RAB10

Summary

RAB10 (RAB10, member RAS oncogene family, HGNC:9759) is a protein-coding gene on chromosome 2p23.3, encoding Ras-related protein Rab-10 (P61026). The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. It is a selective cancer dependency (DepMap: 41.1% of cell lines).

RAB10 belongs to the RAS (see HRAS; MIM 190020) superfamily of small GTPases. RAB proteins localize to exocytic and endocytic compartments and regulate intracellular vesicle trafficking (Bao et al., 1998 [PubMed 9918381]).

Source: NCBI Gene 10890 — RefSeq curated summary.

At a glance

• GWAS associations: 11
• Clinical variants (ClinVar): 21 total
• Druggable target: yes — 1 molecules with ChEMBL bioactivity
• Cancer dependency (DepMap): dependent in 41.1% of screened cell lines
• MANE Select transcript: NM_016131

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:9759
Approved symbol	RAB10
Name	RAB10, member RAS oncogene family
Location	2p23.3
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000084733
Ensembl biotype	protein_coding
OMIM	612672
Entrez	10890

Gene structure

Transcript identifiers

Ensembl transcripts: 14 — 11 protein_coding, 2 protein_coding_CDS_not_defined, 1 retained_intron

ENST00000264710, ENST00000462003, ENST00000473035, ENST00000495146, ENST00000906079, ENST00000906080, ENST00000906081, ENST00000906082, ENST00000906083, ENST00000906084, ENST00000906085, ENST00000926496, ENST00000926497, ENST00000969012

RefSeq mRNA: 1 — MANE Select: NM_016131 NM_016131

CCDS: CCDS1720

Canonical transcript exons

ENST00000264710 — 6 exons

Exon	Start	End
ENSE00001136865	26134938	26137454
ENSE00001136869	26034084	26034735
ENSE00003465594	26109768	26109906
ENSE00003494350	26098662	26098722
ENSE00003603322	26127144	26127233
ENSE00003661721	26127850	26127951

Expression profiles

Bgee: expression breadth ubiquitous, 264 present calls, max score 99.81.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 77.2758 / max 553.9949, expressed in 1828 samples.

FANTOM5 promoters (10 alternative TSS)

Promoter ID	TPM avg	Samples expressed
19236	60.0519	1827
19237	6.6305	1607
19239	5.9388	1376
19248	1.6296	1006
19238	1.0420	632
19242	0.8989	478
19249	0.7519	424
19241	0.2077	61
19240	0.0910	33
202118	0.0334	10

Top tissues by expression

264 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
epithelial cell of pancreas	CL:0000083	99.81	gold quality
ileal mucosa	UBERON:0000331	99.66	gold quality
pancreatic ductal cell	CL:0002079	99.56	gold quality
endothelial cell	CL:0000115	99.41	gold quality
tibialis anterior	UBERON:0001385	99.38	gold quality
esophagus squamous epithelium	UBERON:0006920	99.38	gold quality
gingiva	UBERON:0001828	99.37	gold quality
gingival epithelium	UBERON:0001949	99.37	gold quality
vastus lateralis	UBERON:0001379	99.28	gold quality
deltoid	UBERON:0001476	99.21	gold quality
quadriceps femoris	UBERON:0001377	99.20	gold quality
lower esophagus mucosa	UBERON:0035834	99.19	gold quality
pharyngeal mucosa	UBERON:0000355	99.15	gold quality
oral cavity	UBERON:0000167	99.04	gold quality
upper arm skin	UBERON:0004263	99.00	gold quality
epithelium of nasopharynx	UBERON:0001951	98.96	gold quality
nasopharynx	UBERON:0001728	98.94	gold quality
esophagus mucosa	UBERON:0002469	98.93	gold quality
upper leg skin	UBERON:0004262	98.93	gold quality
body of tongue	UBERON:0011876	98.88	gold quality
biceps brachii	UBERON:0001507	98.85	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	98.85	gold quality
skin of hip	UBERON:0001554	98.80	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	98.80	gold quality
skeletal muscle tissue	UBERON:0001134	98.73	gold quality
kidney epithelium	UBERON:0004819	98.67	gold quality
tongue	UBERON:0001723	98.61	gold quality
cortical plate	UBERON:0005343	98.54	gold quality
mammalian vulva	UBERON:0000997	98.46	gold quality
left ventricle myocardium	UBERON:0006566	98.46	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-CURD-114	yes	54.19
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

231 targeting RAB10, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-LET-7A-3P	100.00	74.03	3932
HSA-LET-7B-3P	100.00	74.08	3913
HSA-LET-7F-1-3P	100.00	74.02	3928
HSA-MIR-98-3P	100.00	74.08	3907
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-432-3P	100.00	67.86	705
HSA-MIR-1193	100.00	65.93	529
HSA-MIR-3646	100.00	73.56	5283
HSA-MIR-30A-5P	100.00	76.31	3233
HSA-MIR-30B-5P	100.00	76.29	3248
HSA-MIR-30C-5P	100.00	76.29	3248
HSA-MIR-30D-5P	100.00	76.32	3233
HSA-MIR-30E-5P	100.00	76.32	3242
HSA-MIR-5692B	100.00	71.32	2622
HSA-MIR-5692C	100.00	71.32	2622
HSA-MIR-196A-1-3P	99.99	72.15	2772
HSA-MIR-4282	99.99	75.36	6408
HSA-MIR-3662	99.99	73.82	5684
HSA-MIR-3185	99.99	68.12	1959
HSA-MIR-223-3P	99.99	70.14	1140
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-3692-3P	99.98	70.27	2139
HSA-MIR-4789-5P	99.98	70.76	2721
HSA-LET-7F-2-3P	99.98	70.98	2588
HSA-MIR-1185-1-3P	99.98	71.04	2593
HSA-MIR-1185-2-3P	99.98	71.04	2593
HSA-MIR-103A-3P	99.98	69.14	1595
HSA-MIR-107	99.98	69.14	1595
HSA-MIR-548P	99.98	72.25	3784
HSA-MIR-4482-3P	99.98	72.50	3147

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 41.1% of screened cell lines.

Literature-anchored findings (GeneRIF, showing 40)

• Fibronectin 1 and RAB10 show elevated expression in uninvolved psoriatic epidermis. (PMID:15855153)
• a related Rab protein, Rab10, can interact with myosin Va, myosin Vb, and myosin Vc (PMID:19008234)
• Rab10, acting upstream of Rab5, plays a prominent role in phagolysosome formation and can modulate Mycobacterium-containing phagosomes maturation (PMID:20028485)
• Rab10 and Rab8A are new cytoplasmic factors implicated in WPB biogenesis that play a role in generating granules that can rapidly respond to secretagogue (PMID:21070595)
• Insulin-stimulated GLUT4 protein translocation in adipocytes requires the Rab10 guanine nucleotide exchange factor Dennd4C (PMID:21454697)
• Rab10 regulates endoplasmic reticulum dynamics/morphology. Suggest that these dynamics could be coupled to phospholipid synthesis. (PMID:23263280)
• Rab10 silencing increased the plasma membrane residence of HAS3, resulting in a significant increase of hyaluronan secretion and an enlarged cell surface HA coat, whereas Rab10 overexpression suppressed hyaluronan synthesis. (PMID:24509846)
• Rab10 is a target of the GTPase-activating protein AS160, which is inhibited after phosphorylation by the protein kinase Akt. (PMID:25103239)
• the target gene RAB10 regulated by miRNA-369-3p, miRNA-30e-5p, miRNA-30e-3p, and miRNA-655 may play key role in the progression and development of AD. (PMID:26082458)
• The Anaplasma phagocytophilum surface protein, uridine monophosphate kinase, was identified as a guanine nucleotide-independent, Rab10-specific ligand. (PMID:26289115)
• miR-329 also suppresses wound-healing and migration ability of osteosarcoma cells and inhibits tumorigenicity in vivo. Rab10 was identified as a target of miR-329 in osteosarcoma and mediates its biofunction (PMID:27487475)
• Data suggest that MGCRABGAP is involved in mammalian spermiogenesis by modulating RAB10. (PMID:28067790)
• RAB10 regulates cell survival and proliferation through multiple oncogenic, cell stress and apoptosis pathways. More importantly, high RAB10 expression levels in HCC cells correlated with a poor prognosis in HCC patients. (PMID:28460436)
• Interrogating Parkinson’s disease LRRK2 kinase pathway activity by assessing Rab10 phosphorylation in human neutrophils has been reported. (PMID:29127255)
• Our results suggest that RAB10 could be a promising therapeutic target for Alzheimer’s Disease prevention (PMID:29183403)
• The findings of this study indicated that Rab10 phosphorylation could be responsible for aberrations in the vesicle trafficking observed in AD leading to neurodegeneration. (PMID:29562525)
• LRRK2 mutations impair depolarization-induced mitophagy through inhibition of mitochondrial accumulation of RAB10. (PMID:30945962)
• Pathogenic LRRK2 causes the centrosomal accumulation not only of phosho-RAB8 but also of phospho-RAB10, and the effects on centrosomal cohesion are dependent on RAB8, RAB10 and RILPL1. (PMID:31428781)
• PSMB8-AS1 activated by ELK1 promotes cell proliferation in glioma via regulating miR-574-5p/RAB10. (PMID:31812014)
• Knockdown of circular RNA UBAP2 inhibits the malignant behaviours of esophageal squamous cell carcinoma by microRNA-422a/Rab10 axis. (PMID:32012318)
• Down-regulation of circ-PTN suppresses cell proliferation, invasion and glycolysis in glioma by regulating miR-432-5p/RAB10 axis. (PMID:32629066)
• Distinct Roles for RAB10 and RAB29 in Pathogenic LRRK2-Mediated Endolysosomal Trafficking Alterations. (PMID:32709066)
• miR-409-3p inhibits the proliferation and migration of human ovarian cancer cells by targeting Rab10. (PMID:33287942)
• Defining the protein and lipid constituents of tubular recycling endosomes. (PMID:33334886)
• LncRNA EBLN3P promotes the progression of osteosarcoma through modifying the miR-224-5p/Rab10 signaling axis. (PMID:33479458)
• Long noncoding RNA CYTOR triggers gastric cancer progression by targeting miR-103/RAB10. (PMID:34110382)
• R1441G but not G2019S mutation enhances LRRK2 mediated Rab10 phosphorylation in human peripheral blood neutrophils. (PMID:34125248)
• RAB10 Interacts with ABCB4 and Regulates Its Intracellular Traffic. (PMID:34209301)
• Salmonella effector SopD promotes plasma membrane scission by inhibiting Rab10. (PMID:34349110)
• Circular RNA hsa_circ_0001658 regulates apoptosis and autophagy in gastric cancer through microRNA-182/Ras-related protein Rab-10 signaling axis. (PMID:35030981)
• Circ_KCNQ5 participates in the progression of childhood acute myeloid leukemia by enhancing the expression of RAB10 via binding to miR-622. (PMID:35413218)
• Elevated Urinary Rab10 Phosphorylation in Idiopathic Parkinson Disease. (PMID:35521944)
• Exosomal miR-10527-5p Inhibits Migration, Invasion, Lymphangiogenesis and Lymphatic Metastasis by Affecting Wnt/beta-Catenin Signaling via Rab10 in Esophageal Squamous Cell Carcinoma. (PMID:36636641)
• O-GlcNAcylation of RAB10 promotes hepatocellular carcinoma progression. (PMID:37218374)
• MiR-409-3p regulates the proliferation and apoptosis of THP-1 through targeting Rab10. (PMID:37437422)
• CIRCTDRD9 CONTRIBUTES TO SEPSIS-INDUCED ACUTE LUNG INJURY BY ENHANCING THE EXPRESSION OF RAB10 VIA DIRECTLY BINDING TO MIR-223-3P. (PMID:37548713)
• RAB10 promotes breast cancer proliferation migration and invasion predicting a poor prognosis for breast cancer. (PMID:37709911)
• Cellular and subcellular localization of Rab10 and phospho-T73 Rab10 in the mouse and human brain. (PMID:38110990)
• Coronavirus M Protein Trafficking in Epithelial Cells Utilizes a Myosin Vb Splice Variant and Rab10. (PMID:38247817)
• The LRRK2 kinase substrates RAB8a and RAB10 contribute complementary but distinct disease-relevant phenotypes in human neurons. (PMID:38307024)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	rab10	ENSDARG00000046106
mus_musculus	Rab10	ENSMUSG00000020671
rattus_norvegicus	Rab10	ENSRNOG00000047088

Paralogs (68): RAB27B (ENSG00000041353), RAB27A (ENSG00000069974), RAB7A (ENSG00000075785), RABL2B (ENSG00000079974), RAB21 (ENSG00000080371), RAB18 (ENSG00000099246), RAB36 (ENSG00000100228), IFT27 (ENSG00000100360), RAB40AL (ENSG00000102128), RAB11A (ENSG00000103769), RAB2A (ENSG00000104388), RAB3D (ENSG00000105514), RAB3A (ENSG00000105649), RAB5C (ENSG00000108774), RAB34 (ENSG00000109113), RAB5B (ENSG00000111540), RAB35 (ENSG00000111737), RAB23 (ENSG00000112210), DNAJC27 (ENSG00000115137), RAB29 (ENSG00000117280), RAB32 (ENSG00000118508), RAB14 (ENSG00000119396), RAB9B (ENSG00000123570), RAB9A (ENSG00000123595), RAB38 (ENSG00000123892), RAB22A (ENSG00000124209), RAB17 (ENSG00000124839), RAB2B (ENSG00000129472), RAB25 (ENSG00000132698), RAB33A (ENSG00000134594), RAB30 (ENSG00000137502), RAB1A (ENSG00000138069), RAB20 (ENSG00000139832), RAB15 (ENSG00000139998), RAB40B (ENSG00000141542), RAB13 (ENSG00000143545), RABL2A (ENSG00000144134), RAB5A (ENSG00000144566), RAB19 (ENSG00000146955), RAB41 (ENSG00000147127)

Protein

Protein identifiers

Ras-related protein Rab-10 — P61026 (reviewed: P61026)

All UniProt accessions (1): P61026

UniProt curated annotations — full annotation on UniProt →

Function. The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different set of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. RAB10 is mainly involved in the biosynthetic transport of proteins from the Golgi to the plasma membrane. Regulates, for instance, SLC2A4/GLUT4 glucose transporter-enriched vesicles delivery to the plasma membrane. In parallel, RAB10 regulates the transport of TLR4, a toll-like receptor to the plasma membrane and therefore may be important for innate immune response. Also plays a specific role in asymmetric protein transport to the plasma membrane. In neurons, involved in axonogenesis through regulation of vesicular membrane trafficking toward the axonal plasma membrane. In epithelial cells, regulates transport from the Golgi to the basolateral membrane. May play a role in the basolateral recycling pathway and in phagosome maturation. May play a role in endoplasmic reticulum dynamics and morphology controlling tubulation along microtubules and tubules fusion. Together with LRRK2, RAB8A, and RILPL1, regulates ciliogenesis. When phosphorylated by LRRK2 on Thr-73, binds RILPL1 and inhibits ciliogenesis. Participates in the export of a subset of neosynthesized proteins through a Rab8-Rab10-Rab11-dependent endososomal export route. Targeted to and stabilized on stressed lysosomes through LRRK2 phosphorylation where it promotes the extracellular release of lysosomal content through EHBP1 and EHNP1L1 effector proteins. (Microbial infection) Upon Legionella pneumophila infection promotes endoplasmic reticulum recruitment and bacterial replication. Plays a role in remodeling the Legionella-containing vacuole (LCV) into an endoplasmic reticulum-like vacuole.

Subunit / interactions. Interacts with MYO5A; mediates the transport to the plasma membrane of SLC2A4/GLUT4 storage vesicles. Interacts with GDI1 and with GDI2; negatively regulates RAB10 association with membranes and activation. Interacts (GDP-bound form) with LLGL1; the interaction is direct and promotes RAB10 association with membranes and activation through competition with the Rab inhibitor GDI1. Interacts with EXOC4; probably associates with the exocyst. Interacts (GTP-bound form) with MICALCL, MICAL1, MICAL3, EHBP1 and EHBP1L1; at least in case of MICAL1 two molecules of RAB10 can bind to one molecule of MICAL1. Interacts with TBC1D13. Interacts with SEC16A. Interacts with CHM and CHML. Interacts with LRRK2; interaction facilitates phosphorylation of Thr-73. Interacts (when phosphorylated on Thr-73) with RILPL1 and RILPL2. Interacts with TBC1D21. Interacts with MARCKS.

Subcellular location. Cytoplasmic vesicle membrane. Golgi apparatus membrane. Golgi apparatus. trans-Golgi network membrane. Endosome membrane. Recycling endosome membrane. Cytoplasmic vesicle. Phagosome membrane. Cytoplasm. Cytoskeleton. Cilium basal body. Endoplasmic reticulum membrane. Perinuclear region. Lysosome.

Tissue specificity. Expressed in the hippocampus. Expressed in neutrophils (at protein level). Expressed in the testis (at protein level).

Post-translational modifications. Ubiquitinated upon Legionella pneumophila infection. Ubiquitination does not lead to proteasomal degradation. Phosphorylation of Thr-73 in the switch II region by LRRK2 prevents the association of dRAB regulatory proteins, including CHM, CHML and RAB GDP dissociation inhibitors GDI1 and GDI2. Phosphorylation of Thr-73 by LRRK2 is stimulated by RAB29 and RAB32. Phosphorylation by LRRK2 is required for localization to stressed lysosomes.

Activity regulation. Regulated by guanine nucleotide exchange factors (GEFs) DENND4C and RABIF which promote the exchange of bound GDP for free GTP. Regulated by GTPase activating proteins (GAPs) including TBC1D21 which increase the GTP hydrolysis activity. Inhibited by GDP dissociation inhibitors GDI1 and GDI2 which prevent Rab-GDP dissociation.

Domain organisation. Switch I, switch II and the interswitch regions are characteristic of Rab GTPases and mediate the interactions with Rab downstream effectors. The switch regions undergo conformational changes upon nucleotide binding which drives interaction with specific sets of effector proteins, with most effectors only binding to GTP-bound Rab.

Similarity. Belongs to the small GTPase superfamily. Rab family.

RefSeq proteins (1): NP_057215* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001806	Small_GTPase	Family
IPR005225	Small_GTP-bd	Domain
IPR027417	P-loop_NTPase	Homologous_superfamily
IPR050305	Small_GTPase_Rab	Family

Pfam: PF00071

Catalyzed reactions (Rhea), 1 shown:

• GTP + H2O = GDP + phosphate + H(+) (RHEA:19669)

UniProt features (56 total): binding site 22, helix 9, strand 7, mutagenesis site 5, cross-link 3, region of interest 2, modified residue 2, lipid moiety-binding region 2, turn 2, chain 1, sequence conflict 1

Structure

Experimental structures (PDB)

4 structures.

PDB	Method	Resolution (Å)
9G0C	X-RAY DIFFRACTION	1.8
9G0D	X-RAY DIFFRACTION	2.05
5SZJ	X-RAY DIFFRACTION	2.66
5LPN	X-RAY DIFFRACTION	2.8

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P61026-F1	86.41	0.71

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (22): 24; 35; 36; 40; 41; 41; 64; 67; 122; 123; 125; 126 …

Post-translational modifications (7): 73, 102, 199, 200, 102, 136, 154

Mutagenesis-validated functional residues (5):

Position	Phenotype
23	probable dominant negative mutant locked in the inactive gdp-bound form; alters the basolateral recycling pathway in epi
68	probable constitutively active mutant unable to hydrolyze gtp; accumulates at the base of the primary cilium and alters
73	loss of phosphorylation. no effect on gdi1 and gdi2 binding. increases localization to the cytosol. does not translocate
73	phosphomimetic mutant. reduces interaction with gdi1.
73	phosphomimetic mutant. loss of gdi1 and gdi2 binding. increases localization to the golgi complex.

Function

Pathways and Gene Ontology

Reactome pathways

4 pathways

ID	Pathway
R-HSA-1445148	Translocation of SLC2A4 (GLUT4) to the plasma membrane
R-HSA-6798695	Neutrophil degranulation
R-HSA-8873719	RAB geranylgeranylation
R-HSA-8876198	RAB GEFs exchange GTP for GDP on RABs

MSigDB gene sets: 433 (showing top): GOBP_MORPHOGENESIS_OF_AN_EPITHELIUM, GOBP_RESPONSE_TO_NITROGEN_COMPOUND, GOBP_EPITHELIUM_DEVELOPMENT, REACTOME_INNATE_IMMUNE_SYSTEM, GOBP_ESTABLISHMENT_OR_MAINTENANCE_OF_CELL_POLARITY, TGCGCANK_UNKNOWN, TGCTGCT_MIR15A_MIR16_MIR15B_MIR195_MIR424_MIR497, TGCACTT_MIR519C_MIR519B_MIR519A, GOCC_SECRETORY_GRANULE, MODULE_151, GOBP_ESTABLISHMENT_OF_PROTEIN_LOCALIZATION_TO_ENDOPLASMIC_RETICULUM, TATTATA_MIR374, GOBP_NEUROGENESIS, TGACCTY_ERR1_Q2, GOBP_VESICLE_MEDIATED_TRANSPORT

GO Biological Process (19): exocytosis (GO:0006887), Golgi to plasma membrane transport (GO:0006893), axonogenesis (GO:0007409), vesicle-mediated transport (GO:0016192), endosomal transport (GO:0016197), antigen processing and presentation (GO:0019882), polarized epithelial cell differentiation (GO:0030859), cellular response to insulin stimulus (GO:0032869), Golgi to plasma membrane protein transport (GO:0043001), regulated exocytosis (GO:0045055), establishment of neuroblast polarity (GO:0045200), endoplasmic reticulum tubular network organization (GO:0071786), protein localization to plasma membrane (GO:0072659), establishment of protein localization to membrane (GO:0090150), establishment of protein localization to endoplasmic reticulum membrane (GO:0097051), protein localization to basolateral plasma membrane (GO:1903361), negative regulation of motile cilium assembly (GO:1905504), protein transport (GO:0015031), cell-cell adhesion (GO:0098609)

GO Molecular Function (9): G protein activity (GO:0003925), GTP binding (GO:0005525), GDP binding (GO:0019003), myosin V binding (GO:0031489), cadherin binding involved in cell-cell adhesion (GO:0098641), nucleotide binding (GO:0000166), GTPase activity (GO:0003924), protein binding (GO:0005515), hydrolase activity (GO:0016787)

GO Cellular Component (30): Golgi membrane (GO:0000139), lysosome (GO:0005764), endosome (GO:0005768), endoplasmic reticulum membrane (GO:0005789), Golgi apparatus (GO:0005794), trans-Golgi network (GO:0005802), cytosol (GO:0005829), plasma membrane (GO:0005886), adherens junction (GO:0005912), focal adhesion (GO:0005925), cilium (GO:0005929), endosome membrane (GO:0010008), membrane (GO:0016020), cytoplasmic vesicle membrane (GO:0030659), secretory granule membrane (GO:0030667), phagocytic vesicle membrane (GO:0030670), insulin-responsive compartment (GO:0032593), perinuclear region of cytoplasm (GO:0048471), recycling endosome (GO:0055037), recycling endosome membrane (GO:0055038), extracellular exosome (GO:0070062), exocytic vesicle (GO:0070382), endoplasmic reticulum tubular network (GO:0071782), secretory vesicle (GO:0099503), exocyst (GO:0000145), cytoplasm (GO:0005737), endoplasmic reticulum (GO:0005783), cytoskeleton (GO:0005856), cytoplasmic vesicle (GO:0031410), cell projection (GO:0042995)

Reactome top-level categories

Rollup of top-4 pathways:

Category	Pathways
Membrane Trafficking	1
Innate Immune System	1
Post-translational protein modification	1
Rab regulation of trafficking	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
bounding membrane of organelle	3
cytoplasm	3
cellular anatomical structure	3
vesicle-mediated transport	2
transport	2
protein localization to membrane	2
protein localization to cell periphery	2
establishment of protein localization	2
guanyl ribonucleotide binding	2
endomembrane system	2
cytoplasmic vesicle	2
endosome	2
cytoplasmic vesicle membrane	2
secretory granule	2
secretion by cell	1
vesicle fusion to plasma membrane	1
post-Golgi vesicle-mediated transport	1
vesicle-mediated transport to the plasma membrane	1
cell morphogenesis involved in neuron differentiation	1
neuron projection morphogenesis	1
axon development	1
cellular process	1
intracellular transport	1
immune system process	1
morphogenesis of a polarized epithelium	1
epithelial cell differentiation	1
response to insulin	1
cellular response to peptide hormone stimulus	1
Golgi to plasma membrane transport	1
protein transport	1
establishment of protein localization to plasma membrane	1
protein localization to plasma membrane	1
exocytosis	1
establishment of cell polarity	1
establishment or maintenance of neuroblast polarity	1
endoplasmic reticulum organization	1
localization within membrane	1
establishment of protein localization to endoplasmic reticulum	1
establishment of protein localization to membrane	1
motile cilium assembly	1

Protein interactions and networks

STRING

2464 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
RAB10	RILPL1	Q5EBL4	945
RAB10	EXOC6	Q8TAG9	921
RAB10	RILPL2	Q969X0	919
RAB10	MYO5B	Q9ULV0	913
RAB10	TBC1D4	O60343	911
RAB10	EHBP1	Q8NDI1	888
RAB10	RASA1	P20936	854
RAB10	MYO5A	Q9Y4I1	846
RAB10	SLC2A4	P14672	844
RAB10	EHD2	Q9NZN4	840
RAB10	RABIF	P47224	703
RAB10	MICALL1	Q8N3F8	686
RAB10	GDI2	P50395	658
RAB10	MICAL1	Q8TDZ2	657
RAB10	GDI1	P31150	647

IntAct

163 interactions, top by confidence:

A	B	Type	Score
PRKAA1	PRKAB2	psi-mi:“MI:0914”(association)	0.950
MED20	MED19	psi-mi:“MI:0914”(association)	0.840
GDI1	RAB4A	psi-mi:“MI:0914”(association)	0.820
RAB10	GDI1	psi-mi:“MI:0914”(association)	0.790
IFT70B	IFT56	psi-mi:“MI:0914”(association)	0.790
RABIF	RAB3A	psi-mi:“MI:0914”(association)	0.780
RILPL2	RAB8A	psi-mi:“MI:0914”(association)	0.720
CFTR	ESYT2	psi-mi:“MI:2364”(proximity)	0.710
LRRK2	RAB10	psi-mi:“MI:0217”(phosphorylation reaction)	0.690
RAB10	LRRK2	psi-mi:“MI:0915”(physical association)	0.690
CHM	RAB5C	psi-mi:“MI:0914”(association)	0.640
RAB10	OPTN	psi-mi:“MI:0915”(physical association)	0.560
RAB10	RAB39A	psi-mi:“MI:0915”(physical association)	0.560
RILPL2	RAB10	psi-mi:“MI:0915”(physical association)	0.560
MTNR1A	PGRMC1	psi-mi:“MI:0914”(association)	0.530
RAB12	CHM	psi-mi:“MI:0914”(association)	0.530
RAB10	CHM	psi-mi:“MI:0914”(association)	0.530
rep	AGPS	psi-mi:“MI:0914”(association)	0.530
RILPL1	RAB8A	psi-mi:“MI:0914”(association)	0.500
NRAS	ESYT2	psi-mi:“MI:2364”(proximity)	0.480
sseJ	AGPS	psi-mi:“MI:0914”(association)	0.460

BioGRID (274): RAB10 (Two-hybrid), RAB10 (Affinity Capture-MS), RAB10 (Affinity Capture-MS), CFL1 (Co-fractionation), GDI2 (Co-fractionation), GPI (Co-fractionation), LGALS1 (Co-fractionation), PPIA (Co-fractionation), RAB10 (Co-fractionation), RAB10 (Co-fractionation), RAB10 (Co-fractionation), RAB10 (Co-fractionation), RAB10 (Co-fractionation), RAB10 (Co-fractionation), RAB10 (Co-fractionation)

ESM2 similar proteins: A4FV54, F1PTE3, O24466, O42819, P01123, P11620, P17609, P20790, P20791, P22127, P22128, P24409, P31584, P33723, P34139, P34140, P35280, P35281, P35286, P36410, P51153, P55258, P61006, P61007, P61026, P61027, P61028, P62820, P62821, P62822, P70550, Q05974, Q2HJI8, Q39571, Q4R5P1, Q52NJ2, Q54NU2, Q58DS5, Q5F470, Q5KTJ6

Diamond homologs: A2WSI7, A2Y7R5, A2YEQ6, H9BW96, O17915, O76742, O97572, P09527, P18067, P22127, P24408, P24409, P28748, P32835, P32836, P33519, P34139, P35288, P36411, P36864, P38542, P38543, P38544, P38545, P38546, P38547, P38548, P41914, P41915, P41916, P41917, P41918, P41919, P42558, P51149, P51150, P51151, P52301, P54765, P54766

SIGNOR signaling

2 interactions.

A	Effect	B	Mechanism
RAB10	“form complex”	“Early Endosome”	binding
LRRK2	“down-regulates activity”	RAB10	phosphorylation

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 172 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
RAB geranylgeranylation	11	16.3×	4e-08
NCAM signaling for neurite out-growth	7	16.3×	5e-05
FCERI mediated MAPK activation	5	14.8×	2e-03
TBC/RABGAPs	6	13.3×	6e-04
RAB GEFs exchange GTP for GDP on RABs	12	12.7×	5e-08
Translocation of SLC2A4 (GLUT4) to the plasma membrane	7	9.2×	9e-04
Regulation of RAS by GAPs	5	8.3×	8e-03
Neutrophil degranulation	14	2.8×	1e-02

GO biological processes:

GO term	Partners	Fold	FDR
Rab protein signal transduction	5	33.7×	2e-04
regulation of long-term neuronal synaptic plasticity	5	33.7×	2e-04
Ras protein signal transduction	7	9.8×	2e-03
vesicle-mediated transport	10	6.5×	1e-03
endocytosis	10	6.5×	1e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

21 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	9
Likely benign	0
Benign	1

Top pathogenic / likely-pathogenic (0)

SpliceAI

1406 predictions. Top by Δscore:

Variant	Effect	Δscore
2:26034735:GGTA:G	donor_loss	1.0000
2:26093663:G:GT	donor_gain	1.0000
2:26093711:G:T	donor_gain	1.0000
2:26098655:A:AG	acceptor_gain	1.0000
2:26098660:A:AG	acceptor_gain	1.0000
2:26098661:G:GG	acceptor_gain	1.0000
2:26098718:ATATG:A	donor_gain	1.0000
2:26098719:TATGG:T	donor_loss	1.0000
2:26098721:TGG:T	donor_loss	1.0000
2:26098722:GGT:G	donor_loss	1.0000
2:26098723:G:GA	donor_loss	1.0000
2:26098723:G:GG	donor_gain	1.0000
2:26098724:T:A	donor_loss	1.0000
2:26109766:A:AG	acceptor_gain	1.0000
2:26109766:AG:A	acceptor_gain	1.0000
2:26109766:AGG:A	acceptor_gain	1.0000
2:26109767:G:GG	acceptor_gain	1.0000
2:26109767:GG:G	acceptor_gain	1.0000
2:26109767:GGG:G	acceptor_gain	1.0000
2:26109904:GAGG:G	donor_loss	1.0000
2:26109906:GG:G	donor_loss	1.0000
2:26109908:T:G	donor_loss	1.0000
2:26124043:GAATA:G	donor_gain	1.0000
2:26124048:G:GG	donor_gain	1.0000
2:26127137:A:AG	acceptor_gain	1.0000
2:26127138:T:G	acceptor_gain	1.0000
2:26127139:TTTAG:T	acceptor_loss	1.0000
2:26127140:TTAGC:T	acceptor_loss	1.0000
2:26127141:TAG:T	acceptor_loss	1.0000
2:26127142:A:AG	acceptor_gain	1.0000

AlphaMissense

1339 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
2:26034654:G:A	G16R	1.000
2:26034654:G:C	G16R	1.000
2:26034654:G:T	G16W	1.000
2:26034655:G:A	G16E	1.000
2:26034655:G:T	G16V	1.000
2:26034669:G:A	G21R	1.000
2:26034669:G:C	G21R	1.000
2:26034669:G:T	G21W	1.000
2:26034670:G:A	G21E	1.000
2:26034676:C:T	T23I	1.000
2:26034708:T:C	F34L	1.000
2:26034710:C:A	F34L	1.000
2:26034710:C:G	F34L	1.000
2:26034730:C:T	T41I	1.000
2:26034735:G:A	G43R	1.000
2:26034735:G:C	G43R	1.000
2:26098662:G:A	G43E	1.000
2:26098670:T:C	F46L	1.000
2:26098671:T:C	F46S	1.000
2:26098672:C:A	F46L	1.000
2:26098672:C:G	F46L	1.000
2:26098713:T:C	L60P	1.000
2:26098719:T:A	I62K	1.000
2:26098721:T:A	W63R	1.000
2:26098721:T:C	W63R	1.000
2:26109768:G:C	W63C	1.000
2:26109768:G:T	W63C	1.000
2:26109769:G:C	D64H	1.000
2:26109769:G:T	D64Y	1.000
2:26109770:A:C	D64A	1.000

dbSNP variants (sampled 300 via entrez): RS1000005272 (2:26113298 C>T), RS1000016526 (2:26123412 G>A), RS1000040742 (2:26137037 CTT>C), RS1000071272 (2:26083274 C>T), RS1000103056 (2:26113543 C>T), RS1000198099 (2:26034443 C>G,T), RS1000203158 (2:26080284 A>G), RS1000207861 (2:26060661 A>C,T), RS1000212296 (2:26100657 AC>A), RS1000253407 (2:26033363 GCGCCCAGGTGTTCCTCAACCTTCCTCTCCT>G), RS1000265999 (2:26040101 T>C), RS1000269992 (2:26104585 C>T), RS1000319599 (2:26104928 G>A,C), RS1000319601 (2:26080558 G>A), RS1000326491 (2:26120339 A>C,G,T)

Disease associations

OMIM: gene MIM:612672 | disease phenotypes:

GenCC curated gene-disease

Mondo (1): CIC-rearranged sarcoma (MONDO:0956989)

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

11 associations (top):

Study	Trait	p-value
GCST001491_23	Immune response to smallpox vaccine (IL-6)	8.000000e-06
GCST001817_4	Metabolite levels (HVA-5-HIAA Factor score)	4.000000e-06
GCST001823_1	Metabolite levels (HVA/MHPG ratio)	2.000000e-06
GCST001824_3	Metabolite levels (HVA)	2.000000e-06
GCST004602_80	Mean corpuscular volume	4.000000e-09
GCST004630_23	Mean corpuscular hemoglobin	9.000000e-13
GCST010243_64	Apolipoprotein B levels	3.000000e-08
GCST90002390_349	Mean corpuscular hemoglobin	4.000000e-36
GCST90002391_134	Mean corpuscular hemoglobin concentration	4.000000e-10
GCST90002392_266	Mean corpuscular volume	6.000000e-28
GCST90002401_419	Platelet distribution width	7.000000e-10

EFO canonical traits (8, from GWAS)

EFO ID	Trait name
EFO:0004645	response to vaccine
EFO:0005131	HVA measurement
EFO:0005132	5-HIAA measurement
EFO:0005133	MHPG measurement
EFO:0004527	mean corpuscular hemoglobin
EFO:0004615	apolipoprotein B measurement
EFO:0004528	mean corpuscular hemoglobin concentration
EFO:0007984	platelet component distribution width

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL4105971 (SINGLE PROTEIN)

Molecules with ChEMBL bioactivity

1 molecules (phase ≥1), by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 2,305 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

Molecule	Name	Phase	Patents
CHEMBL483158	ALISERTIB	3	2,305

PharmGKB: 1 entry (VIP=true, CPIC=false)

ChEMBL bioactivities

5 potent at pChembl≥5 of 5 total, top 5 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
6.07	Kd	846.4	nM	CHEMBL3752910
6.07	ED50	846.4	nM	CHEMBL3752910
5.87	Kd	1348	nM	ALISERTIB
5.13	Kd	7336	nM	CHEMBL5653589
5.13	ED50	7336	nM	CHEMBL5653589

PubChem BioAssay actives

3 with measured affinity, of 238 total; 3 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
4-methyl-3-[(1-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2149167: Binding affinity to human RAB10 incubated for 45 mins by Kinobead based pull down assay	kd	0.8464	uM
4-[[9-chloro-7-(2-fluoro-6-methoxyphenyl)-5H-pyrimido[5,4-d][2]benzazepin-2-yl]amino]-2-methoxybenzoic acid	1425148: Kinobeads (epsilon), multiple immobilized ATP-competitive broad spectrum kinase inhibitors, used to assess residual binding of ~300 proteins simultaneously from cell lysate in the presence of a compound. Quantitative readout performed by mass spectrometry.	kd	1.3480	uM
4-methyl-3-[(2-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2149167: Binding affinity to human RAB10 incubated for 45 mins by Kinobead based pull down assay	kd	7.3359	uM

CTD chemical–gene interactions

32 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
bisphenol A	increases expression, affects expression, decreases expression	3
Tobacco Smoke Pollution	increases expression, affects expression	2
Valproic Acid	decreases expression	2
7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	decreases expression	2
Cyclosporine	increases expression	2
FR900359	increases phosphorylation	1
bufotalin	decreases expression	1
decabromobiphenyl ether	increases expression	1
sulforaphane	increases expression	1
sodium arsenite	affects expression	1
tetrabromobisphenol A	increases expression	1
beta-methylcholine	affects expression	1
K 7174	increases expression	1
nutlin 3	affects cotreatment, increases secretion	1
ICG 001	decreases expression	1
bisphenol B	increases expression	1
pentabrominated diphenyl ether 100	increases expression	1
bisphenol AF	increases expression	1
Zoledronic Acid	increases expression	1
Acetaminophen	increases expression	1
Air Pollutants, Occupational	decreases expression	1
Benzo(a)pyrene	affects methylation	1
Dactinomycin	affects cotreatment, increases secretion	1
Doxorubicin	decreases expression	1
Hydrogen Peroxide	affects expression	1
Ivermectin	decreases expression	1
Methyl Methanesulfonate	decreases expression	1
Nickel	decreases expression	1
Ribonucleotides	affects binding	1
Aflatoxin B1	increases methylation	1

ChEMBL screening assays

2 unique, capped per target: 2 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL3991861	Binding	Kinobeads (epsilon), multiple immobilized ATP-competitive broad spectrum kinase inhibitors, used to assess residual binding of ~300 proteins simultaneously from cell lysate in the presence of a compound. Quantitative readout performed by ma	The target landscape of clinical kinase drugs. — Science

Cellosaurus cell lines

6 cell lines: 6 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_A7AI	HeLa M Rab10-KO	Cancer cell line	Female
CVCL_B1H6	Abcam A-549 RAB10 KO	Cancer cell line	Male
CVCL_D3U6	HAP1 RAB10 (-) 1	Cancer cell line	Male
CVCL_D3U7	HAP1 RAB10 (-) 2	Cancer cell line	Male
CVCL_D3U8	HAP1 RAB10 (-) 3	Cancer cell line	Male
CVCL_D7Z2	Ubigene A-549 RAB10 KO	Cancer cell line	Male

Clinical trials (associated diseases)

3 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT02389244	PHASE2	ACTIVE_NOT_RECRUITING	A Phase II Study Evaluating Efficacy and Safety of Regorafenib in Patients With Metastatic Bone Sarcomas
NCT06414434	PHASE1	ACTIVE_NOT_RECRUITING	BTX-A51 in Patients With Liposarcoma or CIC-rearranged Sarcoma
NCT06820957	PHASE2/PHASE3	ACTIVE_NOT_RECRUITING	Testing a New Combination of Anti-cancer Drugs in Patients Newly Diagnosed With Ewing Sarcoma Who Have Cancer That Has Spread to Other Parts of the Body