PYM1

Summary

PYM1 (PYM1 exon junction complex associated factor, HGNC:30258) is a protein-coding gene on chromosome 12q13.2, encoding Partner of Y14 and mago (Q9BRP8). Key regulator of the exon junction complex (EJC), a multiprotein complex that associates immediately upstream of the exon-exon junction on mRNAs and serves as a positional landmark for the intron exon structure of genes and directs post-transcriptional processes in the cytoplasm…. It is a selective cancer dependency (DepMap: 29.7% of cell lines).

Enables ribosome binding activity. Involved in exon-exon junction complex disassembly; nuclear-transcribed mRNA catabolic process, nonsense-mediated decay; and positive regulation of translation. Located in cell junction; cytosol; and nuclear lumen. Part of exon-exon junction complex.

Source: NCBI Gene 84305 — RefSeq curated summary.

At a glance

• GWAS associations: 1
• Clinical variants (ClinVar): 11 total
• Druggable target: yes
• Cancer dependency (DepMap): dependent in 29.7% of screened cell lines
• MANE Select transcript: NM_032345

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:30258
Approved symbol	PYM1
Name	PYM1 exon junction complex associated factor
Location	12q13.2
Locus type	gene with protein product
Status	Approved
Aliases	PYM
Ensembl gene	ENSG00000170473
Ensembl biotype	protein_coding
OMIM	619753
Entrez	84305

Gene structure

Transcript identifiers

Ensembl transcripts: 8 — 5 protein_coding, 3 protein_coding_CDS_not_defined

ENST00000302533, ENST00000398213, ENST00000408946, ENST00000454792, ENST00000547925, ENST00000549939, ENST00000557259, ENST00000859965

RefSeq mRNA: 2 — MANE Select: NM_032345 NM_001143853, NM_032345

CCDS: CCDS41795, CCDS44916

Canonical transcript exons

ENST00000408946 — 3 exons

Exon	Start	End
ENSE00001143351	55901413	55902355
ENSE00001568505	55927725	55927894
ENSE00003560435	55903387	55903480

Expression profiles

Bgee: expression breadth ubiquitous, 258 present calls, max score 95.77.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 29.3793 / max 165.9154, expressed in 1816 samples.

FANTOM5 promoters (6 alternative TSS)

Promoter ID	TPM avg	Samples expressed
131450	13.3040	1756
131447	11.0752	1785
131448	3.4678	1430
131449	0.9620	600
131453	0.3615	136
131452	0.2088	92

Top tissues by expression

259 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
lower esophagus mucosa	UBERON:0035834	95.77	gold quality
esophagus mucosa	UBERON:0002469	95.30	gold quality
mucosa of transverse colon	UBERON:0004991	94.95	gold quality
upper arm skin	UBERON:0004263	94.09	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	93.46	gold quality
pharyngeal mucosa	UBERON:0000355	93.45	gold quality
kidney epithelium	UBERON:0004819	93.28	silver quality
tibialis anterior	UBERON:0001385	92.99	gold quality
skin of leg	UBERON:0001511	92.87	gold quality
skin of abdomen	UBERON:0001416	92.50	gold quality
esophagus	UBERON:0001043	92.33	gold quality
granulocyte	CL:0000094	91.70	gold quality
rectum	UBERON:0001052	91.65	gold quality
islet of Langerhans	UBERON:0000006	91.54	gold quality
right lobe of liver	UBERON:0001114	91.51	gold quality
right adrenal gland cortex	UBERON:0035827	91.48	gold quality
minor salivary gland	UBERON:0001830	91.40	gold quality
left adrenal gland	UBERON:0001234	91.38	gold quality
right adrenal gland	UBERON:0001233	91.31	gold quality
epithelial cell of pancreas	CL:0000083	91.21	gold quality
left adrenal gland cortex	UBERON:0035825	91.19	gold quality
leukocyte	CL:0000738	91.17	gold quality
monocyte	CL:0000576	91.01	gold quality
pancreatic ductal cell	CL:0002079	90.94	gold quality
zone of skin	UBERON:0000014	90.93	gold quality
transverse colon	UBERON:0001157	90.90	gold quality
adrenal cortex	UBERON:0001235	90.90	gold quality
lymph node	UBERON:0000029	90.79	gold quality
small intestine Peyer’s patch	UBERON:0003454	90.79	gold quality
mouth mucosa	UBERON:0003729	90.79	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-MTAB-6524	no	99.87
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

48 targeting PYM1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-5196-5P	100.00	67.98	2761
HSA-MIR-4747-5P	100.00	67.90	2681
HSA-MIR-4425	100.00	67.59	1049
HSA-MIR-4510	100.00	66.60	2050
HSA-MIR-6127	100.00	66.76	2188
HSA-MIR-6129	100.00	66.46	2080
HSA-MIR-6130	100.00	66.69	2012
HSA-MIR-6133	100.00	66.48	2064
HSA-MIR-4533	100.00	69.48	2758
HSA-MIR-515-5P	99.92	69.82	2343
HSA-MIR-519E-5P	99.92	69.62	2358
HSA-MIR-15A-5P	99.90	72.80	2787
HSA-MIR-15B-5P	99.90	72.78	2798
HSA-MIR-16-5P	99.90	72.80	2780
HSA-MIR-195-5P	99.90	72.81	2805
HSA-MIR-6838-5P	99.89	71.94	2690
HSA-MIR-4728-5P	99.85	69.39	4718
HSA-MIR-6785-5P	99.82	68.68	4428
HSA-MIR-6885-3P	99.75	70.36	3187
HSA-MIR-149-3P	99.72	68.22	3963
HSA-MIR-6883-5P	99.69	68.05	3785
HSA-MIR-6134	99.63	65.68	1537
HSA-MIR-6716-5P	99.56	68.62	1244
HSA-MIR-17-3P	99.55	66.77	1311
HSA-MIR-766-5P	99.47	67.91	2225
HSA-MIR-5695	99.41	67.48	1047
HSA-MIR-6739-3P	99.22	68.84	1843
HSA-MIR-4291	99.20	68.88	2969
HSA-MIR-6852-5P	99.17	66.69	2073
HSA-MIR-922	99.02	67.23	1838

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 29.7% of screened cell lines.

Literature-anchored findings (GeneRIF, showing 2)

• suggest that PYM functions as a bridge between EJC-bearing spliced mRNAs and the translation machinery to enhance translation of the mRNAs (PMID:18026120)
• PYM is an Exon junction complexes(EJC) disassembly factor that acts both in vitro and in living cells, and that antagonizes important EJC functions. (PMID:19410547)

Cross-species orthologs

7 orthologs

Organism	Symbol	Gene ID
danio_rerio	pym1	ENSDARG00000046024
mus_musculus	Pym1	ENSMUSG00000064030
rattus_norvegicus	Pym1	ENSRNOG00000058130
rattus_norvegicus		ENSRNOG00000079680
rattus_norvegicus		ENSRNOG00000087436
drosophila_melanogaster	Pym	FBGN0034918
caenorhabditis_elegans		WBGENE00011871

Protein

Protein identifiers

Partner of Y14 and mago — Q9BRP8 (reviewed: Q9BRP8)

Alternative names: PYM homolog 1 exon junction complex-associated factor, Protein wibg homolog

All UniProt accessions (3): Q9BRP8, F8VT68, H0YJW5

UniProt curated annotations — full annotation on UniProt →

Function. Key regulator of the exon junction complex (EJC), a multiprotein complex that associates immediately upstream of the exon-exon junction on mRNAs and serves as a positional landmark for the intron exon structure of genes and directs post-transcriptional processes in the cytoplasm such as mRNA export, nonsense-mediated mRNA decay (NMD) or translation. Acts as an EJC disassembly factor, allowing translation-dependent EJC removal and recycling by disrupting mature EJC from spliced mRNAs. Its association with the 40S ribosomal subunit probably prevents a translation-independent disassembly of the EJC from spliced mRNAs, by restricting its activity to mRNAs that have been translated. Interferes with NMD and enhances translation of spliced mRNAs, probably by antagonizing EJC functions. May bind RNA; the relevance of RNA-binding remains unclear in vivo, RNA-binding was detected by PubMed:14968132, while PubMed:19410547 did not detect RNA-binding activity independently of the EJC.

Subunit / interactions. Interacts (via N-terminus) with MAGOH and RBM8A; the interaction is direct. Associates (eIF2A-like region) with the 40S ribosomal subunit and the 48S preinitiation complex.

Subcellular location. Cytoplasm. Nucleus. Nucleolus. Nucleoplasm.

Domain organisation. The eIF2A-like region shares sequence similarity with eIF2A and mediates the interaction with the 40S ribosomal subunit and the 48S preinitiation complex.

Similarity. Belongs to the pym family.

Isoforms (2)

UniProt ID	Names	Canonical?
Q9BRP8-1	1	yes
Q9BRP8-2	2

RefSeq proteins (2): NP_001137325, NP_115721* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR015362	WIBG_mago-bd	Domain
IPR036348	WIBG_N_sf	Homologous_superfamily
IPR039333	PYM1	Family

Pfam: PF09282

UniProt features (18 total): modified residue 5, region of interest 4, compositionally biased region 3, coiled-coil region 2, chain 1, splice variant 1, sequence variant 1, sequence conflict 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9BRP8-F1	76.01	0.36

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (5): 1, 6, 64, 72, 117

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 142 (showing top): TGCTGCT_MIR15A_MIR16_MIR15B_MIR195_MIR424_MIR497, AREB6_03, GOBP_MACROMOLECULE_CATABOLIC_PROCESS, ACTGCAG_MIR173P, YY1_Q6, GOBP_TRANSLATION, GOBP_POST_TRANSCRIPTIONAL_REGULATION_OF_GENE_EXPRESSION, CCANNAGRKGGC_UNKNOWN, SOX9_B1, IRF1_Q6, IRF_Q6, AACTTT_UNKNOWN, RYTTCCTG_ETS2_B, TCCAGAG_MIR518C, ELK1_01

GO Biological Process (4): nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184), positive regulation of translation (GO:0045727), exon-exon junction complex disassembly (GO:1903259), regulation of translation (GO:0006417)

GO Molecular Function (3): RNA binding (GO:0003723), ribosome binding (GO:0043022), protein binding (GO:0005515)

GO Cellular Component (7): nucleoplasm (GO:0005654), nucleolus (GO:0005730), cytoplasm (GO:0005737), cytosol (GO:0005829), cell junction (GO:0030054), exon-exon junction complex (GO:0035145), nucleus (GO:0005634)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	4
translation	2
nuclear lumen	2
nuclear-transcribed mRNA catabolic process	1
regulation of translation	1
positive regulation of gene expression	1
positive regulation of protein metabolic process	1
protein-containing complex disassembly	1
post-transcriptional regulation of gene expression	1
regulation of protein metabolic process	1
nucleic acid binding	1
ribonucleoprotein complex binding	1
binding	1
intracellular membraneless organelle	1
intracellular anatomical structure	1
cytoplasm	1
nuclear protein-containing complex	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

792 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
PYM1	MAGOHB	Q96A72	964
PYM1	MAGOH	P50606	964
PYM1	RBM8A	Q9Y5S9	705
PYM1	UPF3B	Q9BZI7	618
PYM1	EIF4A3	P38919	597
PYM1	UPF1	Q92900	543
PYM1	UPF2	Q9HAU5	524
PYM1	UPF3A	Q9H1J1	449
PYM1	ADCY10	Q96PN6	420
PYM1	STOML2	Q9UJZ1	419
PYM1	CASC3	O15234	407
PYM1	SEC63	Q9UGP8	386
PYM1	SUOX	P51687	386
PYM1	SMG7	Q92540	382
PYM1	AAR2	Q9Y312	376

IntAct

132 interactions, top by confidence:

A	B	Type	Score
CASC3	EIF4A3	psi-mi:“MI:0915”(physical association)	0.980
RBM8A	MAGOH	psi-mi:“MI:0915”(physical association)	0.980
RBM8A	MAGOH	psi-mi:“MI:0914”(association)	0.980
MAGOH	CASC3	psi-mi:“MI:0914”(association)	0.970
CDKN2C	CDK4	psi-mi:“MI:0914”(association)	0.970
PYM1	MAGOH	psi-mi:“MI:0914”(association)	0.940
PYM1	MAGOH	psi-mi:“MI:0915”(physical association)	0.940
MAGOH	PYM1	psi-mi:“MI:0914”(association)	0.940
MAGOH	PYM1	psi-mi:“MI:0915”(physical association)	0.940
MAGOH	EIF4A3	psi-mi:“MI:0914”(association)	0.940
RBM8A	CASC3	psi-mi:“MI:0914”(association)	0.900
LARP7	CCNT1	psi-mi:“MI:0914”(association)	0.850
MOB1B	LATS1	psi-mi:“MI:0914”(association)	0.840
N	HNRNPR	psi-mi:“MI:0914”(association)	0.730
CDA	LIN7A	psi-mi:“MI:0914”(association)	0.640
PYM1	CASC3	psi-mi:“MI:0914”(association)	0.620

BioGRID (189): RTN4IP1 (Two-hybrid), WIBG (Affinity Capture-RNA), WIBG (Affinity Capture-RNA), WIBG (Affinity Capture-MS), WIBG (Affinity Capture-MS), WIBG (Affinity Capture-MS), NELFE (Co-fractionation), WIBG (Co-fractionation), WIBG (Co-fractionation), WIBG (Co-fractionation), RTN4IP1 (Two-hybrid), WIBG (Affinity Capture-MS), WIBG (Affinity Capture-MS), WIBG (Affinity Capture-MS), WIBG (Affinity Capture-MS)

ESM2 similar proteins: A1A4P4, A1CH36, A2ALW5, A5AAL8, B0BN56, O42911, O70279, P0C2B7, P58468, P83565, Q0CLE8, Q1ECT8, Q290P4, Q2GVC2, Q3SZ86, Q4G0I0, Q4V7Q1, Q5B4U6, Q5BJW9, Q5RFR4, Q5XJW2, Q61733, Q6RUT7, Q753F1, Q7SDU5, Q7SHR9, Q80ZS3, Q86TS9, Q8BGX2, Q8BK72, Q8CHP5, Q8SPE7, Q8TAE8, Q8VD26, Q8WUQ7, Q96AN5, Q96DF8, Q9BRP8, Q9BSF4, Q9BYN8

Diamond homologs: A6QPH1, B0WII7, B1WB17, B4NSP6, B5XDD3, B5XG19, P82804, Q16LW2, Q2F5J3, Q640E9, Q6PH11, Q7Q6B5, Q8CHP5, Q9BRP8, Q9LPZ4, Q5ZKC1, Q4QRJ7, Q8BJW6, Q9BY44

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 137 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Nonsense-Mediated Decay (NMD)	10	26.2×	3e-10
Eukaryotic Translation Initiation	7	24.3×	2e-07
Cap-dependent Translation Initiation	7	24.3×	2e-07
SARS-CoV-1 modulates host translation machinery	7	24.3×	2e-07
Eukaryotic Translation Elongation	7	21.9×	5e-07
Activation of the mRNA upon binding of the cap-binding complex and eIFs, and subsequent binding to 43S	7	21.4×	5e-07
SARS-CoV-2 modulates host translation machinery	8	20.1×	1e-07
Influenza Viral RNA Transcription and Replication	8	19.4×	2e-07

GO biological processes:

GO term	Partners	Fold	FDR
cytoplasmic translation	13	19.6×	8e-11
nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	5	19.0×	5e-04
mRNA export from nucleus	7	16.8×	3e-05
ribosomal small subunit biogenesis	7	13.0×	1e-04
rRNA processing	11	12.7×	3e-07
regulation of alternative mRNA splicing, via spliceosome	5	9.9×	9e-03
translation	10	8.3×	5e-05
mRNA splicing, via spliceosome	10	7.5×	1e-04

Disease & clinical

Clinical variants and AI predictions

ClinVar

11 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	8
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

865 predictions. Top by Δscore:

Variant	Effect	Δscore
12:55902351:CATAT:C	acceptor_gain	1.0000
12:55903370:AAAG:A	donor_gain	1.0000
12:55903385:A:AC	donor_gain	1.0000
12:55903385:A:AT	donor_loss	1.0000
12:55903386:C:CC	donor_gain	1.0000
12:55903386:CA:C	donor_gain	1.0000
12:55903396:T:TA	donor_gain	1.0000
12:55903399:T:TA	donor_gain	1.0000
12:55903412:AT:A	donor_gain	1.0000
12:55903413:T:C	donor_gain	1.0000
12:55903413:T:TA	donor_gain	1.0000
12:55903476:CTTGC:C	acceptor_gain	1.0000
12:55903477:TTGC:T	acceptor_gain	1.0000
12:55903478:TGCCT:T	acceptor_loss	1.0000
12:55903479:GC:G	acceptor_gain	1.0000
12:55903479:GCCTA:G	acceptor_loss	1.0000
12:55903480:CC:C	acceptor_gain	1.0000
12:55903480:CCTAA:C	acceptor_loss	1.0000
12:55903481:C:A	acceptor_loss	1.0000
12:55903481:C:CC	acceptor_gain	1.0000
12:55902353:TAT:T	acceptor_gain	0.9900
12:55902353:TATC:T	acceptor_loss	0.9900
12:55902354:ATCTG:A	acceptor_loss	0.9900
12:55902355:TCTG:T	acceptor_loss	0.9900
12:55902356:C:CC	acceptor_gain	0.9900
12:55902356:CTGCA:C	acceptor_loss	0.9900
12:55902357:T:G	acceptor_loss	0.9900
12:55903379:CCA:C	donor_gain	0.9900
12:55903384:TAC:T	donor_gain	0.9900
12:55903385:ACA:A	donor_gain	0.9900

AlphaMissense

1303 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
12:55903439:G:T	R27S	1.000
12:55902354:A:C	Y45D	0.999
12:55902354:A:G	Y45H	0.999
12:55903447:C:A	G24V	0.999
12:55903447:C:T	G24E	0.999
12:55903448:C:A	G24W	0.999
12:55902346:G:C	N47K	0.998
12:55902346:G:T	N47K	0.998
12:55902354:A:T	Y45N	0.998
12:55903419:T:A	K33N	0.998
12:55903419:T:G	K33N	0.998
12:55903471:A:T	I16N	0.998
12:55901987:A:G	L167P	0.997
12:55902017:A:G	L157P	0.997
12:55903393:A:T	V42D	0.997
12:55903412:A:G	Y36H	0.997
12:55903415:C:G	G35R	0.997
12:55903415:C:T	G35R	0.997
12:55903434:C:A	K28N	0.997
12:55903434:C:G	K28N	0.997
12:55903438:C:G	R27P	0.997
12:55903451:C:G	D23H	0.997
12:55901931:T:C	K186E	0.996
12:55902005:A:G	L161P	0.996
12:55902009:T:C	K160E	0.996
12:55902012:T:C	K159E	0.996
12:55902222:G:T	R89S	0.996
12:55902347:T:A	N47I	0.996
12:55902353:T:C	Y45C	0.996
12:55903405:G:T	P38H	0.996

dbSNP variants (sampled 300 via entrez): RS1000000622 (12:55926607 A>C), RS1000160488 (12:55925061 C>T), RS1000165254 (12:55902108 C>T), RS1000181334 (12:55920841 T>C), RS1000260623 (12:55924795 A>T), RS1000282407 (12:55908856 A>C), RS1000398860 (12:55926879 C>A,G), RS1000552715 (12:55905656 T>C,G), RS1000578731 (12:55925708 GCAGTTTATTCCTTTTTCTCTTC>G), RS1000648158 (12:55921772 A>G), RS1000792386 (12:55918728 C>T), RS1000956503 (12:55921945 C>T), RS1000989935 (12:55913233 A>T), RS1000995049 (12:55927826 C>T), RS1001003427 (12:55901039 G>A)

Disease associations

OMIM: gene MIM:619753 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST010002_217	Refractive error	6.000000e-174

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL6066359 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

ChEMBL bioactivities

2 potent at pChembl≥5 of 2 total, top 2 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
5.14	Kd	7239	nM	CHEMBL5653589
5.14	ED50	7239	nM	CHEMBL5653589

PubChem BioAssay actives

1 with measured affinity, of 2 total; 1 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
4-methyl-3-[(2-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2149782: Binding affinity to human WIBG incubated for 45 mins by Kinobead based pull down assay	kd	7.2391	uM

CTD chemical–gene interactions

45 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects expression, decreases expression, decreases methylation	4
bisphenol A	decreases expression, increases expression	2
Benzo(a)pyrene	decreases expression	2
Cisplatin	affects cotreatment, increases expression	2
p-Chloromercuribenzoic Acid	affects cotreatment, decreases expression	2
GSK-J4	decreases expression	1
FR900359	decreases phosphorylation	1
bisphenol F	increases expression	1
methylmercuric chloride	decreases expression	1
pyrogallol 1,3-dimethyl ether	decreases expression, affects localization, increases expression, affects cotreatment	1
trichostatin A	affects expression	1
tetrahydropalmatine	decreases expression	1
arsenite	increases reaction, affects binding	1
sodium arsenite	decreases expression	1
di-n-butylphosphoric acid	affects expression	1
2,3,5-(triglutathion-S-yl)hydroquinone	increases ADP-ribosylation	1
CGP 52608	affects binding, increases reaction	1
scriptaid	decreases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
Grape Seed Proanthocyanidins	affects cotreatment, decreases expression	1
dorsomorphin	affects cotreatment, decreases expression	1
jinfukang	affects cotreatment, increases expression	1
bisphenol AF	increases expression	1
Sunitinib	decreases expression	1
Panobinostat	decreases expression	1
Caffeine	decreases phosphorylation	1
Cannabidiol	increases expression	1
Catechin	affects cotreatment, decreases expression	1
Deoxyglucose	increases expression	1
Doxorubicin	decreases expression	1

ChEMBL screening assays

1 unique, capped per target: 1 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL5652824	Binding	Binding affinity to human WIBG incubated for 45 mins by Kinobead based pull down assay	NVP-BHG712: Effects of Regioisomers on the Affinity and Selectivity toward the EPHrin Family. — ChemMedChem

Cellosaurus cell lines

1 cell lines: 1 transformed cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B3FH	Abcam HEK293T PYM1 KO	Transformed cell line	Female

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.