PYDC5
gene geneOn this page
Also known as POP3
Summary
PYDC5 (pyrin domain containing 5, HGNC:53781) is a protein-coding gene on chromosome 1q23.1, encoding Pyrin domain-containing protein 5 (W6CW81). Functions as an inhibitor of DNA virus-induced activation of AIM2-like receptors (ALR) inflammasome through interaction with AIM2.
Involved in cellular response to interferon-beta; cellular response to virus; and negative regulation of AIM2 inflammasome complex assembly.
Source: NCBI Gene 107181291 — RefSeq curated summary.
At a glance
- MANE Select transcript:
NM_001320010
Identifiers
Gene identifiers
| Field | Value |
|---|---|
| HGNC ID | HGNC:53781 |
| Approved symbol | PYDC5 |
| Name | pyrin domain containing 5 |
| Location | 1q23.1 |
| Locus type | gene with protein product |
| Status | Approved |
| Aliases | POP3 |
| Ensembl gene | ENSG00000289721 |
| Ensembl biotype | protein_coding |
| Entrez | 107181291 |
Gene structure
Transcript identifiers
Ensembl transcripts: 1 — 1 protein_coding
ENST00000696987
RefSeq mRNA: 1 — MANE Select: NM_001320010
NM_001320010
CCDS: CCDS91078
Canonical transcript exons
ENST00000696987 — 1 exons
| Exon | Start | End |
|---|---|---|
| ENSE00003969202 | 158999971 | 159002751 |
Expression profiles
Top tissues by expression
0 total, by Bgee expression score (0-100, higher = more expressed):
Regulation
Is transcription factor: no
Cross-species orthologs
0 orthologs
Protein
Protein identifiers
Pyrin domain-containing protein 5 — W6CW81 (reviewed: W6CW81)
Alternative names: Pyrin domain-only protein 3
All UniProt accessions (1): W6CW81
UniProt curated annotations — full annotation on UniProt →
Function. Functions as an inhibitor of DNA virus-induced activation of AIM2-like receptors (ALR) inflammasome through interaction with AIM2.
Subunit / interactions. Interacts with AIM2; disrupts assembly of the ALR inflammasome complex. Interacts with IFI16. Interacts with NLRP3.
Tissue specificity. Expressed in monocytic cell lines and primary macrophages but not in B or T cells.
Induction. Up-regulated in response to IFNB1 or virus infection.
RefSeq proteins (1): NP_001306939* (*=MANE)
Domains & families (InterPro)
| ID | Name | Type |
|---|---|---|
| IPR004020 | DAPIN | Domain |
| IPR011029 | DEATH-like_dom_sf | Homologous_superfamily |
UniProt features (2 total): chain 1, domain 1
Structure
Experimental structures (PDB)
0 structures.
Predicted structure (AlphaFold)
| Model | pLDDT | Fraction very-high |
|---|---|---|
| AF-W6CW81-F1 | 53.59 | 0.00 |
Function
Pathways and Gene Ontology
Reactome pathways
0 pathways
MSigDB gene sets: 43 (showing top):
GOBP_NEGATIVE_REGULATION_OF_PROTEIN_CONTAINING_COMPLEX_ASSEMBLY, GOBP_CELLULAR_RESPONSE_TO_VIRUS, GOBP_INFLAMMATORY_RESPONSE, GOBP_RESPONSE_TO_PEPTIDE, GOBP_REGULATION_OF_CELLULAR_COMPONENT_BIOGENESIS, GOBP_RESPONSE_TO_INTERFERON_BETA, GOBP_NEGATIVE_REGULATION_OF_INTRACELLULAR_SIGNAL_TRANSDUCTION, GOBP_NEGATIVE_REGULATION_OF_CELLULAR_COMPONENT_ORGANIZATION, GOBP_POSITIVE_REGULATION_OF_RESPONSE_TO_EXTERNAL_STIMULUS, GOBP_REGULATION_OF_IMMUNE_RESPONSE, GOBP_DEFENSE_RESPONSE_TO_OTHER_ORGANISM, GOBP_REGULATION_OF_RESPONSE_TO_STRESS, GOBP_REGULATION_OF_PROTEIN_CONTAINING_COMPLEX_ASSEMBLY, GOBP_POSITIVE_REGULATION_OF_RESPONSE_TO_BIOTIC_STIMULUS, GOBP_REGULATION_OF_RESPONSE_TO_EXTERNAL_STIMULUS
GO Biological Process (7): inflammatory response (GO:0006954), negative regulation of protein-containing complex assembly (GO:0031333), cellular response to interferon-beta (GO:0035458), cellular response to virus (GO:0098586), negative regulation of AIM2 inflammasome complex assembly (GO:0140972), regulation of innate immune response (GO:0045088), cellular response to cytokine stimulus (GO:0071345)
GO Molecular Function (1): protein binding (GO:0005515)
GO Cellular Component (0):
GO top-level categories
Rollup of top GO terms by namespace:
| Category | Terms |
|---|---|
| defense response | 1 |
| regulation of protein-containing complex assembly | 1 |
| negative regulation of cellular component organization | 1 |
| protein-containing complex assembly | 1 |
| response to interferon-beta | 1 |
| cellular response to cytokine stimulus | 1 |
| response to virus | 1 |
| negative regulation of protein-containing complex assembly | 1 |
| AIM2 inflammasome complex assembly | 1 |
| regulation of AIM2 inflammasome complex assembly | 1 |
| negative regulation of inflammasome-mediated signaling pathway | 1 |
| regulation of response to biotic stimulus | 1 |
| regulation of defense response | 1 |
| regulation of response to external stimulus | 1 |
| innate immune response | 1 |
| regulation of immune response | 1 |
| response to cytokine | 1 |
| binding | 1 |
Protein interactions and networks
STRING
0 interactions, top by confidence (×1000):
IntAct
0 interactions, top by confidence:
ESM2 similar proteins: A0A7H0DN66, A0A7H0DNG7, O14278, O36397, O42654, O92277, P03207, P0C722, P0C723, P0CAA1, P0DSV9, P0DSW0, P21089, P24438, P24651, P24772, P37588, P52361, P52469, P52474, P52548, P55794, Q00732, Q01032, Q03956, Q0VD34, Q10095, Q11115, Q18LD2, Q2HR83, Q568Z9, Q5MKM1, Q5R4I8, Q5UNU6, Q69550, Q80A33, Q86197, Q8IRS9, Q8IRT0, Q8K0S0
Diamond homologs: D0QMC3, O14862, O35368, P0DOV1, P0DOV2, P41218, Q16666, Q504N7, Q5RD14, Q6K0P9, Q8BV49, Q8CGE8, Q8SPH9, Q91VJ1, Q9R002, W6CW81
SIGNOR signaling
0 interactions.
Disease & clinical
Clinical variants and AI predictions
ClinVar
0 variants total. Per-class counts are floors (≥ shown; pagination cap):
| Classification | Count (floor) |
|---|---|
| Pathogenic | 0 |
| Likely pathogenic | 0 |
| Uncertain significance | 0 |
| Likely benign | 0 |
| Benign | 0 |
Top pathogenic / likely-pathogenic (0)
SpliceAI
0 predictions. Top by Δscore:
AlphaMissense
0 scored. Top likely-pathogenic:
dbSNP variants (sampled 300 via entrez): RS1000931902 (1:159001363 G>A), RS1001584597 (1:159000817 GTGGATCCCTCATGAATGGCTCAGTGCCA>G), RS1001814147 (1:159000613 A>C,G), RS1002195245 (1:158999648 T>G), RS1004142061 (1:159003957 G>A,C), RS1004533630 (1:159000481 T>C), RS1004590798 (1:159000235 C>G), RS1004996565 (1:159001818 C>T), RS1006209138 (1:159002200 A>G), RS1006281252 (1:159001874 G>T), RS1007229026 (1:159003760 A>T), RS1007280098 (1:159003944 G>A), RS1007940535 (1:159000868 C>A), RS1008741715 (1:159004695 GA>G,GAA), RS1010233220 (1:159000940 A>G)
Disease associations
OMIM: gene `` | disease phenotypes:
GenCC curated gene-disease
Mondo (0):
Orphanet (0):
HPO phenotypes
0 total (0 of 0 shown, HPO-id order):
GWAS associations
0 associations (top):
Drugs & pharmacology
Drug and pharmacology data
Is drug target: no
PharmGKB: 1 entry (VIP=true, CPIC=false)
Clinical trials (associated diseases)
0 trials via MONDO — disease-level, not drug-specific.
Related Atlas pages
No linked Atlas pages yet — the cross-entity mesh grows as the corpus expands.