PRSS8

Summary

PRSS8 (serine protease 8, HGNC:9491) is a protein-coding gene on chromosome 16p11.2, encoding Prostasin (Q16651). Possesses a trypsin-like cleavage specificity with a preference for poly-basic substrates.

This gene encodes a member of the peptidase S1 or chymotrypsin family of serine proteases. The encoded preproprotein is proteolytically processed to generate light and heavy chains that associate via a disulfide bond to form the heterodimeric enzyme. This enzyme is highly expressed in prostate epithelia and is one of several proteolytic enzymes found in seminal fluid. This protease exhibits trypsin-like substrate specificity, cleaving protein substrates at the carboxyl terminus of lysine or arginine residues. The encoded protease partially mediates proteolytic activation of the epithelial sodium channel, a regulator of sodium balance, and may also play a role in epithelial barrier formation.

Source: NCBI Gene 5652 — RefSeq curated summary.

At a glance

• Gene–disease (curated): ichthyosis (Moderate, GenCC)
• GWAS associations: 2
• Clinical variants (ClinVar): 41 total
• GTEx eGene: eQTL in 14 tissues, sQTL in 5 (q < 0.05)
• Constraint (gnomAD): pLI 0.02 (LoF-tolerant), LOEUF 0.79 (unconstrained)
• MANE Select transcript: NM_002773

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:9491
Approved symbol	PRSS8
Name	serine protease 8
Location	16p11.2
Locus type	gene with protein product
Status	Approved
Aliases	CAP1
Ensembl gene	ENSG00000052344
Ensembl biotype	protein_coding
OMIM	600823
Entrez	5652

Gene structure

Transcript identifiers

Ensembl transcripts: 10 — 5 protein_coding, 3 nonsense_mediated_decay, 2 retained_intron

MANE Select: ENST00000317508

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 2, TSL 2: 2, TSL 3: 1, TSL 4: 1

ENST00000317508, ENST00000564025, ENST00000567531, ENST00000567797, ENST00000567833, ENST00000568261, ENST00000964168, ENST00001001152, ENST00001051200, ENST00001082594

RefSeq mRNA: 1 — MANE Select: NM_002773 NM_002773

CCDS: CCDS45469

Canonical transcript exons

ENST00000317508 — 6 exons

Exon	Start	End
ENSE00000675944	31132429	31132595
ENSE00000675945	31132682	31132953
ENSE00001257144	31131433	31132335
ENSE00001349429	31133226	31133388
ENSE00003487726	31135414	31135727
ENSE00003505181	31135154	31135171

Expression profiles

Bgee: expression breadth ubiquitous, 201 present calls, max score 98.95.

FANTOM5 (CAGE): breadth broad, TPM avg 34.3050 / max 827.4411, expressed in 593 samples.

Highest expression (Bgee): mucosa of transverse colon, lower esophagus mucosa, minor salivary gland, ileal mucosa, body of pancreas.

Genetic regulation across tissues (GTEx eQTL / sQTL)

PRSS8 is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 14 tissues and its splicing (sQTL) in 5 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

19 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Esophagus Mucosa	sqtl	9.5e-54	-1.96	16:31135418:C:G
Thyroid	sqtl	9.0e-50	-2.16	16:31135418:C:G
Esophagus Mucosa	eqtl	1.9e-06	-0.09	16:31091000:C:T
Pituitary	eqtl	2.4e-05	-0.21	16:31161713:T:G
Thyroid	eqtl	3.9e-05	-0.12	16:31124764:T:C
Skin Sun Exposed Lower leg	eqtl	7.6e-04	-0.08	16:30958164:T:TG
Pituitary	sqtl	8.4e-04	+1.17	16:31096606:T:C
Brain Cerebellum	eqtl	1.4e-03	-0.35	16:31108233:G:A
Kidney Cortex	sqtl	3.6e-03	-1.37	16:31096606:T:C
Skin Not Sun Exposed Suprapubic	eqtl	5.0e-03	+0.12	16:31167479:C:T
Bladder	eqtl	1.5e-02	+2.32	16:31866622:C:T
Prostate	sqtl	1.6e-02	-1.45	16:31113603:A:G
Esophagus Gastroesophageal Junction	eqtl	2.0e-02	-1.30	16:31370749:T:G
Nerve Tibial	eqtl	2.2e-02	+0.96	16:30730338:C:CGCTTAAACCACAAGAGCATTT
Adipose Visceral Omentum	eqtl	2.7e-02	+0.57	16:30933902:G:A
Cells EBV-transformed lymphocytes	eqtl	3.3e-02	-0.65	16:30315642:T:C
Artery Tibial	eqtl	3.5e-02	-0.76	16:30582123:C:G
Lung	eqtl	4.1e-02	+0.09	16:30841462:G:A
Brain Cerebellar Hemisphere	eqtl	5.0e-02	+1.63	16:30626935:A:G

FANTOM5 promoters

2 alternative TSS:

Promoter ID	TPM avg	Samples expressed
157141	28.4629	584
157140	5.8421	486

Top tissues by expression

showing 100 of 284 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
mucosa of transverse colon	UBERON:0004991	98.95	gold quality
lower esophagus mucosa	UBERON:0035834	98.89	gold quality
minor salivary gland	UBERON:0001830	97.04	gold quality
ileal mucosa	UBERON:0000331	97.01	gold quality
body of pancreas	UBERON:0001150	96.96	gold quality
skin of abdomen	UBERON:0001416	96.73	gold quality
skin of leg	UBERON:0001511	96.31	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	96.25	gold quality
saliva-secreting gland	UBERON:0001044	96.22	gold quality
esophagus mucosa	UBERON:0002469	96.06	gold quality
corpus epididymis	UBERON:0004359	95.89	gold quality
rectum	UBERON:0001052	95.53	gold quality
mouth mucosa	UBERON:0003729	95.53	gold quality
duodenum	UBERON:0002114	95.52	gold quality
right lung	UBERON:0002167	95.28	gold quality
gall bladder	UBERON:0002110	95.09	gold quality
zone of skin	UBERON:0000014	94.11	gold quality
left lobe of thyroid gland	UBERON:0001120	94.10	gold quality
colonic mucosa	UBERON:0000317	93.87	gold quality
upper lobe of left lung	UBERON:0008952	93.66	gold quality
metanephros cortex	UBERON:0010533	93.65	gold quality
jejunal mucosa	UBERON:0000399	93.51	gold quality
right lobe of thyroid gland	UBERON:0001119	93.40	gold quality
upper lobe of lung	UBERON:0008948	93.38	gold quality
upper arm skin	UBERON:0004263	93.21	silver quality
mucosa of sigmoid colon	UBERON:0004993	92.80	gold quality
thyroid gland	UBERON:0002046	92.54	gold quality
small intestine Peyer’s patch	UBERON:0003454	91.96	gold quality
pancreas	UBERON:0001264	91.44	gold quality
adult mammalian kidney	UBERON:0000082	91.38	gold quality
transverse colon	UBERON:0001157	90.75	gold quality
small intestine	UBERON:0002108	90.70	gold quality
palpebral conjunctiva	UBERON:0001812	90.56	gold quality
placenta	UBERON:0001987	89.28	gold quality
body of stomach	UBERON:0001161	89.02	gold quality
parotid gland	UBERON:0001831	88.81	gold quality
lower lobe of lung	UBERON:0008949	88.81	gold quality
nasal cavity epithelium	UBERON:0005384	88.68	gold quality
nasal cavity mucosa	UBERON:0001826	87.99	gold quality
lung	UBERON:0002048	87.96	gold quality
epithelium of esophagus	UBERON:0001976	87.77	gold quality
stomach	UBERON:0000945	87.70	gold quality
esophagus squamous epithelium	UBERON:0006920	86.91	gold quality
amniotic fluid	UBERON:0000173	86.76	gold quality
islet of Langerhans	UBERON:0000006	86.70	gold quality
trachea	UBERON:0003126	86.06	gold quality
upper leg skin	UBERON:0004262	85.24	gold quality
endometrium epithelium	UBERON:0004811	85.22	gold quality
prostate gland	UBERON:0002367	84.75	gold quality
right lobe of liver	UBERON:0001114	84.67	gold quality
buccal mucosa cell	CL:0002336	83.81	gold quality
oral cavity	UBERON:0000167	83.68	gold quality
vagina	UBERON:0000996	83.46	gold quality
intestine	UBERON:0000160	83.38	gold quality
renal medulla	UBERON:0000362	82.86	gold quality
mammalian vulva	UBERON:0000997	82.63	gold quality
vermiform appendix	UBERON:0001154	82.53	gold quality
gingiva	UBERON:0001828	82.16	gold quality
kidney	UBERON:0002113	81.93	gold quality
mammary duct	UBERON:0001765	81.75	silver quality
large intestine	UBERON:0000059	81.15	gold quality
tonsil	UBERON:0002372	81.06	gold quality
epithelium of mammary gland	UBERON:0003244	81.00	silver quality
pharyngeal mucosa	UBERON:0000355	80.90	gold quality
right uterine tube	UBERON:0001302	80.62	gold quality
colon	UBERON:0001155	80.60	gold quality
penis	UBERON:0000989	80.58	gold quality
squamous epithelium	UBERON:0006914	79.53	gold quality
fundus of stomach	UBERON:0001160	79.51	gold quality
caecum	UBERON:0001153	79.44	gold quality
gingival epithelium	UBERON:0001949	79.17	silver quality
decidua	UBERON:0002450	78.16	silver quality
mucosa of stomach	UBERON:0001199	78.06	gold quality
pylorus	UBERON:0001166	77.94	gold quality
pancreatic ductal cell	CL:0002079	77.47	silver quality
esophagus	UBERON:0001043	76.16	gold quality
cauda epididymis	UBERON:0004360	76.04	gold quality
cortex of kidney	UBERON:0001225	74.85	gold quality
nipple	UBERON:0002030	74.79	gold quality
colonic epithelium	UBERON:0000397	74.74	gold quality
adenohypophysis	UBERON:0002196	74.21	gold quality
pituitary gland	UBERON:0000007	74.16	gold quality
mammary gland	UBERON:0001911	74.14	gold quality
thoracic mammary gland	UBERON:0005200	74.00	gold quality
jejunum	UBERON:0002115	73.53	gold quality
cardia of stomach	UBERON:0001162	72.96	gold quality
liver	UBERON:0002107	72.94	gold quality
endometrium	UBERON:0001295	72.07	gold quality
tongue squamous epithelium	UBERON:0006919	71.05	silver quality
epithelium of nasopharynx	UBERON:0001951	70.35	gold quality
caput epididymis	UBERON:0004358	70.01	gold quality
metanephros	UBERON:0000081	69.95	gold quality
fallopian tube	UBERON:0003889	69.71	gold quality
superior surface of tongue	UBERON:0007371	69.00	gold quality
cervix epithelium	UBERON:0004801	68.51	silver quality
uterine cervix	UBERON:0000002	68.41	gold quality
oviduct epithelium	UBERON:0004804	67.60	silver quality
bronchus	UBERON:0002185	67.57	silver quality
tongue	UBERON:0001723	67.49	silver quality
endocervix	UBERON:0000458	67.33	gold quality

Single-cell (SCXA)

Detected in 16 experiment(s), a significant marker in 15.

Experiment	Marker?	Max mean expression
E-MTAB-10885	yes	1205.64
E-MTAB-10855	yes	1164.15
E-MTAB-5061	yes	903.47
E-MTAB-9841	yes	768.33
E-MTAB-8530	yes	248.70
E-MTAB-10662	yes	164.26
E-MTAB-6701	yes	85.44
E-MTAB-10287	yes	44.62
E-GEOD-81547	yes	26.51
E-MTAB-8410	yes	23.62
E-HCAD-10	yes	18.88
E-MTAB-6678	yes	17.74
E-HCAD-1	yes	8.50
E-MTAB-9388	yes	6.86
E-MTAB-3929	no	653.56

HPA expression

RNA tissue specificity: Tissue enhanced

showing 60 of 74 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Salivary gland	tissue	231.3	low
Duodenum	tissue	146.6	medium
Small intestine	tissue	142.9	not detected
Pancreas	tissue	131.5	not detected
Colon	tissue	119.3	medium
Stomach 1	tissue	109.3	not detected
Epididymis	tissue	106.7	low
Esophagus	tissue	69.8	low
Rectum	tissue	68.2	medium
Skin 1	tissue	61.8	not detected
Vagina	tissue	55.9	not detected
Parathyroid gland	tissue	52.6	not detected
Placenta	tissue	47.9	medium
Prostate	tissue	46.0	low
Thyroid gland	tissue	45.6	not detected
Lung	tissue	45.4	not detected
Gallbladder	tissue	44.8	not detected
Kidney	tissue	33.6	not detected
Cervix	tissue	29.2	not detected
Breast	tissue	23.8	medium
Choroid plexus	tissue	14.8
Fallopian tube	tissue	14.5	low
Thymus	tissue	14.3
Appendix	tissue	14.1	not detected
Tonsil	tissue	11.1	not detected
Endometrium 1	tissue	9.3	medium
Liver	tissue	9.1	not detected
Pituitary gland	tissue	8.2
Seminal vesicle	tissue	8.0	not detected
Urinary bladder	tissue	4.6	not detected
Smooth muscle	tissue	3.3	not detected
Hypothalamus	tissue	1.3
Hippocampus	tissue	1.2	not detected
Nucleus accumbens	tissue	1.1
Cerebellum	tissue	1.1	low
Locus coeruleus	tissue	1.0
Corpus callosum	tissue	1.0
Pons	tissue	0.9
Superior colliculi	tissue	0.9
Cerebral cortex	tissue	0.8	not detected
Adipose tissue	tissue	0.8	not detected
Amygdala	tissue	0.8
Midbrain	tissue	0.8
Medulla oblongata	tissue	0.8
Thalamus	tissue	0.8
Substantia nigra	tissue	0.8
Periaqueductal gray	tissue	0.8
Olfactory bulb	tissue	0.8
Temporal cortex	tissue	0.8
Prefrontal cortex	tissue	0.7
Spinal cord	tissue	0.7
Hippocampal formation	tissue	0.7
Postcentral gyrus	tissue	0.7
Entorhinal cortex	tissue	0.7
Retrosplenial and cingulate cortex	tissue	0.7
Retrosplenial cortex	tissue	0.7
Insular cortex	tissue	0.7
Motor cortex	tissue	0.6
Basal ganglia	tissue	0.6	not detected
Ventral forebrain	tissue	0.6

Brain sub-regions (HPA Brain Atlas): detected in 190; highest nTPM — Flocculonodular lobe (5.0), Vermis (4.5), Cerebellar cortex (3.9), Precentral gyrus (2.0), Area striata (1.9).

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): NFKBIA, SNAI2, SREBF2

miRNA regulators (miRDB)

Targeting PRSS8 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 33 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-574-5P	100.00	66.01	989
HSA-MIR-4692	100.00	67.32	2066
HSA-MIR-4283	100.00	66.42	2097
HSA-MIR-4514	99.99	67.10	1870
HSA-MIR-1250-3P	99.96	70.04	4038
HSA-MIR-6835-3P	99.93	70.49	2904
HSA-MIR-4447	99.85	67.81	2900
HSA-MIR-24-3P	99.59	69.97	1934
HSA-MIR-4437	99.52	65.29	1266
HSA-MIR-4441	99.49	66.56	3216
HSA-MIR-548V	99.29	69.47	1157
HSA-MIR-4685-5P	99.25	65.99	1563
HSA-MIR-6837-5P	99.25	65.47	1632
HSA-MIR-371A-5P	99.08	66.51	1914
HSA-MIR-6846-5P	98.81	65.86	1121
HSA-MIR-6848-5P	98.81	65.49	1126
HSA-MIR-1227-5P	98.65	65.32	1549
HSA-MIR-31-5P	98.58	68.35	1239
HSA-MIR-6838-3P	98.40	65.88	559
HSA-MIR-5088-5P	97.97	64.28	487
HSA-MIR-5699-3P	97.81	65.00	861
HSA-MIR-665	97.60	65.64	1781
HSA-MIR-1910-5P	97.42	66.36	844
HSA-MIR-10400-3P	97.29	64.66	597
HSA-MIR-4674	97.29	64.62	597
HSA-MIR-6748-3P	97.20	65.66	836
HSA-MIR-4529-5P	96.74	65.77	569
HSA-MIR-500B-3P	96.49	65.40	1087
HSA-MIR-4264	96.35	64.76	1480
HSA-MIR-103B	95.51	66.85	441

Functional genomics

gnomAD constraint: pLI 0.0173, LOEUF 0.789, missense Z 1.51 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD RMC): no regional variation along ENST00000317508 — one region, missense o/e 0.82.

Literature-anchored findings (GeneRIF, showing 40)

• protease-mediated regulation of sodium absorption is a function of human airway epithelia, and prostasin is a likely candidate for this activity. (PMID:11756432)
• prostasin is a major regulator of ENaC-mediated Na+ current in DeltaF508 cystic fibrosis epithelia (PMID:15246975)
• prostasin is a channel activating protease; analysis of its substrate specificity (PMID:15474520)
• HAI-1B is a potential physiological regulator of prostasin function (PMID:16103126)
• Dihydrotestosterone regulates prostasin expression in prostate cells via sterol-regulatory element-binding protein stimulation and SLUG repression of prostasin promoter (PMID:16541421)
• The PRSS8 gene was shown to effectively separate these two tumor(chromophobe renal cell carcinoma (RCC) and benign oncocytoma) groups by quantitative reverse transcription-PCR using fresh tissue samples, with similar trends seen on formalin-fixed tissues. (PMID:17145811)
• Data show that prostasin induces protease-dependent and independent molecular changes in the human prostate carcinoma cell line PC-3. (PMID:17532063)
• reduced activity of a matriptase-prostasin proteolytic cascade is the etiological origin of human ARIH and provides an important mouse model for the exploration of matriptase function in ARIH (PMID:17940283)
• prostasin, an upstream prostasin-activating protease, and PN-1 regulate Na+ absorption in the airway and that abnormal prostasin expression contributes to excessive proteolytic activation of ENaC in cystic fibrosis patients (PMID:18310226)
• Genetic variation of the prostasin gene may be implicated in the development of hypertension in youths. (PMID:18583984)
• crystallographic analysis of prostasin (PMID:18922802)
• Suggest that urinary prostasin could be a novel biomarker and/or mechanism for renal pressure natriuresis in normotensive black adolescents. (PMID:19127211)
• it is not clear, at the present time, whether endogenous aldosterone regulates prostasin expression or vice versa (PMID:19262497)
• study presents structures of the extracellular domain of active prostasin in several forms; of particular interest is the S1 subsite loop which opens and closes in response to basic residues or divalent ions, directly binding Ca(+2) cations (PMID:19388054)
• the mRNA level of PN-1 is significantly elevated in colorectal cancer tissue (PMID:19555470)
• prostasin is overexpressed in many epithelial ovarian cancers; a potential tumor marker (PMID:19606239)
• In the in vitro cultured human choriocarcinomal JEG-3 cells, treatment with functional antibody against prostasin led to promotion in cell invasion capability, as well as increase in the production of MMP-2, MMP-26, TIMP-1, and TIMP-4. (PMID:19847458)
• Loss of prostasin expression in bladder transitional cell carcinomas is associated with epithelial-mesenchymal transition. (PMID:19849847)
• Hepsin activates prostasin and cleaves the extracellular domain of the epidermal growth factor receptor. (PMID:19911255)
• Essential hypertension in Xinjiang Kazakhs is not associated with the 2827C>T polymorphism in the prostasin gene. (PMID:20078940)
• Prostasin may regulate trophoblast cell proliferation via modulating the EGFR-MAPK signaling pathway. (PMID:20089521)
• Luciferase assay using CYP11B2 promoter revealed that prostasin significantly increased the transcriptional activity of CYP11B2. (PMID:20204133)
• the matriptase-prostasin proteolytic cascade is tightly regulated by two mechanisms: 1) prostasin activation temporally coupled to matriptase autoactivation and 2) HAI-1 rapidly inhibiting not only active matriptase but also active prostasin (PMID:20696767)
• Transport via the transcytotic pathway makes prostasin available as a substrate for matriptase. (PMID:21148558)
• Expression of matriptase and prostasin is closely correlated in breast cancer cell lines and in breast cancer tissues. Matriptase and prostasin display a near identical spatial expression pattern in the epithelial compartment of breast cancer tissue. (PMID:21678412)
• Study does not provide evidence of a major role of prostasin variation in blood pressure modulation. (PMID:21933610)
• prostasin is present, mature and active on the apical surface of wild-type and cystic fibrosis bronchial epithelial cells (PMID:22582115)
• urinary prostasin correlates with the aldosterone to renin ratio, and it is physiologically modulated by natriuresis in normotensive individuals (PMID:23344129)
• Prostasin requires expression of endogenous matriptase to stimulate barrier formation since matriptase depletion by siRNA silencing abrogates prostasin barrier-forming activity. (PMID:23443662)
• prostasin is a non-enzymatic co-factor for matriptase activation (PMID:23673661)
• Our study suggested that Axl and prostasin expression may be closely related to carcinogenesis, metastasis, and prognosis of ovarian adenocarcinoma. (PMID:23707658)
• Prostasin repress cancer cells and contribute to chemoresistance by modulating the CASP/PAK2-p34/actin pathway. (PMID:24434518)
• The higher frequency of C allele of prostasin gene at rs12597511 is associated with severe preeclampsia. (PMID:24890150)
• Prostasin regulate the Lin28/Let-7 loop in ovarian cancer cells. (PMID:25188517)
• In urinary exosomes, NCC and prostasin had a diurnal pattern parallel to ADH and aquaporin 2, confirming that, in healthy subjects, both prostasin and NCC relate to water balance. (PMID:25931204)
• Polymorphism of the prostasin gene is closely associated with poor pregnancy outcomes of early-onset severe preeclampsia. (PMID:26252104)
• It is concluded that prostasin protein level change is less likely to be causally involved in placental dysfunction in preeclampsia. (PMID:26867056)
• Overexpression of PRSS8 mRNA and high levels of prostasin in multiple subtypes of early stage ovarian tumors may provide clinical biomarkers for early detection of ovarian cancer. (PMID:27036110)
• PRSS8 acts as a tumor suppressor in colorectal cancer (PMID:27050145)
• Data show that PRSS8 was reduced in esophageal squamous cell carcinomas (ESCC) tissues and the reduction of PRSS8 was associated with poor differentiation and shorter survival time. (PMID:27081034)

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Prss8	ENSMUSG00000030800
rattus_norvegicus	Prss8	ENSRNOG00000019616

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:1923810) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 46 distinct phenotype terms.

Mouse phenotype (MP)	Records
sparse hair	5
decreased body weight	4
curly vibrissae	4
impaired skin barrier function	4
abnormal epidermis stratum corneum morphology	3
abnormal hair follicle morphology	2
decreased hair follicle number	2
kinked vibrissae	2
dehydration	2
postnatal lethality, complete penetrance	2
postnatal lethality, incomplete penetrance	2
underdeveloped hair follicles	1
short hair	1
reddish skin	1
scaly skin	1
wrinkled skin	1
skin lesions	1
abnormal epidermal layer morphology	1
abnormal dermal layer morphology	1
weight loss	1
short vibrissae	1
absent vibrissae	1
cataract	1
excessive scratching	1
abnormal coat appearance	1

+21 more (showing top 25).

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Drosophila melanogaster	C0HKA2	100.0%	Diamond
Drosophila erecta	C0HKA5	100.0%	Diamond
Pongo abelii	Q5R5E8	99.3%	Diamond
Pan troglodytes	Q2F9P2	98.7%	Diamond
Pan paniscus	Q2F9P4	98.7%	Diamond
Glossina austeni	Q4TTV7	98.2%	Diamond
Tachypleus tridentatus	P28175	97.2%	Diamond
Carcinoscorpius rotundicauda	Q26422	97.2%	Diamond
Bos taurus	P00741	96.8%	Diamond
Ovis aries	P16291	96.8%	Diamond
Macaca fascicularis	Q4R577	96.3%	Diamond
Macaca mulatta	Q28506	95.7%	Diamond
Capra hircus	Q28315	92.7%	Diamond
Papio cynocephalus	P16227	92.6%	Diamond
Rhinella arenarum	Q66TN7	90.6%	Diamond
Canis lupus familiaris	P19540	88.5%	Diamond
Acropora millepora	B8V7S0	87.4%	Diamond
Sus scrofa	P51779	86.9%	Diamond
Felis catus	Q28412	86.0%	Diamond
Demansia vestigiata	A6MFK7	85.8%	Diamond
Mesocricetus auratus	P15156	84.7%	Diamond
Meriones unguiculatus	P50342	84.7%	Diamond
Equus caballus	Q28380	84.7%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
VKORC1	protein-coding	79001
KAT8	protein-coding	84148
PYCARD-AS1	ncRNA	100652740
PRSS36	protein-coding	146547
FUS	protein-coding	2521
PYCARD	protein-coding	29108
BCKDK	protein-coding	10295

Protein

Protein identifiers

Prostasin — Q16651 (reviewed: Q16651)

Alternative names: Channel-activating protease 1, Serine protease 8

All UniProt accessions (3): H3BUJ8, H3BVC8, Q16651

UniProt curated annotations — full annotation on UniProt →

Function. Possesses a trypsin-like cleavage specificity with a preference for poly-basic substrates. Stimulates epithelial sodium channel (ENaC) activity through activating cleavage of the gamma subunits (SCNN1G).

Subunit / interactions. Heterodimer of two chains, light and heavy, held by a disulfide bond.

Subcellular location. Cell membrane Secreted. Extracellular space Secreted. Extracellular space.

Tissue specificity. Found in prostate, liver, salivary gland, kidney, lung, pancreas, colon, bronchus and renal proximal tubular cells. In the prostate gland it may be synthesized in epithelial cells, secreted into the ducts, and excreted into the seminal fluid.

Similarity. Belongs to the peptidase S1 family.

Isoforms (2)

UniProt ID	Names	Canonical?
Q16651-1	1	yes
Q16651-2	2

RefSeq proteins (1): NP_002764* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001254	Trypsin_dom	Domain
IPR001314	Peptidase_S1A	Family
IPR009003	Peptidase_S1_PA	Homologous_superfamily
IPR018114	TRYPSIN_HIS	Active_site
IPR033116	TRYPSIN_SER	Active_site
IPR043504

Pfam: PF00089

Enzyme classification (BRENDA)

• EC 3.4.21.B6 — (BRENDA: organisms, substrates, inhibitors, Km, kcat entries)

UniProt features (49 total): strand 17, helix 11, disulfide bond 5, active site 3, chain 3, turn 3, propeptide 2, signal peptide 1, glycosylation site 1, splice variant 1, transmembrane region 1, domain 1

Structure

Experimental structures (PDB)

9 structures by resolution:

PDB	Title	Method	Resolution (Å)
3GYL	Structure of Prostasin at 1.3 Angstroms resolution in complex with a Calcium Ion.	X-RAY DIFFRACTION	1.3
3DFJ	Crystal structure of human Prostasin	X-RAY DIFFRACTION	1.45
3E16	X-ray structure of human prostasin in complex with Benzoxazole warhead peptidomimic …	X-RAY DIFFRACTION	1.6
3FVF	The Crystal Structure of Prostasin Complexed with Camostat at 1.6 Angstroms Resolution	X-RAY DIFFRACTION	1.6
3E0N	The X-ray structure of Human Prostasin in complex with DFFR-chloromethyl ketone inhibitor	X-RAY DIFFRACTION	1.7
3E0P	The X-ray structure of Human Prostasin in complex with a covalent benzoxazole inhibitor	X-RAY DIFFRACTION	1.7
3E1X	The Crystal Structure of Apo Prostasin at 1.7 Angstroms Resolution	X-RAY DIFFRACTION	1.7
3DFL	Crystal structure of human Prostasin complexed to 4-guanidinobenzoic acid	X-RAY DIFFRACTION	2
3GYM	Structure of Prostasin in Complex with Aprotinin	X-RAY DIFFRACTION	2.8

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q16651-F1	84.49	0.66

Human Protein Atlas

Protein class: Enzymes, Peptidases, Serine-type peptidases, Predicted membrane proteins, Predicted secreted proteins

Protein evidence: Evidence at protein level

Antibody reliability (HPA): IH uncertain

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (3)

Position	Role
238	charge relay system
85	charge relay system
134	charge relay system

Disulfide bonds (5)

Type	Positions
Interchain (between light and heavy chains)	37–154
Disulfide bond	70–86, 168–244, 201–223, 234–262

Glycosylation sites (1)

Type	Positions
N-linked (glcnac…) asparagine	159

Function

Pathways and Gene Ontology

Reactome pathways

1 curated (TAS) of 3; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

3 pathways:

ID	Pathway	Evidence
R-HSA-6809371	Formation of the cornified envelope	curated
R-HSA-1266738	Developmental Biology	—
R-HSA-6805567	Keratinization	—

MSigDB gene sets: 450 (showing top): MODULE_172, DAVIES_MULTIPLE_MYELOMA_VS_MGUS_DN, REACTOME_INNATE_IMMUNE_SYSTEM, GNF2_MSN, GOBP_ESTABLISHMENT_OR_MAINTENANCE_OF_CELL_POLARITY, JAEGER_METASTASIS_DN, GOCC_SECRETORY_GRANULE, REACTOME_PLATELET_ACTIVATION_SIGNALING_AND_AGGREGATION, ENK_UV_RESPONSE_KERATINOCYTE_UP, ATACCTC_MIR202, GOZGIT_ESR1_TARGETS_DN, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_UP, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, MORF_HDAC1, HSIAO_HOUSEKEEPING_GENES

GO Biological Process (3): positive regulation of sodium ion transport (GO:0010765), protein processing (GO:0016485), proteolysis (GO:0006508)

GO Molecular Function (5): serine-type endopeptidase activity (GO:0004252), serine-type peptidase activity (GO:0008236), protein binding (GO:0005515), peptidase activity (GO:0008233), hydrolase activity (GO:0016787)

GO Cellular Component (3): extracellular region (GO:0005576), plasma membrane (GO:0005886), extracellular exosome (GO:0070062)

Reactome top-level categories

2 top-level categories:

Category	Pathways
Keratinization	1
Developmental Biology	1

GO top-level categories

18 GO namespaces:

Category	Terms
regulation of sodium ion transport	1
sodium ion transport	1
positive regulation of monoatomic ion transport	1
proteolysis	1
protein maturation	1
protein metabolic process	1
endopeptidase activity	1
serine-type peptidase activity	1
peptidase activity	1
serine hydrolase activity	1
binding	1
hydrolase activity	1
catalytic activity, acting on a protein	1
catalytic activity	1
cellular anatomical structure	1
membrane	1
cell periphery	1
extracellular vesicle	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 2 of 12 annotations. The rest are phylogenetic / computational / electronic (IEA).

2 experimentally-supported GO terms:

GO term	NS	Evidence
extracellular exosome	CC	high-throughput assay
plasma membrane	CC	direct assay

Protein interactions and networks

STRING

showing 15 of 844 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
PRSS8	SPINT1	O43278	742
PRSS8	SPINT2	O43291	679
PRSS8	SCNN1A	P37088	670
PRSS8	SCNN1G	P51170	620
PRSS8	NEDD4L	Q96PU5	607
PRSS8	FURIN	P09958	577
PRSS8	ASIC2	Q16515	552
PRSS8	SERPINE2	P07093	517
PRSS8	KAT8	Q9H7Z6	492
PRSS8	SCNN1B	P51168	470
PRSS8	NEDD4	P46934	457
PRSS8	CFTR	P13569	434
PRSS8	DSP	P15924	407
PRSS8	ST14	Q9Y5Y6	381
PRSS8	TMEM63A	O94886	365

IntAct

Human interaction partners of PRSS8 in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

11 partners by confidence:

Partner	Interaction type	MIscore	Records
BRAF	proximity	0.470	2
ATF7IP	physical association	0.370	1
GPAA1	association	0.350	1
TUBB4A	association	0.350	1
FBXW7	proximity	0.270	4
SMAD4	proximity	0.270	4
SPOP	proximity	0.270	4
AKT1	proximity	0.270	1
EGFR	proximity	0.270	1
PTEN	proximity	0.270	1
SMARCA4	proximity	0.270	1

BioGRID (63 interactions; top human partners by supporting records): AGK (Affinity Capture-MS), ALDH3B1 (Affinity Capture-MS), ANLN (Affinity Capture-MS), B3GALT4 (Affinity Capture-MS), BRINP2 (Affinity Capture-MS), CAMK2G (Negative Genetic), CFC1 (Affinity Capture-MS), CHD1 (Positive Genetic), CLEC2B (Affinity Capture-MS), CTAG1B (Affinity Capture-MS), DCP2 (Affinity Capture-MS), EDN3 (Affinity Capture-MS), EFNA2 (Affinity Capture-MS), ERBB3 (Negative Genetic), ERF (Affinity Capture-MS)

Disease & clinical

Genetic variants

Variant evidence for PRSS8: 41 ClinVar records (0 pathogenic / likely pathogenic); 2 GWAS associations.

ClinVar

41 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	31
Likely benign	5
Benign	1

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 24 predictions of 409):

Position(s)	Effect	Δscore	Sites
16:31132427–31132428	donor_loss	1.0000	5
16:31132680–31132681	donor_loss	1.0000	4
16:31132954–31132955	acceptor_loss	1.0000	4
16:31135413	donor_loss	1.0000	2
16:31132596	acceptor_loss	0.9900
16:31132598	acceptor_gain	0.9900
16:31132681	donor_loss	0.9900
16:31132954–31132955	acceptor_loss	0.9900	2
16:31133394	acceptor_gain	0.9900
16:31135412–31135413	donor_loss	0.9900	3

AlphaMissense

700 missense substitutions predicted likely pathogenic (of 2,207 scored), across 163 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
M221	9	0.847	0.970
D237	8	0.993	0.998
D134	8	0.988	0.997
D232	8	0.983	0.996
H85	8	0.980	0.993
S257	8	0.955	0.998
F87	8	0.924	0.994
S61	8	0.893	0.995
H68	8	0.859	0.967
F162	8	0.855	0.986
D260	8	0.795	0.879
C86	7	0.997	0.999
C223	7	0.997	0.999
W173	7	0.996	1.000
C234	7	0.996	0.999
C201	7	0.995	0.999
C70	7	0.994	0.998
C262	7	0.992	0.997
C168	7	0.991	0.998
W58	7	0.987	0.999

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

3 prognostic cancer types:

Cancer	Prognostic	p-value
Kidney Renal Clear Cell Carcinoma (TCGA)	favorable	2.24e-06
Kidney Renal Papillary Cell Carcinoma (TCGA)	favorable	0.000239
Liver Hepatocellular Carcinoma (validation)	favorable	0.000824

Disease associations

OMIM: gene MIM:600823 | disease phenotypes:

GenCC curated gene-disease

1 curated gene-disease records:

Disease	Classification	Inheritance	Records
ichthyosis	Moderate	Autosomal recessive

Mondo (1): ichthyosis (MONDO:0019269)

GWAS associations

2 associations:

Study	Trait	p-value
GCST008115_45	Bipolar I disorder	5e-7
GCST008103_26	Bipolar disorder	8e-6

EFO canonical traits (from GWAS)

1 canonical traits:

EFO ID	Trait name
EFO:0009963	bipolar I disorder

MeSH disease descriptors

1 disease descriptors:

Descriptor	Name	Tree numbers
D007057	Ichthyosis	C16.131.831.512; C16.614.492; C17.800.428.333; C17.800.804.512

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL5610 (SINGLE PROTEIN)

PharmGKB: 1 entry (CPIC guideline: no)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: enzyme — S1: Chymotrypsin

Most potent curated ligand interactions (1 total), top 1:

Ligand	Action	Affinity	Parameter
B3C	Inhibition	7.92	pKi

Binding affinities (BindingDB)

23 measured of 28 human assays (28 total across all organisms); most potent 23 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value
benzyl (R)-1-((2S,4R)-2-(((S)-6-amino-1-(benzo[d]oxazol-2-yl)-1-oxohexan-2-yl)carbamoyl)-4-(4-chlorobenzyloxy)pyrrolidin-1-yl)-1-oxo-4-phenylbutan-2-ylcarbamate	KI	12 nM
benzyl (R)-1-((2S,4R)-2-(((S)-6-amino-1-(benzo[d]oxazol-2-yl)-1-oxohexan-2-yl)carbamoyl)-4-(cyclohexylmethoxy)pyrrolidin-1-yl)-1-oxo-4-phenylbutan-2-ylcarbamate	KI	19 nM
benzyl (R)-1-((2S,4R)-2-(((S)-6-amino-1-(benzo[d]oxazol-2-yl)-1-oxohexan-2-yl)carbamoyl)-4-(4-fluorobenzyloxy)pyrrolidin-1-yl)-1-oxo-4-phenylbutan-2-ylcarbamate	KI	27 nM
benzyl (R)-1-((2S,4R)-2-(((S)-6-amino-1-(benzo[d]oxazol-2-yl)-1-oxohexan-2-yl)carbamoyl)-4-(4-(trifluoromethyl)benzyloxy)pyrrolidin-1-yl)-1-oxo-4-phenylbutan-2-ylcarbamate	KI	28 nM
(3R,5S)-5-(((S)-6-amino-1-(benzo[d]oxazol-2-yl)-1-oxohexan-2-yl)carbamoyl)-1-((R)-2-(benzyloxycarbonyl)-4-phenylbutanoyl)pyrrolidin-3-yl piperidine-1-carboxylate	KI	29 nM
benzyl (R)-1-((2S,4R)-2-(((S)-6-amino-1-(benzo[d]oxazol-2-yl)-1-oxohexan-2-yl)carbamoyl)-4-(benzyloxy)pyrrolidin-1-yl)-1-oxo-4-phenylbutan-2-ylcarbamate	KI	40 nM
benzyl (R)-1-((2S,4R)-2-(((S)-6-amino-1-(benzo[d]oxazol-2-yl)-1-oxohexan-2-yl)carbamoyl)-4-(3-(trifluoromethyl)benzyloxy)pyrrolidin-1-yl)-1-oxo-4-phenylbutan-2-ylcarbamate	KI	41 nM
{(R)-1-[(2S,4R)-2-[(S)-5-Amino-1-(benzooxazole-2-carbonyl)-pentylcarbamoyl]-4-(4-methyl-benzyloxy)-pyrrolidine-1-carbonyl]-3-phenyl-propyl}-carbamic acid benzyl ester	KI	45 nM
benzyl (R)-1-((2S,3S)-2-(((S)-6-amino-1-(benzo[d]oxazol-2-yl)-1-oxohexan-2-yl)carbamoyl)-3-methylpyrrolidin-1-yl)-1-oxo-4-phenylbutan-2-ylcarbamate	KI	49 nM
((R)-1-{(2S,4R)-2-[(S)-5-Amino-1-(benzooxazole-2-carbonyl)-pentylcarbamoyl]-4-benzylcarbamoyloxy-pyrrolidine-1-carbonyl}-3-phenyl-propyl)-carbamic acid benzyl ester	KI	60 nM
benzyl (R)-1-((2S,4R)-2-(((S)-6-amino-1-(benzo[d]oxazol-2-yl)-1-oxohexan-2-yl)carbamoyl)-4-(cyclopentylmethoxy)pyrrolidin-1-yl)-1-oxo-4-phenylbutan-2-ylcarbamate	KI	65 nM
(3R,5S)-5-(((S)-6-amino-1-(benzo[d]oxazol-2-yl)-1-oxohexan-2-yl)carbamoyl)-1-((R)-2-(benzyloxycarbonyl)-4-phenylbutanoyl)pyrrolidin-3-yl pyrrolidine-1-carboxylate	KI	101 nM
Phenyl-carbamic acid (3R,5S)-5-[(S)-5-amino-1-(benzooxazole-2-carbonyl)-pentylcarbamoyl]-1-((R)-2-benzyloxycarbonylamino-4-phenyl-butyryl)-pyrrolidin-3-yl ester	KI	130 nM
{(R)-1-[(2S,4R)-2-[(S)-5-Amino-1-(benzooxazole-2-carbonyl)-pentylcarbamoyl]-4-(4-methanesulfonyl-benzylcarbamoyloxy)-pyrrolidine-1-carbonyl]-3-phenyl-propyl}-carbamic acid benzyl ester	KI	176 nM
benzyl (R)-1-((2S,3R)-2-(((S)-6-amino-1-(benzo[d]oxazol-2-yl)-1-oxohexan-2-yl)carbamoyl)-3-phenylpyrrolidin-1-yl)-1-oxo-4-phenylbutan-2-ylcarbamate	KI	267 nM
(3R,5S)-5-((S)-6-amino-1-(benzo[d]oxazol-2-yl)-1-oxohexan-2-ylcarbamoyl)-1-((R)-2-(benzyloxycarbonylamino)-4-phenylbutanoyl)pyrrolidin-3-yl morpholine-4-carboxylate	KI	510 nM
benzyl (R)-1-((2S,4R)-2-(((S)-6-amino-1-(benzo[d]oxazol-2-yl)-1-oxohexan-2-yl)carbamoyl)-4-hydroxypyrrolidin-1-yl)-1-oxo-4-phenylbutan-2-ylcarbamate	KI	1040 nM
benzyl (R)-1-((S)-2-(((S)-6-amino-1-(benzo[d]oxazol-2-yl)-1-oxohexan-2-yl)carbamoyl)pyrrolidin-1-yl)-1-oxo-4-phenylbutan-2-ylcarbamate	KI	1400 nM
((R)-1-{(2S,4R)-2-[(S)-5-Amino-1-(benzooxazole-2-carbonyl)-pentylcarbamoyl]-4-dimethylcarbamoyloxy-pyrrolidine-1-carbonyl}-3-phenyl-propyl)-carbamic acid benzyl ester	KI	1550 nM
benzyl (S)-1-((S)-1-((S)-6-amino-1-(benzo[d]oxazol-2-yl)-1-oxohexan-2-ylamino)-1-oxo-4-phenylbutan-2-ylamino)-3-(1H-imidazol-5-yl)-1-oxopropan-2-ylcarbamate	KI	2100 nM
benzyl (S)-1-((S)-1-((S)-6-amino-1-(benzo[d]oxazol-2-yl)-1-oxohexan-2-ylamino)-4-methyl-1-oxopentan-2-ylamino)-3-(1H-imidazol-5-yl)-1-oxopropan-2-ylcarbamate	KI	5720 nM
benzyl (S)-6-amino-1-((S)-1-((S)-6-amino-1-(benzo[d]oxazol-2-yl)-1-oxohexan-2-ylamino)-1-oxo-4-phenylbutan-2-ylamino)-1-oxohexan-2-ylcarbamate	KI	5780 nM
benzyl (S)-6-amino-1-((S)-1-((S)-6-amino-1-(benzo[d]oxazol-2-yl)-1-oxohexan-2-ylamino)-4-methyl-1-oxopentan-2-ylamino)-1-oxohexan-2-ylcarbamate	KI	15200 nM

ChEMBL bioactivities

22 potent at pChembl≥5 of 24 total, top 22 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
7.92	Ki	12	nM	CHEMBL505558
7.72	Ki	19	nM	CHEMBL500474
7.57	Ki	27	nM	CHEMBL505738
7.55	Ki	28	nM	CHEMBL505048
7.54	Ki	29	nM	CHEMBL476038
7.40	Ki	40	nM	CHEMBL498914
7.39	Ki	41	nM	CHEMBL443101
7.35	Ki	45	nM	CHEMBL506226
7.31	Ki	49	nM	CHEMBL509770
7.22	Ki	60	nM	CHEMBL500835
7.19	Ki	65	nM	CHEMBL446259
7.00	Ki	101	nM	CHEMBL504789
6.89	Ki	130	nM	CHEMBL448873
6.75	Ki	176	nM	CHEMBL501945
6.57	Ki	267	nM	CHEMBL454436
6.29	Ki	510	nM	CHEMBL510406
5.98	Ki	1040	nM	CHEMBL507245
5.85	Ki	1400	nM	CHEMBL501802
5.81	Ki	1550	nM	CHEMBL501405
5.68	Ki	2100	nM	CHEMBL503925
5.24	Ki	5720	nM	CHEMBL507205
5.24	Ki	5780	nM	CHEMBL504394

PubChem BioAssay actives

22 with measured affinity, of 29 total; 22 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
benzyl N-[(2R)-1-[(2S,4R)-2-[[(2S)-6-amino-1-(1,3-benzoxazol-2-yl)-1-oxohexan-2-yl]carbamoyl]-4-[(4-chlorophenyl)methoxy]pyrrolidin-1-yl]-1-oxo-4-phenylbutan-2-yl]carbamate	409756: Binding affinity to human prostasin	ki	0.0120	uM
benzyl N-[(2R)-1-[(2S,4R)-2-[[(2S)-6-amino-1-(1,3-benzoxazol-2-yl)-1-oxohexan-2-yl]carbamoyl]-4-(cyclohexylmethoxy)pyrrolidin-1-yl]-1-oxo-4-phenylbutan-2-yl]carbamate	409756: Binding affinity to human prostasin	ki	0.0190	uM
benzyl N-[(2R)-1-[(2S,4R)-2-[[(2S)-6-amino-1-(1,3-benzoxazol-2-yl)-1-oxohexan-2-yl]carbamoyl]-4-[(4-fluorophenyl)methoxy]pyrrolidin-1-yl]-1-oxo-4-phenylbutan-2-yl]carbamate	409756: Binding affinity to human prostasin	ki	0.0270	uM
benzyl N-[(2R)-1-[(2S,4R)-2-[[(2S)-6-amino-1-(1,3-benzoxazol-2-yl)-1-oxohexan-2-yl]carbamoyl]-4-[[4-(trifluoromethyl)phenyl]methoxy]pyrrolidin-1-yl]-1-oxo-4-phenylbutan-2-yl]carbamate	409756: Binding affinity to human prostasin	ki	0.0280	uM
[(3R,5S)-5-[[(2S)-6-amino-1-(1,3-benzoxazol-2-yl)-1-oxohexan-2-yl]carbamoyl]-1-[(2R)-4-phenyl-2-(phenylmethoxycarbonylamino)butanoyl]pyrrolidin-3-yl] piperidine-1-carboxylate	409756: Binding affinity to human prostasin	ki	0.0290	uM
benzyl N-[(2R)-1-[(2S,4R)-2-[[(2S)-6-amino-1-(1,3-benzoxazol-2-yl)-1-oxohexan-2-yl]carbamoyl]-4-phenylmethoxypyrrolidin-1-yl]-1-oxo-4-phenylbutan-2-yl]carbamate	409756: Binding affinity to human prostasin	ki	0.0400	uM
benzyl N-[(2R)-1-[(2S,4R)-2-[[(2S)-6-amino-1-(1,3-benzoxazol-2-yl)-1-oxohexan-2-yl]carbamoyl]-4-[[3-(trifluoromethyl)phenyl]methoxy]pyrrolidin-1-yl]-1-oxo-4-phenylbutan-2-yl]carbamate	409756: Binding affinity to human prostasin	ki	0.0410	uM
benzyl N-[(2R)-1-[(2S,4R)-2-[[(2S)-6-amino-1-(1,3-benzoxazol-2-yl)-1-oxohexan-2-yl]carbamoyl]-4-[(4-methylphenyl)methoxy]pyrrolidin-1-yl]-1-oxo-4-phenylbutan-2-yl]carbamate	409756: Binding affinity to human prostasin	ki	0.0450	uM
benzyl N-[(2R)-1-[(2S,3S)-2-[[(2S)-6-amino-1-(1,3-benzoxazol-2-yl)-1-oxohexan-2-yl]carbamoyl]-3-methylpyrrolidin-1-yl]-1-oxo-4-phenylbutan-2-yl]carbamate	409756: Binding affinity to human prostasin	ki	0.0490	uM
benzyl N-[(2R)-1-[(2S,4R)-2-[[(2S)-6-amino-1-(1,3-benzoxazol-2-yl)-1-oxohexan-2-yl]carbamoyl]-4-(benzylcarbamoyloxy)pyrrolidin-1-yl]-1-oxo-4-phenylbutan-2-yl]carbamate	409756: Binding affinity to human prostasin	ki	0.0600	uM
benzyl N-[(2R)-1-[(2S,4R)-2-[[(2S)-6-amino-1-(1,3-benzoxazol-2-yl)-1-oxohexan-2-yl]carbamoyl]-4-(cyclopentylmethoxy)pyrrolidin-1-yl]-1-oxo-4-phenylbutan-2-yl]carbamate	409756: Binding affinity to human prostasin	ki	0.0650	uM
[(3R,5S)-5-[[(2S)-6-amino-1-(1,3-benzoxazol-2-yl)-1-oxohexan-2-yl]carbamoyl]-1-[(2R)-4-phenyl-2-(phenylmethoxycarbonylamino)butanoyl]pyrrolidin-3-yl] pyrrolidine-1-carboxylate	409756: Binding affinity to human prostasin	ki	0.1010	uM
benzyl N-[(2R)-1-[(2S,4R)-2-[[(2S)-6-amino-1-(1,3-benzoxazol-2-yl)-1-oxohexan-2-yl]carbamoyl]-4-(phenylcarbamoyloxy)pyrrolidin-1-yl]-1-oxo-4-phenylbutan-2-yl]carbamate	409756: Binding affinity to human prostasin	ki	0.1300	uM
benzyl N-[(2R)-1-[(2S,4R)-2-[[(2S)-6-amino-1-(1,3-benzoxazol-2-yl)-1-oxohexan-2-yl]carbamoyl]-4-[(4-methylsulfonylphenyl)methylcarbamoyloxy]pyrrolidin-1-yl]-1-oxo-4-phenylbutan-2-yl]carbamate	409756: Binding affinity to human prostasin	ki	0.1760	uM
benzyl N-[(2R)-1-[(2S,3R)-2-[[(2S)-6-amino-1-(1,3-benzoxazol-2-yl)-1-oxohexan-2-yl]carbamoyl]-3-phenylpyrrolidin-1-yl]-1-oxo-4-phenylbutan-2-yl]carbamate	409756: Binding affinity to human prostasin	ki	0.2670	uM
[(3R,5S)-5-[[(2S)-6-amino-1-(1,3-benzoxazol-2-yl)-1-oxohexan-2-yl]carbamoyl]-1-[(2R)-4-phenyl-2-(phenylmethoxycarbonylamino)butanoyl]pyrrolidin-3-yl] morpholine-4-carboxylate	409756: Binding affinity to human prostasin	ki	0.5100	uM
benzyl N-[(2R)-1-[(2S,4R)-2-[[(2S)-6-amino-1-(1,3-benzoxazol-2-yl)-1-oxohexan-2-yl]carbamoyl]-4-hydroxypyrrolidin-1-yl]-1-oxo-4-phenylbutan-2-yl]carbamate	409756: Binding affinity to human prostasin	ki	1.0400	uM
benzyl N-[(2R)-1-[(2S)-2-[[(2S)-6-amino-1-(1,3-benzoxazol-2-yl)-1-oxohexan-2-yl]carbamoyl]pyrrolidin-1-yl]-1-oxo-4-phenylbutan-2-yl]carbamate	409756: Binding affinity to human prostasin	ki	1.4000	uM
[(3R,5S)-5-[[(2S)-6-amino-1-(1,3-benzoxazol-2-yl)-1-oxohexan-2-yl]carbamoyl]-1-[(2R)-4-phenyl-2-(phenylmethoxycarbonylamino)butanoyl]pyrrolidin-3-yl] N,N-dimethylcarbamate	409756: Binding affinity to human prostasin	ki	1.5500	uM
benzyl N-[(2S)-1-[[(2S)-1-[[(2S)-6-amino-1-(1,3-benzoxazol-2-yl)-1-oxohexan-2-yl]amino]-1-oxo-4-phenylbutan-2-yl]amino]-3-(1H-imidazol-5-yl)-1-oxopropan-2-yl]carbamate	409756: Binding affinity to human prostasin	ki	2.1000	uM
benzyl N-[(2S)-1-[[(2S)-1-[[(2S)-6-amino-1-(1,3-benzoxazol-2-yl)-1-oxohexan-2-yl]amino]-4-methyl-1-oxopentan-2-yl]amino]-3-(1H-imidazol-5-yl)-1-oxopropan-2-yl]carbamate	409756: Binding affinity to human prostasin	ki	5.7200	uM
benzyl N-[(2S)-6-amino-1-[[(2S)-1-[[(2S)-6-amino-1-(1,3-benzoxazol-2-yl)-1-oxohexan-2-yl]amino]-1-oxo-4-phenylbutan-2-yl]amino]-1-oxohexan-2-yl]carbamate	409756: Binding affinity to human prostasin	ki	5.7800	uM

CTD chemical–gene interactions

47 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects cotreatment, increases expression, increases methylation	6
trichostatin A	affects cotreatment, increases expression	3
sodium arsenite	decreases expression, increases expression	3
Estradiol	affects cotreatment, decreases expression	3
mercuric bromide	increases expression, affects cotreatment	2
entinostat	increases expression, affects cotreatment	2
Panobinostat	increases expression, affects cotreatment	2
Phenylmercuric Acetate	affects cotreatment, increases expression	2
Tobacco Smoke Pollution	affects expression, increases expression	2
afuresertib	increases expression	1
bisphenol A	affects expression	1
lead acetate	decreases expression	1
afimoxifene	decreases expression, decreases reaction	1
cupric chloride	decreases expression	1
nickel sulfate	increases expression	1
octa-2,4,6-trienoic acid	increases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
abrine	increases expression	1
dorsomorphin	affects cotreatment, increases expression	1
LG 100815	increases expression	1
Resveratrol	affects cotreatment, decreases expression	1
Sunitinib	decreases expression	1
Air Pollutants	increases abundance, increases expression	1
Arsenic	affects methylation	1
Benzo(a)pyrene	affects methylation, decreases methylation	1
Cadmium	increases expression	1
Copper	affects binding, decreases expression	1
Coumestrol	affects cotreatment, decreases expression	1
Dichlorodiphenyl Dichloroethylene	decreases expression	1
Disulfiram	affects binding, decreases expression	1

ChEMBL screening assays

2 unique, capped per target: 2 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL6110325	Binding	Inhibition of prostasin (unknown origin)	Small molecule inhibitors of mannan-binding lectin-associated serine Proteases-2 and-3. — *Eur J Med Chem*

Cellosaurus cell lines

3 cell lines: 3 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_D1LI	Abcam Jurkat PRSS8 KO	Cancer cell line	Male
CVCL_D1Q7	Abcam K-562 PRSS8 KO	Cancer cell line	Female
CVCL_D2LT	Abcam Raji PRSS8 KO	Cancer cell line	Male

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

25 trials:

NCT	Phase	Status	Title
NCT04996485	Phase 4	UNKNOWN	Scientific Substantiation and Assessment of the Effectiveness of Pathogenetic Methods of Therapy for Congenital Ichthyosis in Children
NCT00004690	Phase 3	COMPLETED	Phase III Study of Monolaurin Cream Therapy for Patients With Congenital Ichthyosis
NCT05295732	Phase 3	COMPLETED	The ASCEND Study: Evaluating TMB-001 in the Treatment of RXLI or ARCI Ichthyosis
NCT02864082	Phase 2	COMPLETED	A Safety and Tolerability Study of Topical PAT-001 in Congenital Ichthyosis
NCT03041038	Phase 2	COMPLETED	The Efficacy and Safety of Secukinumab in Patients With Ichthyoses
NCT04154293	Phase 2	COMPLETED	A Vehicle Controlled Study to Evaluate Safety and Efficacy of Topical TMB-001 for Treatment of Congenital Ichthyosis
NCT04697056	Phase 2	TERMINATED	A Study to Evaluate the Efficacy and Safety of Imsidolimab (ANB019) in the Treatment of Participants With Ichthyosis
NCT06136403	Phase 2	RECRUITING	A 44-week Monocentric Open Study Assessing the Efficacy and Safety of Deucravacitinib in Adults With Inflammatory Genodermatoses
NCT06362447	Phase 2	NOT_YET_RECRUITING	Efficacy of Injectable Gentamicin in Hereditary Ichthyosis
NCT04549792	Early Phase 1	COMPLETED	An Open-Label and Long-Term Extension Study to Evaluate the Efficacy and Safety of Ustekinumab in the Treatment of Patients With Ichthyoses
NCT07050810	Early Phase 1	ENROLLING_BY_INVITATION	Thera-Clean® Microbubbles System in Patients With Skin Diseases
NCT00074685	Not specified	COMPLETED	National Registry for Ichthyosis and Related Disorders
NCT02655861	Not specified	TERMINATED	A Multi-center, Prospective Evaluation of Infants and Children With Congenital Ichthyosis
NCT03051347	Not specified	COMPLETED	Asthma and Atopic Dermatitis Validation of PROMIS Pediatric Instruments
NCT03417856	Not specified	ENROLLING_BY_INVITATION	Defining the Skin and Blood Biomarkers of Ichthyosis
NCT03464994	Not specified	COMPLETED	Ophthalmological Abnormalities in Hereditary Ichthyosis (ICHTYO-KERATO)
NCT03641261	Not specified	COMPLETED	Therapeutic Education Using an Internet Application in Hereditary Ichthyosis
NCT03796052	Not specified	COMPLETED	Study Determining Safety and Efficacy of Avena Sativa (Oat) Skincare Products for Treating Skin Dryness and Itching in Cancer Patients
NCT05610306	Not specified	COMPLETED	Quality of Life in Middle-aged and Older Patients With Congenital Ichthyosis
NCT05954416	Not specified	RECRUITING	FARD (RaDiCo Cohort) (RaDiCo-FARD)
NCT06123091	Not specified	UNKNOWN	Exploring Patient Reported Outcomes in Inherited Ichthyosis
NCT06330324	Not specified	ENROLLING_BY_INVITATION	Reproductive Options in Inherited Skin Diseases
NCT06330350	Not specified	RECRUITING	Qualitative Study in Patients With Genodermatoses and Healthcare Professionals on Reproductive Counselling
NCT07066150	Not specified	COMPLETED	A Clinical Evaluation of Marula-Derived Ceramide Cream on Skin Barrier Function Enhancement
NCT07783165	Not specified	NOT_YET_RECRUITING	Patient Study to Evaluate the Safety and Emollient Performance of Doublebase Once in the Treatment of Ichthyosis

Predicted chemistry — Sugi Predict

The predicted patent-compound landscape for PRSS8 across ~30M SureChEMBL compounds — explore on Sugi Predict.