PURA

Summary

PURA (purine rich element binding protein A, HGNC:9701) is a protein-coding gene on chromosome 5q31.3, encoding Transcriptional activator protein Pur-alpha (Q00577). This is a probable transcription activator that specifically binds the purine-rich single strand of the PUR element located upstream of the MYC gene. It is haploinsufficient (ClinGen: sufficient evidence).

This gene product is a sequence-specific, single-stranded DNA-binding protein. It binds preferentially to the single strand of the purine-rich element termed PUR, which is present at origins of replication and in gene flanking regions in a variety of eukaryotes from yeasts through humans. Thus, it is implicated in the control of both DNA replication and transcription. Deletion of this gene has been associated with myelodysplastic syndrome and acute myelogenous leukemia.

Source: NCBI Gene 5813 — RefSeq curated summary.

At a glance

• Gene–disease (curated): complex neurodevelopmental disorder (Definitive, ClinGen) — +1 more curated relationship
• GWAS associations: 1
• Clinical variants (ClinVar): 601 total — 125 pathogenic, 72 likely-pathogenic
• Phenotypes (HPO): 83
• Dosage sensitivity (ClinGen): haploinsufficiency sufficient evidence, triplosensitivity no evidence
• Transcription factor: yes — 22 downstream targets (CollecTRI)
• MANE Select transcript: NM_005859

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:9701
Approved symbol	PURA
Name	purine rich element binding protein A
Location	5q31.3
Locus type	gene with protein product
Status	Approved
Aliases	PURALPHA, PUR1, PUR-ALPHA
Ensembl gene	ENSG00000185129
Ensembl biotype	protein_coding
OMIM	600473
Entrez	5813

Gene structure

Transcript identifiers

Ensembl transcripts: 5 — 4 protein_coding, 1 protein_coding_CDS_not_defined

ENST00000331327, ENST00000502351, ENST00000505703, ENST00000651386, ENST00000676000

RefSeq mRNA: 1 — MANE Select: NM_005859 NM_005859

CCDS: CCDS4220

Canonical transcript exons

ENST00000331327 — 1 exons

Exon	Start	End
ENSE00001309033	140114109	140125619

Expression profiles

Bgee: expression breadth ubiquitous, 295 present calls, max score 99.16.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 25.0306 / max 2095.6277, expressed in 1795 samples.

FANTOM5 promoters (11 alternative TSS)

Promoter ID	TPM avg	Samples expressed
58872	8.1599	1672
58876	5.2101	1634
58873	2.2567	860
58877	2.1545	1172
58882	2.1349	594
58874	1.6468	613
58879	1.4944	341
58881	1.1046	272
58875	0.4254	247
58878	0.2813	47

Top tissues by expression

295 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
Brodmann (1909) area 23	UBERON:0013554	99.16	gold quality
middle temporal gyrus	UBERON:0002771	99.00	gold quality
choroid plexus epithelium	UBERON:0003911	98.96	gold quality
dorsal motor nucleus of vagus nerve	UBERON:0002870	98.95	gold quality
postcentral gyrus	UBERON:0002581	98.87	gold quality
parietal lobe	UBERON:0001872	98.74	gold quality
ventral tegmental area	UBERON:0002691	98.48	gold quality
medulla oblongata	UBERON:0001896	98.31	gold quality
superior vestibular nucleus	UBERON:0007227	98.29	gold quality
subthalamic nucleus	UBERON:0001906	98.15	gold quality
inferior vagus X ganglion	UBERON:0005363	98.14	gold quality
pons	UBERON:0000988	98.12	gold quality
lateral globus pallidus	UBERON:0002476	98.07	gold quality
substantia nigra pars reticulata	UBERON:0001966	98.04	gold quality
substantia nigra pars compacta	UBERON:0001965	98.01	gold quality
CA1 field of hippocampus	UBERON:0003881	98.01	gold quality
entorhinal cortex	UBERON:0002728	98.00	gold quality
globus pallidus	UBERON:0001875	97.95	gold quality
Brodmann (1909) area 46	UBERON:0006483	97.92	gold quality
medial globus pallidus	UBERON:0002477	97.88	gold quality
inferior olivary complex	UBERON:0002127	97.85	gold quality
lateral nuclear group of thalamus	UBERON:0002736	97.80	gold quality
endothelial cell	CL:0000115	97.66	gold quality
nipple	UBERON:0002030	97.53	gold quality
orbitofrontal cortex	UBERON:0004167	97.49	gold quality
cardia of stomach	UBERON:0001162	97.45	gold quality
skin of hip	UBERON:0001554	97.38	gold quality
cranial nerve II	UBERON:0000941	97.25	gold quality
trigeminal ganglion	UBERON:0001675	97.16	gold quality
jejunal mucosa	UBERON:0000399	97.04	gold quality

Single-cell (SCXA)

Detected in 3 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-MTAB-7316	yes	13.05
E-ANND-3	yes	10.06
E-MTAB-6386	no	657.72

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

22 targets.

Target	Regulation
ABCC3
ACTA2
APBB1	Unknown
APP
AR	Repression
CD79A
ERBB2	Unknown
FAS	Repression
GATA2	Unknown
GIT1
KLK3
MBP
MYH6	Repression
PCNA	Repression
PDGFA	Activation
RBM8A
SLU7
SPN	Unknown
ST6GAL2	Activation
TAT
TGFB1	Unknown
TPM1

Upstream regulators (CollecTRI, top): AR, E2F1, IRF3, NFYA

miRNA regulators (miRDB)

330 targeting PURA, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6867-5P	100.00	82.21	3464
HSA-MIR-6873-3P	100.00	71.42	2626
HSA-MIR-7110-3P	100.00	73.18	2486
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-6833-3P	100.00	70.63	3197
HSA-MIR-4768-5P	100.00	69.49	2861
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-656-3P	100.00	72.15	2788
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-8485	100.00	77.57	4731
HSA-LET-7A-3P	100.00	74.03	3932
HSA-LET-7B-3P	100.00	74.08	3913
HSA-LET-7F-1-3P	100.00	74.02	3928
HSA-MIR-98-3P	100.00	74.08	3907
HSA-MIR-6748-5P	100.00	65.81	1057
HSA-MIR-4795-3P	100.00	74.62	4024
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-4668-3P	100.00	68.74	2635
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-4789-3P	99.99	70.75	2484
HSA-MIR-371B-5P	99.99	75.34	4759
HSA-MIR-150-5P	99.99	66.69	1976
HSA-MIR-223-3P	99.99	70.14	1140
HSA-MIR-4282	99.99	75.36	6408
HSA-MIR-10401-5P	99.99	65.79	948
HSA-MIR-548AW	99.99	72.57	3559
HSA-MIR-4789-5P	99.98	70.76	2721
HSA-MIR-568	99.98	69.86	2084
HSA-MIR-373-5P	99.98	75.36	4753
HSA-MIR-616-5P	99.98	75.58	4775

Functional genomics

ClinGen dosage: haploinsufficiency 3 (sufficient evidence), triplosensitivity 0 (no evidence). ClinGen Gene Dosage Map

Literature-anchored findings (GeneRIF, showing 32)

• The ability of Puralpha to activate the CD11c gene promoter increases in differentiating U937 monocytic cells. (PMID:11937543)
• acts together with hnRNP-K to repress the transcriptional activity of the CD43 gene promoter during lymphocyte activation (PMID:12411317)
• results show that PUR proteins are capable of binding to alpha-MHC mRNA and attenuate its translational efficiency; also show robust expression of PUR proteins in failing hearts where alpha-MHC mRNA levels are suppressed (PMID:12933792)
• The N-terminal 72 amino acids of Pura were involved in E2F-1 binding, inhibition of promoter activation by E2F-1 and reversal of E2F-mediated growth inhibition. (PMID:15517862)
• Puralpha has been shown to colocalize with cyclin A/Cdk2 and to coimmunoprecipitate with cyclin A during S-phase and we show that this interaction is mediated by a specific affinity of Puralpha for Cdk2. (PMID:15707957)
• Hypoxia induces a coordinated up-regulation in beta2 integrin expression that is dependent upon transcriptional mechanisms mediated by HIF-1 and Pur alpha. (PMID:17641060)
• the partnership of Puralpha with Rev is beneficial for Rev-mediated expression of the HIV-1 genome. (PMID:17722108)
• that the recruitment of YB1, PURalpha, and H1.2 to the p53 target gene Bax is required for repression of p53-induced transcription. (PMID:18258596)
• Stably overexpressing PURalpha in PC3 and DU145 cells negatively regulates cell proliferation, resulting in decreases in PCNA expression (PMID:18386260)
• A transcriptional repressor complex that binds a specific sequence (repressor element) in the androgen recptor gene 5’-untranslated region in prostate cancer contains Pur alpha. (PMID:18413735)
• Pur-alpha protein is associated with Alzheimer’s disease. (PMID:18780968)
• Effects of the DNA damage-inducing cancer chemotherapeutic agent cisplatin on mouse embryo fibroblasts (MEFs) from PURA negative knockout mice. (PMID:18927497)
• Using shotgun mass spectrometry, we found this protein differentially expressed in the dorsolateral prefrontal cortex from patients with schizophrenia. (PMID:19165527)
• Regulation of PURalpha expression in prostate cancer cells may serve as a therapeutic target for hormone refractory prostate cancer. (PMID:19267365)
• The study identifies three functionally distinct PURA promoters and show that these are utilized differentially in human cell types and that they respond differently to cytomegalovirus infection. (PMID:21062477)
• This study showed that Pur-alpha showed inadequate expression in monocytes, and the translation of Pur-alpha mRNA was repressed by cell-expressed microRNA. (PMID:22835829)
• Suggest dynamic interplay between transcriptional activators Pur-alpha/Pur-beta and repressors in regulating SMalphaA gene output during myofibroblast differentiation. (PMID:24446247)
• Data show that protein PURalpha is specifically involved in the transcriptional activation of the secondary promoter and may exert its function by forming a complex with E2F-1 and RNA polymerase II. (PMID:24819879)
• These findings provide definitive evidence for the role of PURA in causing a variable syndrome of neurodevelopmental delay, learning disability, neonatal hypotonia, feeding difficulties, abnormal movements and epilepsy in humans (PMID:25342064)
• Mutations in PURA cause profound neonatal hypotonia, seizures, and encephalopathy in 5q31.3 microdeletion syndrome. (PMID:25439098)
• The results of this study emphasizes the importance of stress granules in ALS pathogenesis and identifies Pur-alpha as a novel regulator of cytoplasmic stress granules dynamics. (PMID:26728149)
• Three genes in our epilepsy cohort (COQ4, DNM1, and PURA), accounting for 14% (3/21) of all novel genetic etiologies identified in patients with epilepsy, were subsequently confirmed in independent publications. (PMID:26795593)
• PURA may be a potential target of miR-144 and observed downregulation of PURA may be caused by increased expression of miR-144. The other predicted target of miR-144 SPRED1, was found to be downregulated in 69 per cent EC tissues as compared to matched distant non-malignant tissues. (PMID:27748283)
• Silencing of miR-144 significantly decreased the migration, invasion and colony formation potential of esophageal carcinoma cell line KYSE-410 (PMID:29940778)
• PURalpha Promotes the Transcriptional Activation of PCK2 in Oesophageal Squamous Cell Carcinoma Cells. (PMID:33142842)
• Forming cytoplasmic stress granules PURalpha suppresses mRNA translation initiation of IGFBP3 to promote esophageal squamous cell carcinoma progression. (PMID:35945453)
• Depletion of the RNA-binding protein PURA triggers changes in posttranscriptional gene regulation and loss of P-bodies. (PMID:36651277)
• Genome-wide CRISPR/Cas9 screening identifies a targetable MEST-PURA interaction in cancer metastasis. (PMID:37149929)
• DUSP8 induces TGF-beta-stimulated IL-9 transcription and Th9-mediated allergic inflammation by promoting nuclear export of Pur-alpha. (PMID:37909329)
• PURA syndrome-causing mutations impair PUR-domain integrity and affect P-body association. (PMID:38655849)
• PURA and GLUT1: Sweet partners for brain health. (PMID:38777099)
• Purine-Rich Element Binding Protein Alpha, a Nuclear Matrix Protein, Has a Role in Prostate Cancer Progression. (PMID:39000020)

Cross-species orthologs

7 orthologs

Organism	Symbol	Gene ID
danio_rerio	puraa	ENSDARG00000067591
danio_rerio	purab	ENSDARG00000099614
mus_musculus	Pura	ENSMUSG00000043991
rattus_norvegicus	Pura	ENSRNOG00000062721
drosophila_melanogaster	Pur-alpha	FBGN0022361
caenorhabditis_elegans		WBGENE00004046
caenorhabditis_elegans		WBGENE00008976

Paralogs (2): PURB (ENSG00000146676), PURG (ENSG00000172733)

Protein

Protein identifiers

Transcriptional activator protein Pur-alpha — Q00577 (reviewed: Q00577)

Alternative names: Purine-rich single-stranded DNA-binding protein alpha

All UniProt accessions (3): A0A494C0H6, A0A494C0X8, Q00577

UniProt curated annotations — full annotation on UniProt →

Function. This is a probable transcription activator that specifically binds the purine-rich single strand of the PUR element located upstream of the MYC gene. May play a role in the initiation of DNA replication and in recombination.

Subunit / interactions. Homodimer, heterodimer with PURB and heterotrimer with PURB and YBX1/Y-box protein 1. Interacts with FMR1; this interaction occurs in association with polyribosome.

Subcellular location. Nucleus.

Disease relevance. Neurodevelopmental disorder with neonatal respiratory insufficiency, hypotonia, and feeding difficulties (NEDRIHF) [MIM:616158] An autosomal dominant disorder characterized by severe neonatal hypotonia, respiratory and feeding difficulties, encephalopathy, and severe developmental delay. Additional common features may include seizures, exaggerated startle reflex, abnormal movements, and dysmorphic facial features. The disease is caused by variants affecting the gene represented in this entry.

Similarity. Belongs to the PUR DNA-binding protein family.

RefSeq proteins (1): NP_005850* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR006628	PUR-bd_fam	Family

Pfam: PF04845

UniProt features (37 total): strand 12, sequence variant 9, helix 5, repeat 3, modified residue 2, region of interest 2, compositionally biased region 2, initiator methionine 1, chain 1

Structure

Experimental structures (PDB)

4 structures.

PDB	Method	Resolution (Å)
8CHW	X-RAY DIFFRACTION	1.7
8CHT	X-RAY DIFFRACTION	1.95
8CHV	X-RAY DIFFRACTION	2.15
8CHU	X-RAY DIFFRACTION	2.45

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q00577-F1	80.82	0.52

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (2): 182, 2

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 605 (showing top): TGGTGCT_MIR29A_MIR29B_MIR29C, MODULE_97, MULLIGHAN_NPM1_SIGNATURE_3_UP, FREAC2_01, GOBP_AXO_DENDRITIC_TRANSPORT, HNF3ALPHA_Q6, TGCTGCT_MIR15A_MIR16_MIR15B_MIR195_MIR424_MIR497, GCANCTGNY_MYOD_Q6, CMYB_01, TTTGTAG_MIR520D, SP3_Q3, STARK_PREFRONTAL_CORTEX_22Q11_DELETION_DN, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, TATTATA_MIR374, AREB6_01

GO Biological Process (11): negative regulation of transcription by RNA polymerase II (GO:0000122), DNA replication initiation (GO:0006270), regulation of transcription by RNA polymerase II (GO:0006357), nervous system development (GO:0007399), positive regulation of cell population proliferation (GO:0008284), lymphocyte proliferation (GO:0046651), epithelial cell proliferation (GO:0050673), dendritic transport of messenger ribonucleoprotein complex (GO:0098963), cell population proliferation (GO:0008283), negative regulation of translation (GO:0017148), negative regulation of DNA-templated transcription (GO:0045892)

GO Molecular Function (15): mRNA regulatory element binding translation repressor activity (GO:0000900), RNA polymerase II transcription regulatory region sequence-specific DNA binding (GO:0000977), DNA-binding transcription factor activity, RNA polymerase II-specific (GO:0000981), DNA-binding transcription repressor activity, RNA polymerase II-specific (GO:0001227), double-stranded telomeric DNA binding (GO:0003691), single-stranded DNA binding (GO:0003697), RNA binding (GO:0003723), purine-rich negative regulatory element binding (GO:0032422), SMAD binding (GO:0046332), DNA-binding transcription factor binding (GO:0140297), transcription regulator inhibitor activity (GO:0140416), DNA binding (GO:0003677), double-stranded DNA binding (GO:0003690), DNA-binding transcription factor activity (GO:0003700), protein binding (GO:0005515)

GO Cellular Component (7): chromosome, telomeric region (GO:0000781), nucleus (GO:0005634), cytoplasm (GO:0005737), dendrite (GO:0030425), neuronal cell body (GO:0043025), postsynapse (GO:0098794), glutamatergic synapse (GO:0098978)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
regulation of DNA-templated transcription	3
transcription cis-regulatory region binding	3
regulation of transcription by RNA polymerase II	2
transcription by RNA polymerase II	2
cell population proliferation	2
RNA polymerase II transcription regulatory region sequence-specific DNA binding	2
DNA binding	2
nucleic acid binding	2
transcription regulator activity	2
cellular anatomical structure	2
synapse	2
negative regulation of DNA-templated transcription	1
DNA metabolic process	1
DNA-templated DNA replication	1
system development	1
regulation of cell population proliferation	1
positive regulation of cellular process	1
mononuclear cell proliferation	1
lymphocyte activation	1
dendritic transport	1
cellular process	1
translation	1
regulation of translation	1
negative regulation of gene expression	1
negative regulation of protein metabolic process	1
DNA-templated transcription	1
negative regulation of RNA biosynthetic process	1
mRNA binding	1
translation repressor activity	1
chromatin	1
DNA-binding transcription factor activity	1
negative regulation of transcription by RNA polymerase II	1
DNA-binding transcription factor activity, RNA polymerase II-specific	1
DNA-binding transcription repressor activity	1
double-stranded DNA binding	1
telomeric repeat DNA binding	1
protein binding	1
transcription factor binding	1
regulation of gene expression	1
molecular function inhibitor activity	1

Protein interactions and networks

STRING

1000 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
PURA	FMR1	Q06787	985
PURA	YBX1	P16990	928
PURA	FXR2	P51116	880
PURA	FXR1	P51114	873
PURA	GNPTAB	Q3T906	872
PURA	NUCLEOLIN	P19338	821
PURA	ADK	P55263	818
PURA	A0A494C100	A0A494C100	810
PURA	MCM8	Q9UJA3	810
PURA	HNRNPA2B1	P22626	802
PURA	CELF1	Q92879	792
PURA	POLDIP3	Q9BY77	791
PURA	HNRNPK	P61978	776
PURA	MDH2	P40926	768
PURA	MBNL1	Q9NR56	759

IntAct

163 interactions, top by confidence:

A	B	Type	Score
LARP7	CCNT1	psi-mi:“MI:0914”(association)	0.850
CFTR	ESYT2	psi-mi:“MI:2364”(proximity)	0.710
PTK2	TGFB1I1	psi-mi:“MI:0914”(association)	0.680
PURA		psi-mi:“MI:0915”(physical association)	0.590
NP	KPNA6	psi-mi:“MI:0914”(association)	0.550
H1-4	IGF2BP3	psi-mi:“MI:0914”(association)	0.530
ZCRB1	DKC1	psi-mi:“MI:0914”(association)	0.530
RPS3	ZNF316	psi-mi:“MI:0914”(association)	0.530
MAGEB2	POLRMT	psi-mi:“MI:0914”(association)	0.530
H2AC20	PPM1G	psi-mi:“MI:0914”(association)	0.530
H1-4	RRP8	psi-mi:“MI:0914”(association)	0.530
SURF2	HEXIM1	psi-mi:“MI:0914”(association)	0.530
MAGEB2	GTPBP10	psi-mi:“MI:0914”(association)	0.530
KRR1	MPHOSPH10	psi-mi:“MI:0914”(association)	0.530
ZNF71	DKC1	psi-mi:“MI:0914”(association)	0.530
ABT1	ZNF316	psi-mi:“MI:0914”(association)	0.530
RB1	PURA	psi-mi:“MI:0915”(physical association)	0.520
PURA	RB1	psi-mi:“MI:0915”(physical association)	0.520
PURA		psi-mi:“MI:0915”(physical association)	0.520
	PURA	psi-mi:“MI:0915”(physical association)	0.520
CFTR	CNOT1	psi-mi:“MI:0914”(association)	0.480
ESR2	FBLL1	psi-mi:“MI:0914”(association)	0.460

BioGRID (320): PURA (Two-hybrid), PURA (Affinity Capture-MS), PURA (Affinity Capture-MS), PURA (Affinity Capture-MS), PURA (Affinity Capture-MS), PURA (Affinity Capture-MS), PURA (Affinity Capture-MS), PURA (Affinity Capture-MS), PURA (Affinity Capture-MS), PURA (Affinity Capture-MS), PURA (Affinity Capture-MS), PURA (Affinity Capture-MS), E2F1 (Reconstituted Complex), PURA (Affinity Capture-MS), PURA (Affinity Capture-RNA)

ESM2 similar proteins: A2AWA9, A6QL63, F1LQ48, O35295, O43242, O75446, O88506, P09851, P14685, P14866, P20936, P42669, P50904, Q00577, Q13330, Q2KJ46, Q503N9, Q5EAD0, Q5RAN1, Q5SQF8, Q60437, Q62599, Q62771, Q640Q5, Q68A21, Q6GMN2, Q6GQW0, Q6NT76, Q6P5H6, Q6PAC9, Q6PHK6, Q6ZVM7, Q8AVS4, Q8BKX1, Q8K4B0, Q8N122, Q8R081, Q8R3S6, Q8VHW5, Q8WXS5

Diamond homologs: O35295, P42669, P86252, Q00577, Q68A21, Q6PAC9, Q6PHK6, Q8AVS4, Q8R4E6, Q94230, Q96QR8, Q9UJV8

SIGNOR signaling

1 interactions.

A	Effect	B	Mechanism
PURA	“down-regulates quantity by repression”	MYH6	“transcriptional regulation”

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 168 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Formation of Senescence-Associated Heterochromatin Foci (SAHF)	6	38.0×	2e-07
Peptide chain elongation	17	20.4×	7e-16
Viral mRNA Translation	17	20.4×	7e-16
PELO:HBS1L and ABCE1 dissociate a ribosome on a non-stop mRNA	17	20.1×	7e-16
Selenocysteine synthesis	17	19.3×	1e-15
Eukaryotic Translation Termination	17	19.3×	1e-15
Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC)	17	18.9×	1e-15
ZNF598 and the Ribosome-associated Quality Trigger (RQT) complex dissociate a ribosome stalled on a no-go mRNA	17	18.9×	1e-15

GO biological processes:

GO term	Partners	Fold	FDR
negative regulation of DNA recombination	5	37.0×	3e-05
regulation of mRNA splicing, via spliceosome	5	29.2×	9e-05
chromosome condensation	5	27.7×	1e-04
cytoplasmic translation	18	21.9×	2e-16
ribosomal small subunit biogenesis	9	13.5×	5e-06
translation	19	12.8×	3e-13
RNA processing	8	11.5×	8e-05
regulation of alternative mRNA splicing, via spliceosome	7	11.2×	3e-04

Disease & clinical

Clinical variants and AI predictions

ClinVar

601 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	125
Likely pathogenic	72
Uncertain significance	180
Likely benign	165
Benign	18

Top pathogenic / likely-pathogenic (30)

Variant ID	HGVS	Classification
1012526	NM_005859.5(PURA):c.716del (p.Lys239fs)	Pathogenic
1053368	NM_005859.5(PURA):c.895dup (p.Gln299fs)	Pathogenic
1068656	NM_005859.5(PURA):c.647_660del (p.Ala216fs)	Pathogenic
1070477	NM_005859.5(PURA):c.502dup (p.Leu168fs)	Pathogenic
1196418	NM_005859.5(PURA):c.171_172dup (p.Thr58fs)	Pathogenic
1217989	NM_005859.5(PURA):c.802G>T (p.Gly268Ter)	Pathogenic
1299583	NM_005859.5(PURA):c.531del (p.Pro178fs)	Pathogenic
1302015	NM_005859.5(PURA):c.406C>T (p.Gln136Ter)	Pathogenic
1313493	NM_005859.5(PURA):c.478A>G (p.Lys160Glu)	Pathogenic
1328455	GRCh37/hg19 5q31.2-31.3(chr5:139486394-139505318)x1	Pathogenic
1334710	NM_005859.5(PURA):c.530_531dup (p.Pro178fs)	Pathogenic
1360182	NM_005859.5(PURA):c.310dup (p.Met104fs)	Pathogenic
1451955	NM_005859.5(PURA):c.389del (p.Pro130fs)	Pathogenic
156403	NM_005859.5(PURA):c.812_814del (p.Phe271del)	Pathogenic
156404	NM_005859.5(PURA):c.307_308del (p.Ser103fs)	Pathogenic
156405	NM_005859.5(PURA):c.556C>T (p.Gln186Ter)	Pathogenic
156406	NM_005859.5(PURA):c.289A>G (p.Lys97Glu)	Pathogenic
156409	NM_005859.5(PURA):c.783C>G (p.Tyr261Ter)	Pathogenic
156410	NM_005859.5(PURA):c.470T>A (p.Met157Lys)	Pathogenic
156411	NM_005859.5(PURA):c.265G>C (p.Ala89Pro)	Pathogenic
156412	NM_005859.5(PURA):c.263_265del (p.Ile88_Ala89delinsThr)	Pathogenic
1686114	NM_005859.5(PURA):c.169G>T (p.Glu57Ter)	Pathogenic
1686115	NM_005859.5(PURA):c.512G>C (p.Arg171Pro)	Pathogenic
1686116	NM_005859.5(PURA):c.629del (p.Gly210fs)	Pathogenic
1686117	NM_005859.5(PURA):c.715A>T (p.Lys239Ter)	Pathogenic
1691853	NM_005859.5(PURA):c.235C>T (p.Gln79Ter)	Pathogenic
1699169	NM_005859.5(PURA):c.362dup (p.Tyr121Ter)	Pathogenic
1699218	NM_005859.5(PURA):c.74del (p.Gly25fs)	Pathogenic
1699399	NM_005859.5(PURA):c.426_427dup (p.Leu143fs)	Pathogenic
1706638	NM_005859.5(PURA):c.98dup (p.Gly34fs)	Pathogenic

SpliceAI

255 predictions. Top by Δscore:

Variant	Effect	Δscore
5:140115091:G:GT	donor_gain	0.9800
5:140115130:G:GT	donor_gain	0.9700
5:140117459:A:T	donor_gain	0.9200
5:140115123:GG:G	donor_gain	0.9000
5:140115124:GG:G	donor_gain	0.9000
5:140115139:G:T	donor_gain	0.8900
5:140115139:G:GT	donor_gain	0.8500
5:140115389:G:GG	donor_gain	0.7900
5:140114215:G:GA	donor_gain	0.7200
5:140116224:T:TA	donor_gain	0.7200
5:140116225:AGTG:A	donor_gain	0.7200
5:140115388:A:AG	donor_gain	0.7100
5:140121688:C:G	donor_gain	0.6800
5:140121687:ACTGG:A	donor_gain	0.6700
5:140114214:T:TA	donor_gain	0.6500
5:140115120:GCAGG:G	donor_gain	0.6500
5:140115125:G:GG	donor_gain	0.6000
5:140115427:A:AG	donor_gain	0.5900
5:140121646:A:C	donor_gain	0.5800
5:140115121:CAGG:C	donor_loss	0.5700
5:140115122:AGG:A	donor_loss	0.5700
5:140115123:GGGTG:G	donor_loss	0.5700
5:140115124:GGTGA:G	donor_loss	0.5700
5:140115126:T:A	donor_loss	0.5700
5:140115127:G:GG	donor_loss	0.5700
5:140115128:A:AT	donor_loss	0.5700
5:140115129:G:C	donor_loss	0.5700
5:140116222:GGTA:G	donor_gain	0.5600
5:140116223:GTAG:G	donor_gain	0.5600
5:140121531:T:A	acceptor_gain	0.5400

AlphaMissense

2088 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
5:140114359:G:A	E60K	1.000
5:140114363:T:C	L61P	1.000
5:140114368:T:C	S63P	1.000
5:140114369:C:A	S63Y	1.000
5:140114369:C:T	S63F	1.000
5:140114373:G:C	K64N	1.000
5:140114373:G:T	K64N	1.000
5:140114384:T:A	I68N	1.000
5:140114392:A:C	K71Q	1.000
5:140114392:A:G	K71E	1.000
5:140114393:A:C	K71T	1.000
5:140114393:A:T	K71M	1.000
5:140114394:G:C	K71N	1.000
5:140114394:G:T	K71N	1.000
5:140114395:C:A	R72S	1.000
5:140114395:C:T	R72C	1.000
5:140114396:G:C	R72P	1.000
5:140114398:T:C	F73L	1.000
5:140114398:T:G	F73V	1.000
5:140114399:T:C	F73S	1.000
5:140114399:T:G	F73C	1.000
5:140114400:C:A	F73L	1.000
5:140114400:C:G	F73L	1.000
5:140114401:T:A	Y74N	1.000
5:140114401:T:C	Y74H	1.000
5:140114401:T:G	Y74D	1.000
5:140114402:A:G	Y74C	1.000
5:140114405:T:A	L75Q	1.000
5:140114405:T:C	L75P	1.000
5:140114405:T:G	L75R	1.000

dbSNP variants (sampled 300 via entrez): RS1000353128 (5:140119779 G>A), RS1000376469 (5:140122717 T>C), RS1000564027 (5:140113225 C>T), RS1000881743 (5:140113315 G>A), RS1000893311 (5:140114128 GAGGCGGCGGGCGGAGCGGC>G,GAGGCGGCGGGCGGAGCGGCAGGCGGCGGGCGGAGCGGC), RS1000933342 (5:140115718 A>G), RS1001006359 (5:140118163 G>A), RS1001400373 (5:140118713 A>G), RS1001410253 (5:140119227 T>A), RS1001537019 (5:140121734 G>A), RS1001661940 (5:140112782 G>A,C), RS1001852422 (5:140112450 T>C,G), RS1002048836 (5:140113086 T>C,G), RS1002416512 (5:140117281 C>T), RS1002468953 (5:140117662 A>G)

Disease associations

OMIM: gene MIM:600473 | disease phenotypes: MIM:616158

GenCC curated gene-disease

Disease	Classification	Inheritance
PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome due to a point mutation	Definitive	Autosomal dominant

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
complex neurodevelopmental disorder	Definitive	AD

Mondo (6): PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome (MONDO:1060108), PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome due to a point mutation (MONDO:0014512), global developmental delay-visual anomalies-progressive cerebellar atrophy-truncal hypotonia syndrome (MONDO:0018822), intellectual disability (MONDO:0001071), congenital nervous system disorder (MONDO:0002320), neurodevelopmental disorder (MONDO:0700092)

Orphanet (4): PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome (Orphanet:438213), PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome due to a point mutation (Orphanet:438216), Global developmental delay-visual anomalies-progressive cerebellar atrophy-truncal hypotonia syndrome (Orphanet:480898), NON RARE IN EUROPE: Unexplained intellectual disability (Orphanet:319658)

HPO phenotypes

83 total (30 of 83 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000194	Open mouth
HP:0000218	High palate
HP:0000219	Thin upper lip vermilion
HP:0000252	Microcephaly
HP:0000276	Long face
HP:0000286	Epicanthus
HP:0000293	Full cheeks
HP:0000297	Facial hypotonia
HP:0000324	Facial asymmetry
HP:0000341	Narrow forehead
HP:0000347	Micrognathia
HP:0000348	High forehead
HP:0000369	Low-set ears
HP:0000377	Abnormal pinna morphology
HP:0000430	Underdeveloped nasal alae
HP:0000431	Wide nasal bridge
HP:0000455	Broad nasal tip
HP:0000463	Anteverted nares
HP:0000486	Strabismus
HP:0000494	Downslanted palpebral fissures
HP:0000506	Telecanthus
HP:0000508	Ptosis
HP:0000545	Myopia
HP:0000565	Esotropia
HP:0000582	Upslanted palpebral fissure
HP:0000637	Long palpebral fissure
HP:0000639	Nystagmus
HP:0000736	Short attention span
HP:0000739	Anxiety

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST005951_151	Body mass index	6.000000e-07

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0004340	body mass index

MeSH disease descriptors (2)

Descriptor	Name	Tree numbers
D008607	Intellectual Disability	C10.597.606.360; C23.888.592.604.646; F01.700.687; F03.625.539
D065886	Neurodevelopmental Disorders	F03.625

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

PharmGKB clinical annotations

1 annotations.

Variant	Type	Level	Drugs	Phenotypes
rs2013169	Efficacy	3	methylphenidate	Attention Deficit Disorder with Hyperactivity

PharmGKB variants

1 variants.

Variant	Genes	Level	Score	#Clin annots	Drugs
rs2013169	PURA	3	0.00	1	methylphenidate

CTD chemical–gene interactions

31 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Tobacco Smoke Pollution	affects expression, increases expression	3
Valproic Acid	affects expression, increases expression	3
Smoke	decreases expression, increases abundance	2
FR900359	increases phosphorylation	1
triphenyl phosphate	affects expression	1
bisphenol A	increases methylation, decreases expression	1
butyraldehyde	decreases expression	1
nickel chloride	decreases expression	1
celastrol	decreases expression	1
gedunin	decreases expression	1
K 7174	increases expression	1
bisphenol B	increases expression	1
jinfukang	decreases expression	1
3-(2-hydroxy-4-(2-methylnonan-2-yl)phenyl)cyclohexan-1-ol	decreases expression	1
Air Pollutants	increases abundance, decreases expression	1
Benzo(a)pyrene	decreases methylation	1
Carbamazepine	affects expression	1
Chromium Alloys	decreases expression	1
Cisplatin	decreases expression	1
Doxorubicin	decreases expression	1
Enzyme Inhibitors	increases O-linked glycosylation, decreases activity	1
Fluorouracil	affects expression	1
Haloperidol	increases expression	1
Ivermectin	decreases expression	1
Methylnitronitrosoguanidine	affects binding, increases reaction, increases expression	1
Ribonucleotides	affects binding	1
Rotenone	increases expression	1
Dronabinol	increases expression	1
Zinc	decreases expression	1
Cyclosporine	decreases expression	1

Clinical trials (associated diseases)

197 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT05657860	PHASE4	COMPLETED	Guanfacine Extended Release for the Reduction of Aggression and Self-injurious Behavior Associated With Prader-Willi Syndrome
NCT05744479	PHASE4	RECRUITING	Metformin for Antipsychotic-induced Weight Gain in Adults With Intellectual Disability
NCT06107829	PHASE4	WITHDRAWN	Valbenazine Treatment of Tardive Dyskinesia in Adults With Intellectual/Developmental Disabilities
NCT06997198	PHASE4	NOT_YET_RECRUITING	Deutetrabenazine Treatment for Tardive Dyskinesia in Intellectual/Developmental Disabilities
NCT02270736	PHASE3	COMPLETED	Clinical Study to Investigate the Efficacy and Safety of NT 201 Compared to Placebo in the Treatment of Chronic Troublesome Drooling Associated With Neurological Disorders and/or Intellectual Disability
NCT02304302	PHASE2	COMPLETED	Down Syndrome Memantine Follow-up Study
NCT03862950	PHASE2	COMPLETED	A Trial of Metformin in Individuals With Fragile X Syndrome (Met)
NCT04529226	PHASE2	UNKNOWN	Study to Compare Clozapine vs Treatment as Usual in People With Intellectual Disability & Treatment-resistant Psychosis
NCT04821856	PHASE2	COMPLETED	Evaluation of the Effectiveness of Cannabidiol in Treating Severe Behavioural Problems in Children and Adolescents With Intellectual Disability
NCT05273320	PHASE1	COMPLETED	Clinical Trial of Nabilone for Aggression in Adults With Intellectual and Developmental Disabilities
NCT05301361	PHASE1	ENROLLING_BY_INVITATION	Sensitivity of the NIH Toolbox to Stimulant Treatment in Intellectual Disabilities
NCT06016764	PHASE1	COMPLETED	Use of MRI and cTBS for Catatonia in Autism
NCT06586827	PHASE1	COMPLETED	Impact of Competency-Based Training and Technical Assistance Employment Outcomes of Individuals With ID/DD
NCT07531940	PHASE1	NOT_YET_RECRUITING	Escalating Doses of Memantine in Down Syndrome (MEDS-123)
NCT03479476	PHASE2/PHASE3	COMPLETED	A Trial of Metformin in Individuals With Fragile X Syndrome
NCT02616796	PHASE1/PHASE2	COMPLETED	Effects of Social Gaze Training on Brain and Behavior in Fragile X Syndrome
NCT06860672	EARLY_PHASE1	RECRUITING	Clinical Trial of the Dual Vector Base Editor for the Treatment of the CHD3-R1025W Mutation
NCT00597948	Not specified	COMPLETED	Healthy Lifestyles for People With Intellectual Disabilities
NCT01087320	Not specified	RECRUITING	Genome Medical Sequencing for Gene Discovery
NCT01652963	Not specified	UNKNOWN	Picture-based Computerised Assessment and Training of Cognitive Behaviour Therapy Skills
NCT01695395	Not specified	COMPLETED	Mental Health Care Provision for Adults With Intellectual Disability and a Mental Disorder
NCT01867554	Not specified	COMPLETED	Research and Characterization of New Genes Involved in Intellectual Disability
NCT01915381	Not specified	COMPLETED	Improving Adherence Healthy Lifestyle With a Smartphone Application Based on Adults With Intellectual Disabilities
NCT01988623	Not specified	COMPLETED	Pivotal Response Treatment for Individuals With Intellectual Disabilities
NCT02099773	Not specified	COMPLETED	Support Staff-client Interactions With Augmentative and Alternative Communication
NCT02136849	Not specified	COMPLETED	Inter-regional Project of the Great Western Exploration Approach for Exome Molecular Causes Severe Intellectual Disability Isolated or Syndromic
NCT02225041	Not specified	COMPLETED	Sedation Strategy and Cognitive Outcome After Critical Illness in Early Childhood
NCT02414438	Not specified	COMPLETED	Establishing the Clinical Utility of First StepDx PLUS and NextStepDx PLUS Study
NCT02451761	Not specified	COMPLETED	Apparently Balanced Chromosomal Translocation/ Next-generation Sequencing/ Intellectual Disability
NCT02461420	Not specified	ACTIVE_NOT_RECRUITING	Mapping the Genotype, Phenotype, and Natural History of Phelan-McDermid Syndrome
NCT02461459	Not specified	ACTIVE_NOT_RECRUITING	Autism Spectrum Disorder (ASD) and Intellectual Disability (ID) Determinants in Tuberous Sclerosis Complex (TSC)
NCT02486081	Not specified	COMPLETED	Development and Application-Smart Football for Movement Evaluation and Training in the Special Education Population
NCT02504502	Not specified	COMPLETED	Enhancing Genomic Laboratory Reports to Enhance Communication and Empower Patients
NCT02513277	Not specified	COMPLETED	Diabetes Screening & Prevention for People With Learning (Intellectual) Disabilities:STOP Diabetes Study
NCT02561754	Not specified	COMPLETED	Weight Management for Adolescents With IDD
NCT02591446	Not specified	COMPLETED	Transcranial Magnetic Stimulation Studies in Autism Spectrum Disorders
NCT02714868	Not specified	COMPLETED	Evaluation of Project TEAM (Teens Making Environmental and Activity Modifications)
NCT02721394	Not specified	UNKNOWN	FCT With Young Children With ID in the UK: A Feasibility Project V.1
NCT02746614	Not specified	COMPLETED	Psychomotor Therapy Effects in Adaptive Behavior and Motor Proficiency in Intellectual Disability
NCT02836405	Not specified	COMPLETED	TMS for the Investigation of Brain Plasticity in Autism Spectrum Disorders