PWWP4

Summary

PWWP4 (PWWP domain containing 4, HGNC:55197) is a protein-coding gene on chromosome Xq28, encoding Putative PWWP domain-containing DNA repair factor 4 (A0A494C071).

At a glance

• MANE Select transcript: NM_001395996

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:55197
Approved symbol	PWWP4
Name	PWWP domain containing 4
Location	Xq28
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000278803
Ensembl biotype	protein_coding
Entrez	728317

Gene structure

Transcript identifiers

Ensembl transcripts: 1 — 1 protein_coding

ENST00000458091

RefSeq mRNA: 1 — MANE Select: NM_001395996 NM_001395996

CCDS: CCDS94692

Canonical transcript exons

ENST00000458091 — 4 exons

Exon	Start	End
ENSE00002294287	153271407	153279145
ENSE00003971527	153267970	153268042
ENSE00003971528	153266152	153266229
ENSE00003971529	153270529	153270709

Expression profiles

Bgee: expression breadth broad, 13 present calls, max score 53.07.

Top tissues by expression

128 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
cortical plate	UBERON:0005343	53.07	gold quality
nucleus accumbens	UBERON:0001882	49.49	gold quality
prefrontal cortex	UBERON:0000451	45.48	gold quality
frontal cortex	UBERON:0001870	41.83	gold quality
primary visual cortex	UBERON:0002436	40.19	gold quality
hypothalamus	UBERON:0001898	39.75	gold quality
Brodmann (1909) area 9	UBERON:0013540	39.46	silver quality
caudate nucleus	UBERON:0001873	38.53	gold quality
cerebral cortex	UBERON:0000956	38.42	silver quality
dorsolateral prefrontal cortex	UBERON:0009834	38.03	silver quality
putamen	UBERON:0001874	38.01	gold quality
colonic epithelium	UBERON:0000397	37.20	gold quality
ganglionic eminence	UBERON:0004023	37.11	gold quality
sural nerve	UBERON:0015488	36.82	gold quality
ventricular zone	UBERON:0003053	36.48	gold quality
right frontal lobe	UBERON:0002810	36.34	silver quality
bone marrow cell	CL:0002092	36.16	gold quality
brain	UBERON:0000955	35.16	gold quality
temporal lobe	UBERON:0001871	33.86	gold quality
skeletal muscle tissue	UBERON:0001134	33.38	gold quality
hindlimb stylopod muscle	UBERON:0004252	32.15	gold quality
monocyte	CL:0000576	31.81	gold quality
islet of Langerhans	UBERON:0000006	31.80	gold quality
bone marrow	UBERON:0002371	31.74	gold quality
leukocyte	CL:0000738	31.43	gold quality
liver	UBERON:0002107	31.25	gold quality
muscle tissue	UBERON:0002385	31.06	gold quality
stromal cell of endometrium	CL:0002255	29.87	gold quality
duodenum	UBERON:0002114	28.14	gold quality
lymph node	UBERON:0000029	27.57	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	0.66

Regulation

Is transcription factor: no

Cross-species orthologs

8 orthologs

Organism	Symbol	Gene ID
danio_rerio	si:dkey-57k2.7	ENSDARG00000060395
mus_musculus	Pwwp4a	ENSMUSG00000067771
mus_musculus	Pwwp4b	ENSMUSG00000071745
mus_musculus	Pwwp4d	ENSMUSG00000079531
mus_musculus	Pwwp4c	ENSMUSG00000079534
rattus_norvegicus	Pwwp4	ENSRNOG00000068777
rattus_norvegicus		ENSRNOG00000072022
rattus_norvegicus		ENSRNOG00000073377

Paralogs (2): PWWP3B (ENSG00000157502), PWWP3A (ENSG00000160953)

Protein

Protein identifiers

Putative PWWP domain-containing DNA repair factor 4 — A0A494C071 (reviewed: A0A494C071)

All UniProt accessions (1): A0A494C071

UniProt curated annotations — full annotation on UniProt →

Similarity. Belongs to the PWWP3A family.

RefSeq proteins (1): NP_001382925* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR035504	MUM1-like_PWWP	Domain
IPR040263	PWP3A_3B_4	Family
IPR048765	PWP3A_3B_4_N	Domain
IPR048795	PWP3A_3B_4_C	Domain

Pfam: PF20884, PF20886, PF20887

UniProt features (19 total): region of interest 10, compositionally biased region 7, chain 1, domain 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-A0A494C071-F1	51.03	0.00

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 9 (showing top): chrXq28, FOSTER_KDM1A_TARGETS_UP, GSE17721_CTRL_VS_CPG_0.5H_BMDC_DN, GSE31082_DP_VS_CD4_SP_THYMOCYTE_UP, GSE8835_CD4_VS_CD8_TCELL_DN, GSE4811_CLASSSICALY_ACTIVATED_VS_TYPE_2_ACTIVATED_MACROPHAGE_UP, GSE21774_CD56_BRIGHT_VS_DIM_CD62L_POSITIVE_NK_CELL_DN, GSE46606_DAY1_VS_DAY3_CD40L_IL2_IL5_STIMULATED_IRF4_KO_BCELL_DN, GSE41176_UNSTIM_VS_ANTI_IGM_STIM_TAK1_KO_BCELL_1H_DN

GO Biological Process (0):

GO Molecular Function (0):

GO Cellular Component (0):

Protein interactions and networks

STRING

1505 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
PWWP4	TCP11X2	Q5H9J9	772
PWWP4	CXorf49	A8MYA2	691
PWWP4	CXorf51A	A0A1B0GTR3	643
PWWP4	PNMA6A	P0CW24	480
PWWP4	TMSB15A	P0CG34	369
PWWP4	LDOC1	O95751	367
PWWP4	TSPY1	P09002	307
PWWP4	ATP5F1D	P30049	281
PWWP4	MT-ATP6	P00846	281
PWWP4	ATP5F1A	P25705	281
PWWP4	NDUFS3	O75489	280
PWWP4	NDUFS8	O00217	280
PWWP4	NDUFV2	P19404	280
PWWP4	MT-ND1	P03886	280
PWWP4	MT-ND4L	P03901	280
PWWP4	MT-ND4	P03905	280
PWWP4	MT-ND3	P03897	280
PWWP4	NDUFS2	O75306	280
PWWP4	NDUFS1	P28331	280
PWWP4	NDUFV1	P49821	280

IntAct

0 interactions, top by confidence:

ESM2 similar proteins: A0A0J9YWL9, A0A0J9YY54, A0A0U1RQI7, A0A494C071, A6NNC1, A6QL64, B3KS81, D3YZV8, E2RYF7, E9Q6E9, F1LWT0, F8W0I5, O60732, P0C8Z4, P0DKJ7, P0DKJ8, P0DKL2, P0DPF3, P18751, P20930, P43537, P53353, P59797, P62521, Q01456, Q08AG5, Q12816, Q3BBV2, Q5H9R4, Q5HY64, Q5JPF3, Q6P902, Q6ZQX7, Q86T75, Q86VE3, Q86VQ3, Q8BGJ3, Q8N307, Q8N7U7, Q8N7X1

Diamond homologs: A0A494C071, B1H224, Q08DK9, Q2TAK8, Q4VA55, Q5H9M0, Q6DID5

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

0 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	0
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

0 predictions. Top by Δscore:

AlphaMissense

13041 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
X:153276938:T:A	V1774D	0.993
X:153276898:T:A	W1761R	0.992
X:153276898:T:C	W1761R	0.992
X:153276925:T:A	W1770R	0.991
X:153276925:T:C	W1770R	0.991
X:153277384:T:C	F1923L	0.989
X:153277386:C:A	F1923L	0.989
X:153277386:C:G	F1923L	0.989
X:153276902:T:C	F1762S	0.988
X:153277465:T:C	F1950L	0.988
X:153277467:T:A	F1950L	0.988
X:153277467:T:G	F1950L	0.988
X:153271733:T:A	V39D	0.987
X:153276901:T:C	F1762L	0.987
X:153276903:C:A	F1762L	0.987
X:153276903:C:G	F1762L	0.987
X:153276922:T:C	F1769L	0.987
X:153276924:T:A	F1769L	0.987
X:153276924:T:G	F1769L	0.987
X:153276907:T:C	F1764L	0.986
X:153276909:T:A	F1764L	0.986
X:153276909:T:G	F1764L	0.986
X:153277111:T:A	W1832R	0.986
X:153277111:T:C	W1832R	0.986
X:153277124:T:C	L1836P	0.986
X:153277201:A:C	S1862R	0.986
X:153277203:C:A	S1862R	0.986
X:153277203:C:G	S1862R	0.986
X:153277453:T:A	W1946R	0.986
X:153277453:T:C	W1946R	0.986

dbSNP variants (sampled 300 via entrez): RS113378114 (X:153267892 T>C), RS1156490145 (X:153266927 A>T), RS1156708963 (X:153264705 T>A,C), RS1156774466 (X:153266273 A>G), RS1156932926 (X:153272395 G>A), RS1156942233 (X:153273092 G>A), RS1157344100 (X:153270220 GAGAGAGAGAGA>G), RS1157634321 (X:153271383 C>T), RS1158203512 (X:153267550 C>T), RS1158507173 (X:153265540 T>G), RS1158593344 (X:153272763 C>A), RS1158719867 (X:153269801 T>G), RS1158940524 (X:153273271 T>G), RS1159052849 (X:153266465 ATGTGAGGATGTGTG>A,ATGTGAGGATGTGTGTGTGAGGATGTGTG), RS1159141576 (X:153271938 G>A)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.