS, GOBP_CARBOHYDRATE_DERIVATIVE_METABOLIC_PROCESS, GOBP_GLUCOSE_6_PHOSPHATE_METABOLIC_PROCESS, GOBP_NUCLEOBASE_CONTAINING_SMALL_MOLECULE_METABOLIC_PROCESS

GO Biological Process (6): 5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015), pentose-phosphate shunt (GO:0006098), nucleobase-containing compound metabolic process (GO:0006139), purine nucleotide biosynthetic process (GO:0006164), ribonucleoside monophosphate biosynthetic process (GO:0009156), nucleotide biosynthetic process (GO:0009165)

GO Molecular Function (10): magnesium ion binding (GO:0000287), ribose phosphate diphosphokinase activity (GO:0004749), ATP binding (GO:0005524), kinase activity (GO:0016301), identical protein binding (GO:0042802), protein homodimerization activity (GO:0042803), nucleotide binding (GO:0000166), protein binding (GO:0005515), transferase activity (GO:0016740), metal ion binding (GO:0046872)

GO Cellular Component (2): cytoplasm (GO:0005737), cytosol (GO:0005829)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Pentose phosphate pathway	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	2
ribose phosphate biosynthetic process	1
5-phosphoribose 1-diphosphate metabolic process	1
NADPH regeneration	1
pentose-phosphate shunt, oxidative branch	1
pentose-phosphate shunt, non-oxidative branch	1
glucose 6-phosphate metabolic process	1
primary metabolic process	1
purine nucleotide metabolic process	1
nucleotide biosynthetic process	1
purine-containing compound biosynthetic process	1
nucleoside monophosphate biosynthetic process	1
nucleotide metabolic process	1
nucleoside phosphate biosynthetic process	1
metal ion binding	1
diphosphotransferase activity	1
adenyl ribonucleotide binding	1
purine ribonucleoside triphosphate binding	1
transferase activity, transferring phosphorus-containing groups	1
protein binding	1
identical protein binding	1
protein dimerization activity	1
nucleoside phosphate binding	1
heterocyclic compound binding	1
binding	1
catalytic activity	1
cation binding	1
intracellular anatomical structure	1
cytoplasm	1

Protein interactions and networks

STRING

2550 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
PRPS2	MSMB	P08118	898
PRPS2	NT5C3A	Q9H0P0	784
PRPS2	MID2	Q9UJV3	717
PRPS2	PPAT	Q06203	649
PRPS2	APRT	P07741	612
PRPS2	GART	P22102	595
PRPS2	NT5C	Q8TCD5	590
PRPS2	ADSL	P30566	590
PRPS2	COL4A6	Q14031	586
PRPS2	ZFX	P17010	584
PRPS2	RPS4X	P12631	583
PRPS2	IMPDH2	P12268	573
PRPS2	RPEL1	Q2QD12	563
PRPS2	RPIA	P49247	557
PRPS2	H6PD	O95479	550

IntAct

119 interactions, top by confidence:

A	B	Type	Score
PRPS1	PRPS2	psi-mi:“MI:0915”(physical association)	0.900
PRPS2	PRPS1	psi-mi:“MI:0915”(physical association)	0.900
PRPS1	PRPSAP2	psi-mi:“MI:0914”(association)	0.840
PRPS2	PRPSAP1	psi-mi:“MI:0915”(physical association)	0.670
NTAQ1	PRPS2	psi-mi:“MI:0915”(physical association)	0.670
PRPS2	NTAQ1	psi-mi:“MI:0915”(physical association)	0.670
MAPK7	PFDN6	psi-mi:“MI:0914”(association)	0.640
PRPS1	NMT2	psi-mi:“MI:0914”(association)	0.640
PRPS2	PRPS2	psi-mi:“MI:0915”(physical association)	0.560
PRPS2	NOTCH2NLA	psi-mi:“MI:0915”(physical association)	0.560
NOTCH2NLA	PRPS2	psi-mi:“MI:0915”(physical association)	0.560
GRN	PRPS2	psi-mi:“MI:0915”(physical association)	0.560
PRPS2	HSPB1	psi-mi:“MI:0915”(physical association)	0.560

BioGRID (300): PRPS2 (Two-hybrid), PRPS2 (Two-hybrid), PRPSAP1 (Two-hybrid), WDYHV1 (Two-hybrid), NOTCH2NL (Two-hybrid), PRPS1 (Affinity Capture-MS), PRPSAP1 (Affinity Capture-MS), PRPSAP2 (Affinity Capture-MS), PRIM2 (Affinity Capture-MS), NMT2 (Affinity Capture-MS), PRPS2 (Co-fractionation), PRPSAP1 (Co-fractionation), PRPSAP2 (Co-fractionation), SBDS (Co-fractionation), PRPS2 (Proximity Label-MS)

ESM2 similar proteins: A6W1C7, B8GZV1, P0A1V6, P0A1V7, P0A717, P0A718, P0A719, P0DB98, P0DB99, P11908, P44328, P65234, P65235, P65243, P65245, Q0ARN5, Q0C5A1, Q1LTH2, Q4R4R7, Q5XEL0, Q63XL8, Q6AJL7, Q7MMZ1, Q7N590, Q7NQS9, Q7VL55, Q7VUH1, Q7W181, Q7WNY4, Q87A22, Q87RN8, Q888C6, Q88PX6, Q8DFF5, Q8EAQ9, Q8FZF0, Q8K9X2, Q8PC63, Q8PNU0, Q8UDA9

Diamond homologs: A2VDS0, A6W1C7, O08618, O33924, O60256, O67556, O94413, P09330, P0A1V6, P0A1V7, P0A717, P0A718, P0A719, P11908, P14193, P21108, P32895, P38063, P38620, P38689, P41831, P42816, P44328, P46585, P56184, P57266, P60891, P60892, P65234, P65235, P65236, P65237, P65238, P65239, P65240, P87171, Q08DW2, Q14558, Q1LTH2, Q28DH0

SIGNOR signaling

9 interactions.

A	Effect	B	Mechanism
PRKAA1	“down-regulates activity”	PRPS2	phosphorylation
AMPK	“down-regulates activity”	PRPS2	phosphorylation
PRPS2	up-regulates	Nucleotide_synthesis
PRPS2	“down-regulates quantity”	“D-ribofuranose 5-phosphate(2-)”	“chemical modification”
PRPS2	“up-regulates quantity”	“5-phospho-α-D-ribose 1-diphosphate”	“chemical modification”
MYC	“up-regulates quantity by expression”	PRPS2	“transcriptional regulation”
LATS1	“down-regulates quantity by destabilization”	PRPS2	phosphorylation
LATS2	“down-regulates quantity by destabilization”	PRPS2	phosphorylation
TBK1	“up-regulates activity”	PRPS2	phosphorylation

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 102 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
VEGFR2 mediated vascular permeability	5	27.2×	8e-05
FCGR3A-mediated phagocytosis	9	22.5×	5e-08
EPHB-mediated forward signaling	6	21.2×	4e-05
Signaling by SCF-KIT	6	19.9×	5e-05
VEGFA-VEGFR2 Pathway	10	18.6×	5e-08
Fcgamma receptor (FCGR) dependent phagocytosis	5	18.6×	5e-04
Regulation of actin dynamics for phagocytic cup formation	7	17.2×	2e-05
Signaling by VEGF	5	14.6×	1e-03

GO biological processes:

GO term	Partners	Fold	FDR
Fc-gamma receptor signaling pathway involved in phagocytosis	6	44.8×	3e-06
integrin-mediated signaling pathway	6	10.2×	4e-03
regulation of cell shape	7	9.2×	3e-03
positive regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction	8	6.7×	4e-03
intracellular signal transduction	13	5.3×	5e-04

Disease & clinical

Clinical variants and AI predictions

ClinVar

66 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	7
Likely benign	1
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

1164 predictions. Top by Δscore:

Variant	Effect	Δscore
X:12791596:G:GT	donor_gain	1.0000
X:12799205:A:AG	acceptor_gain	1.0000
X:12799205:AGC:A	acceptor_gain	1.0000
X:12799205:AGCGT:A	acceptor_gain	1.0000
X:12799206:G:GA	acceptor_gain	1.0000
X:12799206:GC:G	acceptor_gain	1.0000
X:12799206:GCG:G	acceptor_gain	1.0000
X:12799206:GCGT:G	acceptor_gain	1.0000
X:12799206:GCGTG:G	acceptor_gain	1.0000
X:12799335:GA:G	donor_gain	1.0000
X:12799386:ACAAG:A	donor_loss	1.0000
X:12799387:CAAG:C	donor_loss	1.0000
X:12799388:AAGG:A	donor_loss	1.0000
X:12799390:GGT:G	donor_loss	1.0000
X:12799391:GTAGG:G	donor_loss	1.0000
X:12799392:T:C	donor_loss	1.0000
X:12809228:TTGTA:T	acceptor_loss	1.0000
X:12809229:TGTA:T	acceptor_loss	1.0000
X:12809231:TA:T	acceptor_loss	1.0000
X:12809232:A:AG	acceptor_gain	1.0000
X:12809232:AGAGT:A	acceptor_loss	1.0000
X:12809233:G:GG	acceptor_gain	1.0000
X:12809233:GA:G	acceptor_gain	1.0000
X:12809233:GAGTC:G	acceptor_gain	1.0000
X:12809329:ACAGG:A	donor_loss	1.0000
X:12809330:CAGGT:C	donor_loss	1.0000
X:12809331:AGG:A	donor_loss	1.0000
X:12809332:GGT:G	donor_loss	1.0000
X:12809333:G:GA	donor_loss	1.0000
X:12809334:T:G	donor_loss	1.0000

AlphaMissense

2105 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
X:12799344:C:A	A87D	1.000
X:12799376:G:C	D98H	1.000
X:12799381:A:C	K99N	1.000
X:12799381:A:T	K99N	1.000
X:12799384:G:C	K100N	1.000
X:12799384:G:T	K100N	1.000
X:12809259:T:C	L111P	1.000
X:12809265:C:A	A113D	1.000
X:12809285:G:T	G120W	1.000
X:12809315:C:A	H130N	1.000
X:12809315:C:G	H130D	1.000
X:12809316:A:G	H130R	1.000
X:12809317:T:A	H130Q	1.000
X:12809317:T:G	H130Q	1.000
X:12809326:G:C	Q133H	1.000
X:12809326:G:T	Q133H	1.000
X:12810022:G:A	G136R	1.000
X:12810022:G:C	G136R	1.000
X:12810023:G:A	G136E	1.000
X:12810025:T:C	F137L	1.000
X:12810027:C:A	F137L	1.000
X:12810027:C:G	F137L	1.000
X:12810119:T:A	V168D	1.000
X:12810125:C:A	P170H	1.000
X:12810127:G:C	D171H	1.000
X:12810128:A:T	D171V	1.000
X:12810129:C:A	D171E	1.000
X:12810129:C:G	D171E	1.000
X:12810133:G:A	G173R	1.000
X:12810133:G:C	G173R	1.000

dbSNP variants (sampled 300 via entrez): RS1000033968 (X:12800638 A>G), RS1000074318 (X:12810696 G>A,T), RS1000121268 (X:12794162 C>T), RS1000140580 (X:12800820 C>G), RS1000367946 (X:12805186 A>G), RS1000405990 (X:12793460 G>A), RS1000679397 (X:12796070 G>A), RS1000859446 (X:12813527 A>T), RS1000911848 (X:12813907 T>C), RS1000971431 (X:12802439 G>A), RS1001205238 (X:12806225 CT>C,CTT), RS1001412256 (X:12791445 GCCTCCGCCACCT>G,GCCTCCGCCACCTCCTCCGCCACCT), RS1001638826 (X:12804821 C>T), RS1001657665 (X:12806788 G>A), RS1001742368 (X:12812663 C>T)

Disease associations

OMIM: gene MIM:311860 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

3 associations (top):

Study	Trait	p-value
GCST003252_20	Systemic lupus erythematosus	3.000000e-06
GCST009391_449	Metabolite levels	7.000000e-06
GCST011956_122	Systemic lupus erythematosus	3.000000e-25

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0010386	phosphatidylcholine 38:4 measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

54 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	decreases expression, increases expression	2
Arsenic Trioxide	affects binding, decreases reaction, increases expression	2
Air Pollutants	decreases expression, affects cotreatment, increases abundance, increases oxidation	2
Cisplatin	increases expression	2
Phenylmercuric Acetate	affects cotreatment, decreases expression	2
7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	decreases expression, increases expression	2
Cyclosporine	decreases expression	2
aristolochic acid I	decreases expression, increases expression	1
testosterone enanthate	affects cotreatment, decreases expression	1
triphenyl phosphate	affects expression	1
alpha-pinene	affects cotreatment, increases oxidation, increases abundance	1
kojic acid	increases expression	1
arsenite	affects binding, increases reaction	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
cobaltous chloride	decreases expression	1
benzo(e)pyrene	increases methylation	1
potassium chromate(VI)	increases expression	1
nickel sulfate	increases expression	1
4-aminophenylarsenoxide	affects binding, decreases reaction	1
methacrylaldehyde	increases abundance, affects cotreatment, increases oxidation	1
beta-methylcholine	affects expression	1
cetrorelix	affects cotreatment, decreases expression	1
microcystin RR	decreases expression, increases expression	1
tanespimycin	affects cotreatment, decreases expression	1
K 7174	decreases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
nutlin 3	affects cotreatment, increases secretion	1
ICG 001	decreases expression	1
abrine	decreases expression	1
dorsomorphin	affects cotreatment, decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.