PRR16

Summary

PRR16 (proline rich 16, HGNC:29654) is a protein-coding gene on chromosome 5q23.1, encoding Protein Largen (Q569H4). Regulator of cell size that promotes cell size increase independently of mTOR and Hippo signaling pathways.

Involved in positive regulation of cell size and positive regulation of translation.

Source: NCBI Gene 51334 — RefSeq curated summary.

At a glance

• GWAS associations: 15
• Clinical variants (ClinVar): 56 total
• MANE Select transcript: NM_001300783

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:29654
Approved symbol	PRR16
Name	proline rich 16
Location	5q23.1
Locus type	gene with protein product
Status	Approved
Aliases	DSC54
Ensembl gene	ENSG00000184838
Ensembl biotype	protein_coding
OMIM	615931
Entrez	51334

Gene structure

Transcript identifiers

Ensembl transcripts: 5 — 5 protein_coding

ENST00000379551, ENST00000407149, ENST00000446965, ENST00000505123, ENST00000509923

RefSeq mRNA: 4 — MANE Select: NM_001300783 NM_001300783, NM_001308087, NM_001308088, NM_016644

CCDS: CCDS4127, CCDS75290, CCDS78053

Canonical transcript exons

ENST00000407149 — 2 exons

Exon	Start	End
ENSE00001555386	120464300	120464645
ENSE00003845878	120685954	120687314

Expression profiles

Bgee: expression breadth ubiquitous, 205 present calls, max score 90.46.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 13.4360 / max 371.3172, expressed in 1228 samples.

FANTOM5 promoters (6 alternative TSS)

Promoter ID	TPM avg	Samples expressed
58171	13.2350	1226
58172	0.1191	46
58174	0.0309	3
58170	0.0272	3
203670	0.0135	3
58169	0.0103	3

Top tissues by expression

276 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
stromal cell of endometrium	CL:0002255	90.46	gold quality
descending thoracic aorta	UBERON:0002345	88.65	gold quality
oocyte	CL:0000023	88.22	gold quality
thoracic aorta	UBERON:0001515	85.52	gold quality
ascending aorta	UBERON:0001496	85.30	gold quality
hindlimb stylopod muscle	UBERON:0004252	85.04	gold quality
secondary oocyte	CL:0000655	84.34	gold quality
vastus lateralis	UBERON:0001379	84.13	gold quality
right lung	UBERON:0002167	83.70	gold quality
aorta	UBERON:0000947	83.55	gold quality
right coronary artery	UBERON:0001625	82.83	gold quality
quadriceps femoris	UBERON:0001377	82.34	gold quality
popliteal artery	UBERON:0002250	82.29	gold quality
tibial artery	UBERON:0007610	82.29	gold quality
body of uterus	UBERON:0009853	82.26	gold quality
left coronary artery	UBERON:0001626	81.92	gold quality
endocervix	UBERON:0000458	81.74	gold quality
biceps brachii	UBERON:0001507	80.47	gold quality
coronary artery	UBERON:0001621	80.02	gold quality
muscle organ	UBERON:0001630	79.85	gold quality
muscle of leg	UBERON:0001383	79.76	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	79.52	gold quality
subcutaneous adipose tissue	UBERON:0002190	78.52	gold quality
gastrocnemius	UBERON:0001388	78.48	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	78.24	gold quality
heart left ventricle	UBERON:0002084	78.13	gold quality
cardiac ventricle	UBERON:0002082	77.64	gold quality
skeletal muscle tissue	UBERON:0001134	77.24	gold quality
upper lobe of left lung	UBERON:0008952	77.04	gold quality
calcaneal tendon	UBERON:0003701	76.63	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-CURD-119	yes	12.29
E-ANND-3	yes	5.09

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

68 targeting PRR16, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-5692B	100.00	71.32	2622
HSA-MIR-5692C	100.00	71.32	2622
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-3662	99.99	73.82	5684
HSA-MIR-548AW	99.99	72.57	3559
HSA-MIR-568	99.98	69.86	2084
HSA-MIR-27A-3P	99.98	72.13	2955
HSA-MIR-27B-3P	99.98	72.13	2955
HSA-MIR-9985	99.98	72.11	2939
HSA-MIR-12136	99.98	72.81	5713
HSA-MIR-551B-5P	99.96	71.28	3493
HSA-MIR-302E	99.96	70.74	2669
HSA-MIR-4760-3P	99.93	70.50	2385
HSA-MIR-3119	99.92	71.34	2390
HSA-MIR-374A-5P	99.90	71.34	2923
HSA-MIR-374B-5P	99.90	69.98	2734
HSA-MIR-106A-5P	99.90	73.94	2683
HSA-MIR-7162-3P	99.89	68.16	1682
HSA-MIR-548E-5P	99.89	72.73	4486
HSA-MIR-17-5P	99.89	73.83	2665
HSA-MIR-106B-5P	99.88	74.72	2795
HSA-MIR-20A-5P	99.88	74.76	2769
HSA-MIR-20B-5P	99.88	74.01	2621
HSA-MIR-519D-3P	99.88	73.97	2607
HSA-MIR-93-5P	99.88	73.98	2606
HSA-MIR-526B-3P	99.88	74.06	2587
HSA-MIR-12119	99.87	68.35	1653
HSA-MIR-137-3P	99.87	74.74	2401

Literature-anchored findings (GeneRIF, showing 1)

• Largen, the product of a gene PRR16, increases cell size upon overexpression in human cells. (PMID:24656129)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	prr16	ENSDARG00000101530
mus_musculus	Prr16	ENSMUSG00000073565
rattus_norvegicus	AABR07032097.1	ENSRNOG00000019744

Paralogs (1): INSYN1 (ENSG00000205363)

Protein

Protein identifiers

Protein Largen — Q569H4 (reviewed: Q569H4)

Alternative names: Mesenchymal stem cell protein DSC54, Proline-rich protein 16

All UniProt accessions (3): Q569H4, A0A0A0MSW7, D6RGF0

UniProt curated annotations — full annotation on UniProt →

Function. Regulator of cell size that promotes cell size increase independently of mTOR and Hippo signaling pathways. Acts by stimulating the translation of specific mRNAs, including those encoding proteins affecting mitochondrial functions. Increases mitochondrial mass and respiration.

Miscellaneous. Was named ‘Largen’ because overexpression causes cells enlargement.

Isoforms (3)

UniProt ID	Names	Canonical?
Q569H4-1	1	yes
Q569H4-2	2
Q569H4-3	3

RefSeq proteins (4): NP_001287712, NP_001295016, NP_001295017, NP_057728 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR027997	Largen/INSYN1	Family

Pfam: PF15252

UniProt features (14 total): compositionally biased region 5, region of interest 4, splice variant 2, chain 1, sequence variant 1, coiled-coil region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q569H4-F1	63.69	0.14

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 122 (showing top): AAGCAAT_MIR137, LEE_NEURAL_CREST_STEM_CELL_DN, BUYTAERT_PHOTODYNAMIC_THERAPY_STRESS_DN, CTATGCA_MIR153, GOBP_TRANSLATION, SENESE_HDAC1_AND_HDAC2_TARGETS_DN, GOBP_POST_TRANSCRIPTIONAL_REGULATION_OF_GENE_EXPRESSION, GOBP_REGULATION_OF_ANATOMICAL_STRUCTURE_SIZE, DAWSON_METHYLATED_IN_LYMPHOMA_TCL1, GOBP_REGULATION_OF_CELL_SIZE, TGACATY_UNKNOWN, ONDER_CDH1_TARGETS_2_UP, GOBP_POSITIVE_REGULATION_OF_CELL_SIZE, HAN_SATB1_TARGETS_DN, CHEN_HOXA5_TARGETS_9HR_DN

GO Biological Process (2): positive regulation of translation (GO:0045727), positive regulation of cell size (GO:0045793)

GO Molecular Function (1): protein binding (GO:0005515)

GO Cellular Component (0):

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
translation	1
regulation of translation	1
positive regulation of gene expression	1
positive regulation of protein metabolic process	1
regulation of cell size	1
binding	1

Protein interactions and networks

STRING

404 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
PRR16	PRR12	Q9ULL5	540
PRR16	TMEM154	Q6P9G4	487
PRR16	CDX4	O14627	415
PRR16	KRTAP10-1	P60331	395
PRR16	FRG2B	Q96QU4	394
PRR16	PRR20A	P86496	380
PRR16	COBL	O75128	380
PRR16	C10orf67	Q8IYJ2	380
PRR16	ZFHX4	Q86UP3	373
PRR16	CCDC89	Q8N998	372
PRR16	CCDC18	Q5T9S5	361
PRR16	PRR9	Q5T870	358
PRR16	VPS13D	Q5THJ4	349
PRR16	RHOV	Q96L33	347
PRR16	DAW1	Q8N136	341

IntAct

145 interactions, top by confidence:

A	B	Type	Score
ABI2	PRR16	psi-mi:“MI:0915”(physical association)	0.670
PRR16	DLG4	psi-mi:“MI:0915”(physical association)	0.590
PRR16	DLG4	psi-mi:“MI:0407”(direct interaction)	0.590
DLG4	PRR16	psi-mi:“MI:0407”(direct interaction)	0.590
NCK2	PRR16	psi-mi:“MI:0915”(physical association)	0.560
PRR16	ABI2	psi-mi:“MI:0915”(physical association)	0.560
NOD2	PRR16	psi-mi:“MI:0915”(physical association)	0.510
PRR16	NOD2	psi-mi:“MI:0915”(physical association)	0.510
PRR16	DAPK1	psi-mi:“MI:0407”(direct interaction)	0.440
PRR16	DLG1	psi-mi:“MI:0407”(direct interaction)	0.440
PRR16	MAGI2	psi-mi:“MI:0407”(direct interaction)	0.440
PRR16	DLG2	psi-mi:“MI:0407”(direct interaction)	0.440
MAGI3	PRR16	psi-mi:“MI:0407”(direct interaction)	0.440
PRR16	SNX27	psi-mi:“MI:0407”(direct interaction)	0.440
PRR16	DLG3	psi-mi:“MI:0407”(direct interaction)	0.440
PRR16	MAST2	psi-mi:“MI:0407”(direct interaction)	0.440
PRR16	LNX2	psi-mi:“MI:0407”(direct interaction)	0.440
PRR16	MAGI1	psi-mi:“MI:0407”(direct interaction)	0.440
PRR16	GORASP2	psi-mi:“MI:0407”(direct interaction)	0.440
PRR16	PDZD7	psi-mi:“MI:0407”(direct interaction)	0.440

BioGRID (19): PRR16 (Two-hybrid), PRR16 (Biochemical Activity), PRR16 (Reconstituted Complex), PRR16 (Two-hybrid), ABI2 (Two-hybrid), PRR16 (Two-hybrid), PRR16 (Two-hybrid), PRR16 (Proximity Label-MS), PRR16 (Two-hybrid), PRR16 (Affinity Capture-RNA), GCLC (Affinity Capture-MS), PRR16 (Positive Genetic), PRR16 (Cross-Linking-MS (XL-MS)), SND1 (Cross-Linking-MS (XL-MS)), PRR16 (Reconstituted Complex)

ESM2 similar proteins: A0JLT2, A3KMN5, A7XYH9, A7XYI6, A7XYQ1, B3DM43, F1M8W4, O42400, O94885, P35710, P35711, P40647, P43322, P57094, P57095, P59808, P78312, Q02297, Q05199, Q08495, Q08C81, Q08DM1, Q0P5V2, Q32NP7, Q3UH68, Q52KW0, Q569H4, Q56A10, Q5F368, Q5R4B6, Q5R8Q8, Q5U2R6, Q6DR98, Q6PD31, Q7TQG1, Q80Z38, Q8BLB8, Q8C1B1, Q8C1S0, Q8CGI1

Diamond homologs: A3KMN5, Q1L899, Q569H4, A7YWL5, B0BN13, Q2T9L4, Q5PQ25, Q8CD60

SIGNOR signaling

1 interactions.

A	Effect	B	Mechanism
SMURF1	unknown	PRR16	ubiquitination

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 86 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Ras activation upon Ca2+ influx through NMDA receptor	5	49.2×	2e-06
Unblocking of NMDA receptors, glutamate binding and activation	5	46.9×	2e-06
Negative regulation of NMDA receptor-mediated neuronal transmission	5	46.9×	2e-06
Assembly and cell surface presentation of NMDA receptors	10	43.8×	2e-12
Dopamine Neurotransmitter Release Cycle	5	42.8×	3e-06
Long-term potentiation	5	41.0×	3e-06
Neurexins and neuroligins	11	37.3×	1e-12
Protein-protein interactions at synapses	7	32.0×	1e-07

GO biological processes:

GO term	Partners	Fold	FDR
establishment or maintenance of epithelial cell apical/basal polarity	11	77.0×	4e-16
protein localization to synapse	6	55.4×	1e-07
receptor clustering	7	52.6×	1e-08
regulation of postsynaptic membrane neurotransmitter receptor levels	7	41.8×	5e-08
protein-containing complex assembly	9	12.3×	4e-06
cell-cell adhesion	9	11.0×	9e-06
regulation of small GTPase mediated signal transduction	5	8.7×	6e-03
chemical synaptic transmission	7	6.5×	3e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

56 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	48
Likely benign	6
Benign	1

Top pathogenic / likely-pathogenic (0)

SpliceAI

1884 predictions. Top by Δscore:

Variant	Effect	Δscore
5:120464622:G:GT	donor_gain	1.0000
5:120464634:GAACT:G	donor_gain	1.0000
5:120464642:GGAG:G	donor_gain	1.0000
5:120464643:G:GT	donor_gain	1.0000
5:120464643:GAG:G	donor_gain	1.0000
5:120464646:GTGAG:G	donor_loss	1.0000
5:120464647:T:G	donor_loss	1.0000
5:120469038:A:T	donor_gain	1.0000
5:120464368:G:GT	donor_gain	0.9900
5:120464635:A:T	donor_gain	0.9900
5:120464646:G:GG	donor_gain	0.9900
5:120684347:G:GT	donor_gain	0.9900
5:120685949:ACTAG:A	acceptor_gain	0.9900
5:120685950:C:G	acceptor_gain	0.9900
5:120685950:CTA:C	acceptor_loss	0.9900
5:120685951:TAGGT:T	acceptor_loss	0.9900
5:120685953:G:C	acceptor_loss	0.9900
5:120685953:GGT:G	acceptor_gain	0.9900
5:120464644:A:T	donor_gain	0.9800
5:120685949:A:AG	acceptor_gain	0.9800
5:120685952:A:AG	acceptor_gain	0.9800
5:120685952:AGGT:A	acceptor_gain	0.9800
5:120685953:G:GG	acceptor_gain	0.9800
5:120685953:GGTG:G	acceptor_gain	0.9800
5:120469083:T:G	donor_gain	0.9700
5:120685180:G:GT	donor_gain	0.9700
5:120464643:G:T	donor_gain	0.9600
5:120521002:GGAA:G	donor_gain	0.9600
5:120534773:T:G	acceptor_gain	0.9600
5:120534833:GTCAT:G	donor_gain	0.9600

AlphaMissense

1974 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
5:120464617:T:C	L44P	1.000
5:120464638:T:A	L51H	1.000
5:120464638:T:C	L51P	1.000
5:120464575:T:C	I30T	0.999
5:120464596:T:C	L37S	0.999
5:120464608:T:A	L41Q	0.999
5:120464608:T:C	L41P	0.999
5:120464617:T:A	L44Q	0.999
5:120464628:G:C	A48P	0.999
5:120464629:C:A	A48D	0.999
5:120685958:T:A	V55D	0.999
5:120685967:T:A	I58N	0.999
5:120685967:T:G	I58S	0.999
5:120685976:T:C	L61P	0.999
5:120464575:T:G	I30S	0.998
5:120464584:T:A	I33N	0.998
5:120464596:T:G	L37W	0.998
5:120464605:T:A	V40D	0.998
5:120685964:A:C	Q57P	0.998
5:120685967:T:C	I58T	0.998
5:120685976:T:A	L61Q	0.998
5:120685988:T:C	L65P	0.998
5:120686413:T:C	F207L	0.998
5:120686414:T:C	F207S	0.998
5:120686415:T:A	F207L	0.998
5:120686415:T:G	F207L	0.998
5:120686685:G:C	R297S	0.998
5:120686685:G:T	R297S	0.998
5:120464575:T:A	I30N	0.997
5:120464597:G:C	L37F	0.997

dbSNP variants (sampled 300 via entrez): RS1000017148 (5:120615389 T>C), RS1000018236 (5:120772564 TAAAAGCTACTAACTTCTTTA>T), RS1000022857 (5:120470697 C>A,T), RS1000027755 (5:120778136 ACTG>A), RS1000051078 (5:120549519 T>C), RS1000056395 (5:120621119 C>A), RS1000060302 (5:120489320 A>G), RS1000061624 (5:120746933 A>G), RS1000068278 (5:120584443 A>G), RS1000069881 (5:120602265 A>G), RS1000073932 (5:120713291 C>A), RS1000076407 (5:120652149 T>A), RS1000076439 (5:120767033 G>A), RS1000078033 (5:120476625 G>T), RS1000080321 (5:120549154 G>A,T)

Disease associations

OMIM: gene MIM:615931 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

15 associations (top):

Study	Trait	p-value
GCST001537_9	Immune reponse to smallpox (secreted IL-12p40)	9.000000e-08
GCST002104_14	Bronchopulmonary dysplasia	4.000000e-06
GCST002575_1	Body mass index (change over time)	4.000000e-07
GCST002701_32	Verbal declarative memory	9.000000e-07
GCST003075_121	Cognitive decline rate in late mild cognitive impairment	9.000000e-07
GCST003075_122	Cognitive decline rate in late mild cognitive impairment	2.000000e-06
GCST003075_29	Cognitive decline rate in late mild cognitive impairment	2.000000e-08
GCST003772_7	Loneliness (linear analysis)	2.000000e-06
GCST006629_100	Pulse pressure	4.000000e-10
GCST008152_122	Weight	4.000000e-06
GCST009321_1	Verbal cognitive ability	5.000000e-06
GCST009322_2	Numerical cognitive ability	1.000000e-06
GCST009441_2	Age-related cognitive decline (memory) (slope of z-scores)	7.000000e-07
GCST009444_3	Age-related cognitive decline (global cognition) (slope of z-scores)	2.000000e-06
GCST010988_339	Adult body size	2.000000e-10

EFO canonical traits (11, from GWAS)

EFO ID	Trait name
EFO:0004645	response to vaccine
EFO:0004873	cytokine measurement
EFO:0005937	longitudinal BMI measurement
EFO:0004874	memory performance
EFO:0006805	word list delayed recall measurement
EFO:0007710	cognitive decline measurement
EFO:0007865	loneliness measurement
EFO:0005763	pulse pressure measurement
EFO:0004338	body weight
EFO:0007797	language measurement
EFO:0008354	cognitive function measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

41 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	decreases expression, increases expression	4
arsenite	affects binding, increases reaction, increases methylation	2
entinostat	increases expression, affects cotreatment	2
Arsenic Trioxide	decreases expression, increases expression	2
Panobinostat	affects cotreatment, increases expression	2
Air Pollutants	decreases expression, increases abundance	2
Arsenic	affects methylation, affects cotreatment, increases abundance, increases expression	2
Calcitriol	decreases expression, affects cotreatment	2
Phenylmercuric Acetate	affects cotreatment, increases expression	2
Testosterone	affects cotreatment, decreases expression	2
Tretinoin	decreases expression	2
Aflatoxin B1	increases methylation, decreases methylation	2
Particulate Matter	decreases expression, increases abundance	2
bisphenol A	affects cotreatment, decreases methylation	1
trichostatin A	increases expression	1
sodium arsenite	affects cotreatment, increases abundance, increases expression	1
manganese chloride	increases abundance, increases expression, affects cotreatment	1
didecyldimethylammonium	decreases expression	1
potassium chromate(VI)	decreases expression	1
nickel sulfate	increases expression	1
beta-methylcholine	affects expression	1
2-palmitoylglycerol	increases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	increases expression, affects cotreatment	1
dorsomorphin	affects cotreatment, increases expression	1
NSC 689534	affects binding, decreases expression	1
(+)-JQ1 compound	decreases expression	1
Fulvestrant	affects cotreatment, decreases methylation	1
Benzo(a)pyrene	affects methylation	1
Copper	decreases expression, affects binding	1
Dexamethasone	increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.