PRR18

Summary

PRR18 (proline rich 18, HGNC:28574) is a protein-coding gene on chromosome 6q27, encoding Proline-rich protein 18 (Q8N4B5).

At a glance

• GWAS associations: 2
• Clinical variants (ClinVar): 54 total — 1 pathogenic
• MANE Select transcript: NM_175922

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:28574
Approved symbol	PRR18
Name	proline rich 18
Location	6q27
Locus type	gene with protein product
Status	Approved
Aliases	MGC35308
Ensembl gene	ENSG00000176381
Ensembl biotype	protein_coding
Entrez	285800

Gene structure

Transcript identifiers

Ensembl transcripts: 2 — 2 protein_coding

ENST00000322583, ENST00000529616

RefSeq mRNA: 1 — MANE Select: NM_175922 NM_175922

CCDS: CCDS5291

Canonical transcript exons

ENST00000322583 — 1 exons

Exon	Start	End
ENSE00002060813	166305300	166308392

Expression profiles

Bgee: expression breadth ubiquitous, 105 present calls, max score 98.52.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 1.3615 / max 162.0849, expressed in 103 samples.

FANTOM5 promoters (6 alternative TSS)

Promoter ID	TPM avg	Samples expressed
76669	0.6993	81
76672	0.4982	82
76671	0.0584	38
76670	0.0479	32
76668	0.0346	22
204288	0.0231	13

Top tissues by expression

215 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
endothelial cell	CL:0000115	98.52	gold quality
inferior vagus X ganglion	UBERON:0005363	94.78	gold quality
lateral globus pallidus	UBERON:0002476	93.63	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	92.55	gold quality
spinal cord	UBERON:0002240	92.12	gold quality
Brodmann (1909) area 46	UBERON:0006483	92.09	gold quality
subthalamic nucleus	UBERON:0001906	91.60	gold quality
substantia nigra pars reticulata	UBERON:0001966	91.54	gold quality
midbrain	UBERON:0001891	90.37	gold quality
substantia nigra	UBERON:0002038	90.33	gold quality
globus pallidus	UBERON:0001875	90.28	gold quality
ventral tegmental area	UBERON:0002691	90.26	gold quality
Ammon’s horn	UBERON:0001954	90.09	gold quality
postcentral gyrus	UBERON:0002581	90.07	gold quality
bronchial epithelial cell	CL:0002328	89.92	gold quality
dorsal plus ventral thalamus	UBERON:0001897	89.50	gold quality
medulla oblongata	UBERON:0001896	89.44	gold quality
parietal lobe	UBERON:0001872	89.40	gold quality
medial globus pallidus	UBERON:0002477	89.19	gold quality
entorhinal cortex	UBERON:0002728	89.16	gold quality
bronchus	UBERON:0002185	88.47	gold quality
putamen	UBERON:0001874	88.38	gold quality
substantia nigra pars compacta	UBERON:0001965	88.07	gold quality
superior vestibular nucleus	UBERON:0007227	87.88	gold quality
temporal lobe	UBERON:0001871	87.55	gold quality
amygdala	UBERON:0001876	87.17	gold quality
corpus callosum	UBERON:0002336	87.00	gold quality
occipital lobe	UBERON:0002021	86.82	gold quality
primary visual cortex	UBERON:0002436	86.47	gold quality
caudate nucleus	UBERON:0001873	85.42	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	1.86

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

49 targeting PRR18, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6867-5P	100.00	82.21	3464
HSA-MIR-6077	99.99	68.04	2299
HSA-MIR-4500	99.99	72.72	2367
HSA-MIR-520D-5P	99.98	73.34	4883
HSA-MIR-524-5P	99.98	73.43	4882
HSA-MIR-499A-5P	99.98	70.79	1323
HSA-MIR-507	99.97	70.11	1915
HSA-MIR-3119	99.92	71.34	2390
HSA-MIR-515-5P	99.92	69.82	2343
HSA-MIR-519E-5P	99.92	69.62	2358
HSA-MIR-8063	99.91	69.76	3146
HSA-MIR-3671	99.90	73.04	3897
HSA-MIR-369-3P	99.85	70.52	2264
HSA-MIR-4447	99.85	67.81	2900
HSA-MIR-4698	99.84	71.41	4303
HSA-MIR-6842-5P	99.80	67.54	1587
HSA-MIR-7110-5P	99.80	67.84	1712
HSA-MIR-4802-3P	99.72	70.13	1273
HSA-MIR-7-5P	99.67	70.53	1809
HSA-MIR-519A-3P	99.67	71.67	1868
HSA-MIR-519B-3P	99.67	71.67	1868
HSA-MIR-519C-3P	99.67	71.67	1870
HSA-MIR-298	99.63	67.56	1916
HSA-MIR-12123	99.52	71.79	2990
HSA-MIR-4672	99.50	71.58	2893
HSA-MIR-519D-5P	99.41	69.30	2057
HSA-MIR-329-5P	99.27	68.11	1597
HSA-MIR-520E-5P	99.27	68.90	1513
HSA-MIR-664A-3P	99.22	71.08	2696
HSA-MIR-6074	98.89	69.64	2187

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	prr18	ENSDARG00000093768
mus_musculus	Prr18	ENSMUSG00000055945
rattus_norvegicus	Prr18	ENSRNOG00000070586
drosophila_melanogaster	Rtnl2	FBGN0015831
drosophila_melanogaster	Rtnl1	FBGN0053113

Paralogs (4): RTN4 (ENSG00000115310), RTN2 (ENSG00000125744), RTN3 (ENSG00000133318), RTN1 (ENSG00000139970)

Protein

Protein identifiers

Proline-rich protein 18 — Q8N4B5 (reviewed: Q8N4B5)

All UniProt accessions (2): Q8N4B5, E9PL31

RefSeq proteins (1): NP_787118* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR031369	PRR18	Family

Pfam: PF15671

UniProt features (12 total): modified residue 4, compositionally biased region 4, region of interest 2, chain 1, sequence variant 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q8N4B5-F1	63.32	0.13

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (4): 188, 47, 83, 172

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 35 (showing top): BENPORATH_ES_WITH_H3K27ME3, GATA3_01, SENGUPTA_NASOPHARYNGEAL_CARCINOMA_DN, GATA1_04, chr6q27, GATA_Q6, GATA_C, DODD_NASOPHARYNGEAL_CARCINOMA_DN, FIGUEROA_AML_METHYLATION_CLUSTER_2_UP, FIGUEROA_AML_METHYLATION_CLUSTER_3_UP, FIGUEROA_AML_METHYLATION_CLUSTER_7_UP, PBXIP1_TARGET_GENES, MIR6867_5P, MIR4672, MIR664A_3P

GO Biological Process (0):

GO Molecular Function (0):

GO Cellular Component (0):

Protein interactions and networks

STRING

936 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
PRR18	SFT2D1	Q8WV19	652
PRR18	C6orf118	Q5T5N4	625
PRR18	FAM43B	Q6ZT52	495
PRR18	WRNIP1	Q96S55	479
PRR18	B9ZVM9	B9ZVM9	473
PRR18	SHISA8	B8ZZ34	438
PRR18	RNFT2	Q96EX2	422
PRR18	MPC1	Q9Y5U8	399
PRR18	PHETA2	Q6ICB4	393
PRR18	PDE10A	Q9Y233	393
PRR18	Q12799	Q12799	376
PRR18	C6orf120	Q7Z4R8	375
PRR18	ERMARD	Q5T6L9	374
PRR18	HROB	Q8N3J3	372
PRR18	PACRG	Q96M98	372
PRR18	DBNDD1	Q9H9R9	372

IntAct

0 interactions, top by confidence:

ESM2 similar proteins: A0A0U1RQ45, A0A0U1RQS6, A0A286YF58, A0A2R8YCJ5, A0A7I2V3R4, A2A699, A2VDX9, A6NCS6, A6NGB7, A6NJG2, A6NKF7, A6NKL6, A6NLJ0, A8MVW0, B2RU40, B7Z1M9, B8ZZ34, C9JH25, C9JVW0, D4A9R4, J3QNX5, M0QZC1, P03971, P0CG09, P0DPE3, Q0PHV7, Q0VD38, Q14761, Q29RK8, Q29RM6, Q2KJ18, Q2M3G4, Q2M3V2, Q5T442, Q64697, Q69YZ2, Q6F5E0, Q6NY19, Q6UXK2, Q80XF7

Diamond homologs: Q6PAN7, Q8N4B5

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

54 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	0
Uncertain significance	51
Likely benign	2
Benign	0

Top pathogenic / likely-pathogenic (1)

Variant ID	HGVS	Classification
144539	GRCh38/hg38 6q25.3-27(chr6:160484810-170612011)x1	Pathogenic

SpliceAI

128 predictions. Top by Δscore:

Variant	Effect	Δscore
6:166308276:T:TA	donor_gain	0.9100
6:166308350:C:CA	donor_gain	0.8300
6:166306045:T:C	donor_gain	0.7800
6:166308337:T:TA	donor_gain	0.7800
6:166308244:CCCA:C	donor_loss	0.7500
6:166308245:CCAC:C	donor_loss	0.7500
6:166308246:CACCT:C	donor_loss	0.7500
6:166308248:C:A	donor_loss	0.7500
6:166306044:ATCT:A	donor_gain	0.7400
6:166308241:ACAC:A	donor_loss	0.7300
6:166308242:CACC:C	donor_loss	0.7300
6:166308243:ACCC:A	donor_loss	0.7300
6:166308249:C:G	donor_loss	0.7200
6:166307349:TTGCG:T	donor_gain	0.7100
6:166307350:TGCGT:T	donor_gain	0.7100
6:166308240:CACA:C	donor_loss	0.6700
6:166308171:CC:C	acceptor_gain	0.6500
6:166308172:CC:C	acceptor_gain	0.6500
6:166308239:CCACA:C	donor_loss	0.6500
6:166308170:CCC:C	acceptor_gain	0.6000
6:166308171:CCC:C	acceptor_gain	0.6000
6:166308250:T:C	donor_loss	0.6000
6:166308170:CCCCT:C	acceptor_loss	0.5900
6:166308171:CCCT:C	acceptor_loss	0.5900
6:166308172:CCTGG:C	acceptor_loss	0.5900
6:166308173:CTG:C	acceptor_loss	0.5900
6:166308174:T:G	acceptor_loss	0.5900
6:166308175:GGAAA:G	acceptor_loss	0.5700
6:166308176:GAAA:G	acceptor_loss	0.5700
6:166308177:AAAGA:A	acceptor_loss	0.5700

AlphaMissense

1831 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
6:166307336:C:A	W269C	0.999
6:166307336:C:G	W269C	0.999
6:166307338:A:G	W269R	0.996
6:166307338:A:T	W269R	0.996
6:166307421:T:A	N241I	0.994
6:166307407:A:G	Y246H	0.991
6:166307334:A:G	L270P	0.990
6:166307420:G:C	N241K	0.990
6:166307420:G:T	N241K	0.990
6:166307703:A:G	I147T	0.990
6:166307392:A:G	Y251H	0.989
6:166307403:T:A	D247V	0.988
6:166307406:T:C	Y246C	0.987
6:166307347:A:G	C266R	0.986
6:166307703:A:C	I147S	0.986
6:166307337:C:G	W269S	0.985
6:166307703:A:T	I147N	0.985
6:166307716:C:G	A143P	0.984
6:166307999:C:A	W48C	0.984
6:166307999:C:G	W48C	0.984
6:166307406:T:G	Y246S	0.982
6:166307424:A:T	L240H	0.982
6:166307345:G:C	C266W	0.981
6:166307400:T:A	D248V	0.981
6:166307695:G:T	R150S	0.980
6:166308001:A:G	W48R	0.980
6:166308001:A:T	W48R	0.980
6:166307391:T:C	Y251C	0.978
6:166307738:G:C	F135L	0.978
6:166307738:G:T	F135L	0.978

dbSNP variants (sampled 300 via entrez): RS1000180262 (6:166306982 C>T), RS1000233890 (6:166306781 C>A,T), RS1000964165 (6:166306341 A>T), RS1000996993 (6:166305973 G>A), RS1001691589 (6:166306444 A>G), RS1003341140 (6:166305045 G>A), RS1003890385 (6:166306929 G>C), RS1004006694 (6:166306768 C>G), RS1004673774 (6:166307277 CGTGAGTCCAGGGCCCCCGCCCGGCCCCGCGCGGCAGCCGCG>C), RS1005374670 (6:166308117 G>A,T), RS1005462869 (6:166310367 G>A), RS1005561700 (6:166307679 T>G), RS1006379378 (6:166309330 A>C), RS1006987319 (6:166308097 C>A,T), RS1007266756 (6:166308859 A>G)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST000785_35	Longevity	1.000000e-06
GCST006035_7	Breast cancer and/or colorectal cancer	5.000000e-06

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

11 total (human), top 11 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
aristolochic acid I	increases expression	1
bisphenol A	decreases methylation	1
kojic acid	decreases expression	1
ferrous chloride	increases expression	1
S-(1,2-dichlorovinyl)cysteine	decreases reaction, increases expression	1
licochalcone B	increases expression	1
Arbutin	decreases expression	1
Benzo(a)pyrene	affects methylation	1
Formaldehyde	increases expression	1
Lipopolysaccharides	increases expression, decreases reaction	1
Tobacco Smoke Pollution	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.