RAC3

Summary

RAC3 (Rac family small GTPase 3, HGNC:9803) is a protein-coding gene on chromosome 17q25.3, encoding Ras-related C3 botulinum toxin substrate 3 (P60763). Plasma membrane-associated small GTPase which cycles between an active GTP-bound and inactive GDP-bound state.

The protein encoded by this gene is a GTPase which belongs to the RAS superfamily of small GTP-binding proteins. Members of this superfamily appear to regulate a diverse array of cellular events, including the control of cell growth, cytoskeletal reorganization, and the activation of protein kinases. Alternative splicing results in multiple transcript variants.

Source: NCBI Gene 5881 — RefSeq curated summary.

At a glance

• Gene–disease (curated): neurodevelopmental disorder with structural brain anomalies and dysmorphic facies (Strong, GenCC)
• Clinical variants (ClinVar): 65 total — 2 pathogenic, 6 likely-pathogenic
• Druggable target: yes — 1 molecules with ChEMBL bioactivity
• MANE Select transcript: NM_005052

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:9803
Approved symbol	RAC3
Name	Rac family small GTPase 3
Location	17q25.3
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000169750
Ensembl biotype	protein_coding
OMIM	602050
Entrez	5881

Gene structure

Transcript identifiers

Ensembl transcripts: 9 — 8 protein_coding, 1 retained_intron

ENST00000306897, ENST00000580965, ENST00000584341, ENST00000585014, ENST00000906958, ENST00000906959, ENST00000924839, ENST00000924840, ENST00000924841

RefSeq mRNA: 2 — MANE Select: NM_005052 NM_001316307, NM_005052

CCDS: CCDS11798

Canonical transcript exons

ENST00000306897 — 6 exons

Exon	Start	End
ENSE00001164119	82032947	82033009
ENSE00001289808	82031678	82031796
ENSE00001328203	82032387	82032458
ENSE00002720282	82033699	82034204
ENSE00003593085	82032711	82032828
ENSE00003632835	82033440	82033599

Expression profiles

Bgee: expression breadth ubiquitous, 175 present calls, max score 97.34.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 34.0877 / max 671.5417, expressed in 1619 samples.

FANTOM5 promoters (10 alternative TSS)

Promoter ID	TPM avg	Samples expressed
163449	12.8538	1527
163450	12.7680	1481
163453	5.1057	640
163454	0.9116	173
163447	0.8080	373
163455	0.5189	132
163451	0.4119	252
163456	0.2597	100
163448	0.2399	67
163452	0.2101	112

Top tissues by expression

289 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
cortical plate	UBERON:0005343	97.34	gold quality
right hemisphere of cerebellum	UBERON:0014890	95.76	gold quality
cerebellar hemisphere	UBERON:0002245	95.16	gold quality
cerebellar cortex	UBERON:0002129	94.89	gold quality
ganglionic eminence	UBERON:0004023	93.22	gold quality
ventricular zone	UBERON:0003053	92.76	gold quality
cerebellum	UBERON:0002037	91.98	gold quality
right frontal lobe	UBERON:0002810	90.58	gold quality
right testis	UBERON:0004534	89.76	gold quality
cingulate cortex	UBERON:0003027	89.45	gold quality
anterior cingulate cortex	UBERON:0009835	89.37	gold quality
left testis	UBERON:0004533	89.25	gold quality
prefrontal cortex	UBERON:0000451	87.53	gold quality
adenohypophysis	UBERON:0002196	87.44	gold quality
Brodmann (1909) area 9	UBERON:0013540	87.15	gold quality
mucosa of transverse colon	UBERON:0004991	86.60	gold quality
amygdala	UBERON:0001876	86.29	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	86.03	gold quality
pituitary gland	UBERON:0000007	85.74	gold quality
testis	UBERON:0000473	85.67	gold quality
minor salivary gland	UBERON:0001830	85.45	gold quality
hypothalamus	UBERON:0001898	85.13	gold quality
neocortex	UBERON:0001950	84.99	gold quality
right lobe of liver	UBERON:0001114	84.64	gold quality
Brodmann (1909) area 10	UBERON:0013541	84.37	gold quality
frontal cortex	UBERON:0001870	84.25	gold quality
lower esophagus mucosa	UBERON:0035834	83.51	gold quality
embryo	UBERON:0000922	83.06	gold quality
cerebral cortex	UBERON:0000956	82.24	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	82.10	gold quality

Single-cell (SCXA)

Detected in 4 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-MTAB-6701	yes	75.21
E-CURD-112	yes	8.84
E-MTAB-6524	no	317.60
E-ANND-3	no	0.93

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

21 targeting RAC3, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-4510	100.00	66.60	2050
HSA-MIR-6127	100.00	66.76	2188
HSA-MIR-6129	100.00	66.46	2080
HSA-MIR-6130	100.00	66.69	2012
HSA-MIR-6133	100.00	66.48	2064
HSA-MIR-3662	99.99	73.82	5684
HSA-MIR-568	99.98	69.86	2084
HSA-MIR-33A-3P	99.70	70.27	3362
HSA-MIR-6852-5P	99.17	66.69	2073
HSA-MIR-12114	98.70	63.45	730
HSA-MIR-210-5P	98.57	64.37	832
HSA-MIR-1301-5P	98.09	66.62	495
HSA-MIR-6502-5P	98.09	66.73	495
HSA-MIR-6880-5P	98.08	65.59	1282
HSA-MIR-7113-5P	97.88	67.33	1735
HSA-MIR-517-5P	97.13	68.43	781
HSA-MIR-6729-3P	96.91	66.79	703
HSA-MIR-6822-3P	96.60	66.06	680
HSA-MIR-6820-5P	94.04	61.13	161
HSA-MIR-4707-5P	90.95	65.69	110

Literature-anchored findings (GeneRIF, showing 26)

• Our data is the first report of the frequency of Rac3 overexpression and mutation in human brain tumors. Overexpression may be associated with aggressive tumor behavior (PMID:15993075)
• functional analysis of Rac1 and Rac3 using RNA interference reveals a critical role for these GTPases in the invasive behavior of glioma and breast carcinoma cells (PMID:16027728)
• results suggest a role for both the Rac1 and Rac3 GTPases in human breast cancer progression (PMID:16280046)
• RAC1 and RAC3 have opposing functions in cell adhesion and differentiation in neuronal cells. (PMID:17244648)
• Data demonstrate that Rac3 shares with Rac1 the ability to interfere with cadherin-mediated adhesion. (PMID:18319303)
• Rac3 inhibits adhesion and differentiation of neuronal cells by modifying GIT1 downstream signaling. (PMID:19494130)
• RAC3 is a novel ERalpha co-activator that promotes cell migration and has prognostic value for ERalpha-positive breast cancer metastasis. (PMID:21217774)
• Rac3 GTPase has a role in the regulation of autophagy (PMID:21852230)
• Activation of epithelial-mesenchymal transition by MMP-induced expression of Rac1b gave rise to lung adenocarcinoma. (PMID:22786680)
• Rac1b forms a complex with NADPH oxidase and promotes the production of reactive oxygen species, expression of Snail, and activation of the epithelial-mesenchymal transition program. (PMID:22918955)
• Report role of Rac3 in breast cancer aggressiveness and show the potential usefulness of Rac3 depletion in breast cancer therapy. (PMID:23388133)
• Collectively these data unveil that FBXL19 functions as an antagonist of Rac3 by regulating its stability and regulates the TGFbeta1-induced E-cadherin down-regulation. (PMID:24684802)
• Efficient silencing of Rac3 strongly inhibited A549 cell proliferation. (PMID:25854406)
• Rac3 regulates the biological behaviors of lung adenocarcinoma through a mechanism of downregulating CCND1, MYC, and TFDP1 of cell cycle pathway. (PMID:27402308)
• Rac3 regulates breast cancer invasion and metastasis by controlling adhesion and matrix degradation. (PMID:29061650)
• Missense variants in RAC3 cause a novel brain disorder, likely through a mechanism of constitutive protein activation (PMID:30293988)
• Our study supports that RAC3 variants cause syndromic neurodevelopmental disorders and brain structural abnormality, and expands the phenotypic spectrum of RAC3-related disorders. (PMID:31420595)
• Rac Family Small GTPase 3 Correlates with Progression and Poor Prognosis in Bladder Cancer. (PMID:33600260)
• Rac3 Expression and its Clinicopathological Significance in Patients With Bladder Cancer. (PMID:34257551)
• Pathophysiological Mechanisms in Neurodevelopmental Disorders Caused by Rac GTPases Dysregulation: What’s behind Neuro-RACopathies. (PMID:34943902)
• Gain-of-function p.F28S variant in RAC3 disrupts neuronal differentiation, migration and axonogenesis during cortical development, leading to neurodevelopmental disorder. (PMID:35595279)
• Variant-specific changes in RAC3 function disrupt corticogenesis in neurodevelopmental phenotypes. (PMID:35851598)
• Hypomethylated gene RAC3 induces cell proliferation and invasion by increasing FASN expression in endometrial cancer. (PMID:35917927)
• Establishment of a prognostic model to predict chemotherapy response and identification of RAC3 as a chemotherapeutic target in bladder cancer. (PMID:37310098)
• Unveiling the role of RAC3 in the growth and invasion of cisplatin-resistant bladder cancer cells. (PMID:38847477)
• KLF1 Activates RAC3 to Mediate Fatty Acid Synthesis and Enhance Cisplatin Resistance in Bladder Cancer Cells. (PMID:39376007)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	rac3b	ENSDARG00000020795
danio_rerio	rac3a	ENSDARG00000090062
mus_musculus	Rac3	ENSMUSG00000018012
rattus_norvegicus	Rac3	ENSRNOG00000069600
caenorhabditis_elegans		WBGENE00004287

Paralogs (22): RHOBTB2 (ENSG00000008853), RHOA (ENSG00000067560), CDC42 (ENSG00000070831), RHOBTB1 (ENSG00000072422), RHOV (ENSG00000104140), RND2 (ENSG00000108830), RND3 (ENSG00000115963), RHOU (ENSG00000116574), RHOQ (ENSG00000119729), RHOJ (ENSG00000126785), RHOT1 (ENSG00000126858), RAC2 (ENSG00000128340), RAC1 (ENSG00000136238), RHOF (ENSG00000139725), RHOT2 (ENSG00000140983), RHOB (ENSG00000143878), RHOC (ENSG00000155366), RHOBTB3 (ENSG00000164292), RHOH (ENSG00000168421), RND1 (ENSG00000172602), RHOD (ENSG00000173156), RHOG (ENSG00000177105)

Protein

Protein identifiers

Ras-related C3 botulinum toxin substrate 3 — P60763 (reviewed: P60763)

Alternative names: p21-Rac3

All UniProt accessions (3): P60763, J3KSC4, J3QLK0

UniProt curated annotations — full annotation on UniProt →

Function. Plasma membrane-associated small GTPase which cycles between an active GTP-bound and inactive GDP-bound state. In active state binds to a variety of effector proteins to regulate cellular responses, such as cell spreading and the formation of actin-based protusions including lamellipodia and membrane ruffles. Promotes cell adhesion and spreading on fibrinogen in a CIB1 and alpha-IIb/beta3 integrin-mediated manner.

Subunit / interactions. Interacts with the GEF protein DOCK7, which promotes the exchange between GDP and GTP, and therefore activates it. Interacts with C1D. Interacts (via C-terminal region) with CIB1; the interaction induces their association with the cytoskeleton upon alpha-IIb/beta3 integrin-mediated adhesion. Interacts with NRBP. Interacts (when activated) with ARHGEF40.

Subcellular location. Cytoplasm. Endomembrane system. Cell projection. Lamellipodium. Perinuclear region. Cell membrane. Cytoskeleton.

Tissue specificity. Highest levels in brain, also detected in heart, placenta and pancreas.

Post-translational modifications. (Microbial infection) Glycosylated at Tyr-32 by Photorhabdus asymbiotica toxin PAU_02230. Mono-O-GlcNAcylation by PAU_02230 inhibits downstream signaling by an impaired interaction with diverse regulator and effector proteins of Rac and leads to actin disassembly. Ubiquitinated at Lys-166 in a FBXL19-mediated manner; leading to proteasomal degradation.

Disease relevance. Neurodevelopmental disorder with structural brain anomalies and dysmorphic facies (NEDBAF) [MIM:618577] An autosomal dominant neurodevelopmental disorder characterized by global developmental delay, severe intellectual disability, poor language, seizures, dysmorphic features, and thin corpus callosum. The disease is caused by variants affecting the gene represented in this entry.

Activity regulation. Regulated by guanine nucleotide exchange factors (GEFs) which promote the exchange of bound GDP for free GTP, GTPase activating proteins (GAPs) which increase the GTP hydrolysis activity, and GDP dissociation inhibitors which inhibit the dissociation of the nucleotide from the GTPase. Regulated by the GEF protein DOCK7.

Induction. Expression down-regulated in quiescent fibroblasts and clearly induced by serum stimulation.

Similarity. Belongs to the small GTPase superfamily. Rho family.

RefSeq proteins (2): NP_001303236, NP_005043* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001806	Small_GTPase	Family
IPR003578	Small_GTPase_Rho	Family
IPR005225	Small_GTP-bd	Domain
IPR027417	P-loop_NTPase	Homologous_superfamily

Pfam: PF00071

Enzyme classification (BRENDA):

• EC 3.6.5.2 — small monomeric GTPase (BRENDA: 49 organisms, 138 substrates, 55 inhibitors, 5 Km, 1 kcat entries)

Substrate kinetics (BRENDA)

1 substrates with measured Km, best-characterized 1. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
GTP	—	0

Catalyzed reactions (Rhea), 1 shown:

• GTP + H2O = GDP + phosphate + H(+) (RHEA:19669)

UniProt features (34 total): helix 9, strand 7, sequence variant 4, turn 3, binding site 3, chain 1, propeptide 1, mutagenesis site 1, short sequence motif 1, modified residue 1, lipid moiety-binding region 1, glycosylation site 1, cross-link 1

Structure

Experimental structures (PDB)

6 structures.

PDB	Method	Resolution (Å)
2QME	X-RAY DIFFRACTION	1.75
2C2H	X-RAY DIFFRACTION	1.85
2G0N	X-RAY DIFFRACTION	1.9
2IC5	X-RAY DIFFRACTION	1.9
2OV2	X-RAY DIFFRACTION	2.1
6TM1	X-RAY DIFFRACTION	3.71

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P60763-F1	93.92	0.87

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (3): 10–17; 57–61; 115–118

Post-translational modifications (3): 189, 189, 166

Glycosylation sites (1): 32

Mutagenesis-validated functional residues (1):

Position	Phenotype
166	reduced fbxl19-mediated ubiquitination and subsequent degradation.

Function

Pathways and Gene Ontology

Reactome pathways

2 pathways

ID	Pathway
R-HSA-4086400	PCP/CE pathway
R-HSA-9013423	RAC3 GTPase cycle

MSigDB gene sets: 335 (showing top): GSE45365_NK_CELL_VS_CD8A_DC_UP, GOBP_FOREBRAIN_NEURON_DEVELOPMENT, MODULE_52, GOBP_REGULATION_OF_CELL_MATURATION, GOBP_REGULATION_OF_CELL_MORPHOGENESIS, GOBP_ESTABLISHMENT_OR_MAINTENANCE_OF_CELL_POLARITY, GOBP_MYELOID_LEUKOCYTE_MIGRATION, GOBP_CELL_CHEMOTAXIS, GOBP_SYNAPSE_ASSEMBLY, KEGG_MAPK_SIGNALING_PATHWAY, GOBP_NEURON_MATURATION, MODULE_45, GOBP_NEUROGENESIS, GOBP_REGULATION_OF_CELL_JUNCTION_ASSEMBLY, MODULE_16

GO Biological Process (28): actin filament organization (GO:0007015), establishment or maintenance of cell polarity (GO:0007163), motor neuron axon guidance (GO:0008045), regulation of cell shape (GO:0008360), regulation of neuron maturation (GO:0014041), Wnt signaling pathway (GO:0016055), Rac protein signal transduction (GO:0016601), cerebral cortex GABAergic interneuron development (GO:0021894), cell projection assembly (GO:0030031), actin cytoskeleton organization (GO:0030036), cortical cytoskeleton organization (GO:0030865), regulation of actin cytoskeleton organization (GO:0032956), positive regulation of cell adhesion mediated by integrin (GO:0033630), intracellular signal transduction (GO:0035556), respiratory burst (GO:0045730), homeostasis of number of cells within a tissue (GO:0048873), neuromuscular process controlling balance (GO:0050885), synaptic transmission, GABAergic (GO:0051932), cell chemotaxis (GO:0060326), postsynaptic actin cytoskeleton organization (GO:0098974), regulation of postsynapse assembly (GO:0150052), positive regulation of substrate adhesion-dependent cell spreading (GO:1900026), regulation of neutrophil migration (GO:1902622), small GTPase-mediated signal transduction (GO:0007264), regulation of cell-substrate adhesion (GO:0010810), regulation of cell morphogenesis (GO:0022604), neuron projection development (GO:0031175), neuromuscular process (GO:0050905)

GO Molecular Function (8): GTPase activity (GO:0003924), G protein activity (GO:0003925), GTP binding (GO:0005525), protein kinase binding (GO:0019901), calcium-dependent protein binding (GO:0048306), nucleotide binding (GO:0000166), protein binding (GO:0005515), hydrolase activity (GO:0016787)

GO Cellular Component (20): endoplasmic reticulum membrane (GO:0005789), cytosol (GO:0005829), cytoskeleton (GO:0005856), plasma membrane (GO:0005886), endomembrane system (GO:0012505), lamellipodium (GO:0030027), growth cone (GO:0030426), cytoplasmic vesicle (GO:0031410), filamentous actin (GO:0031941), neuron projection (GO:0043005), NADPH oxidase complex (GO:0043020), neuronal cell body (GO:0043025), perinuclear region of cytoplasm (GO:0048471), extracellular exosome (GO:0070062), cell periphery (GO:0071944), postsynapse (GO:0098794), glutamatergic synapse (GO:0098978), cytoplasm (GO:0005737), membrane (GO:0016020), cell projection (GO:0042995)

Reactome top-level categories

Rollup of top-2 pathways:

Category	Pathways
Beta-catenin independent WNT signaling	1
RHO GTPase cycle	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	8
actin cytoskeleton organization	3
cytoplasm	3
cytoskeleton organization	2
intracellular anatomical structure	2
plasma membrane bounded cell projection	2
synapse	2
supramolecular fiber organization	1
cellular process	1
axon guidance	1
regulation of cell morphogenesis	1
regulation of biological quality	1
neuron maturation	1
regulation of neuron differentiation	1
regulation of cell maturation	1
cell surface receptor signaling pathway	1
small GTPase-mediated signal transduction	1
forebrain neuron development	1
cerebral cortex GABAergic interneuron differentiation	1
cellular component assembly	1
cell projection organization	1
actin filament-based process	1
regulation of actin filament-based process	1
regulation of cytoskeleton organization	1
cell adhesion mediated by integrin	1
regulation of cell adhesion mediated by integrin	1
positive regulation of cell adhesion	1
signal transduction	1
metabolic process	1
tissue homeostasis	1
homeostasis of number of cells	1
musculoskeletal movement	1
neuromuscular process	1
chemical synaptic transmission	1
chemotaxis	1
cell migration	1
cellular response to chemical stimulus	1
postsynaptic cytoskeleton organization	1
ribonucleoside triphosphate phosphatase activity	1
GTPase activity	1

Protein interactions and networks

STRING

3696 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
RAC3	ILF2	Q12905	398
RAC3	GABARAP	O95166	372
RAC3	GABARAPL2	P60520	364
RAC3	ARHGDIG	Q99819	324
RAC3	MLF1	P58340	321
RAC3	SCRN3	Q0VDG4	308
RAC3	ZNF142	P52746	305
RAC3	HOMER3	Q9NSC5	304
RAC3	HBM	Q6B0K9	301
RAC3	KAT2B	Q92831	285
RAC3	TPD52L1	Q16890	282
RAC3	PAK1	Q13153	279
RAC3	PPP1R1A	Q13522	276
RAC3	FADD	Q13158	276
RAC3	HPCA	P32076	276

IntAct

76 interactions, top by confidence:

A	B	Type	Score
RAC1	RAP1GDS1	psi-mi:“MI:0914”(association)	0.800
CFTR	ESYT2	psi-mi:“MI:2364”(proximity)	0.710
RAP1GDS1	DIRAS1	psi-mi:“MI:0914”(association)	0.640
RAC3	ESR1	psi-mi:“MI:0407”(direct interaction)	0.640
ESR1	RAC3	psi-mi:“MI:0915”(physical association)	0.640
RAC3	ESR1	psi-mi:“MI:0915”(physical association)	0.640
PARD6B	RAC3	psi-mi:“MI:0915”(physical association)	0.560
RAC3	PARD6B	psi-mi:“MI:0915”(physical association)	0.560
ARFIP2	RAC3	psi-mi:“MI:0915”(physical association)	0.560
RAC3	HDAC7	psi-mi:“MI:0915”(physical association)	0.560
NRBP1	RAC3	psi-mi:“MI:0915”(physical association)	0.560
RAC3	NRBP1	psi-mi:“MI:0915”(physical association)	0.560
ARHGDIA	RAC3	psi-mi:“MI:0915”(physical association)	0.550
SLC7A1	TMEM223	psi-mi:“MI:0914”(association)	0.530
SLC9A6	MAP1LC3B2	psi-mi:“MI:0914”(association)	0.530
RAC2	RAP1GDS1	psi-mi:“MI:0914”(association)	0.530
IQGAP3	PEX19	psi-mi:“MI:0914”(association)	0.530
RAC2	RAC3	psi-mi:“MI:0914”(association)	0.530
SLC9A6	IFNGR1	psi-mi:“MI:0914”(association)	0.530
XIAP	RAC3	psi-mi:“MI:0407”(direct interaction)	0.440
RXRA	RAC3	psi-mi:“MI:0407”(direct interaction)	0.410
WAS	RAC3	psi-mi:“MI:0915”(physical association)	0.400

BioGRID (646): RAC3 (Co-fractionation), RAC3 (Affinity Capture-MS), RAC3 (Affinity Capture-MS), RAC3 (Affinity Capture-MS), RAC3 (Affinity Capture-MS), RAC3 (Affinity Capture-MS), RAC3 (Affinity Capture-MS), RAC3 (Affinity Capture-Western), HSPA5 (Affinity Capture-Western), RAC3 (Two-hybrid), RAC3 (Two-hybrid), RAC3 (Affinity Capture-MS), CIB1 (Two-hybrid), RAC3 (Affinity Capture-Western), CIB1 (Affinity Capture-Western)

ESM2 similar proteins: A0A286QZ36, C4YDI6, O88931, P08134, P0CY33, P15153, P19073, P24406, P34144, P34145, P34146, P40792, P40793, P48148, P48554, P60763, P60764, P60766, P60952, P60953, P61585, P61586, P61589, P62998, P62999, P63000, P63001, Q007T2, Q03206, Q05062, Q05144, Q16YG0, Q17031, Q1RMJ6, Q22038, Q29HY3, Q2KJ93, Q4R4R6, Q5RCK9, Q5REY6

Diamond homologs: A0A286QZ36, A5D7J5, C4YDI6, O04369, O76321, O82480, O82481, O88931, O94103, O96390, P01122, P08134, P0CY33, P15153, P17081, P19073, P24406, P34144, P34145, P34146, P34147, P34148, P34149, P34150, P40792, P40793, P48148, P48554, P60763, P60764, P60766, P60952, P60953, P61585, P61586, P61589, P62998, P62999, P63000, P63001

SIGNOR signaling

3 interactions.

A	Effect	B	Mechanism
DEAF1	“up-regulates quantity by expression”	RAC3	“transcriptional regulation”
SRGAP3	down-regulates	RAC3
RAC3	“up-regulates activity”	CIB1	binding

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 72 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
CDC42 GTPase cycle	6	9.4×	7e-03
RAC1 GTPase cycle	7	9.3×	3e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

65 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	2
Likely pathogenic	6
Uncertain significance	33
Likely benign	14
Benign	1

Top pathogenic / likely-pathogenic (8)

Variant ID	HGVS	Classification
1723153	NM_005052.3(RAC3):c.183GGA[1] (p.Glu62del)	Pathogenic
425149	NM_005052.3(RAC3):c.184G>A (p.Glu62Lys)	Pathogenic
2583144	NM_005052.3(RAC3):c.86C>G (p.Pro29Arg)	Likely pathogenic
2663816	NM_005052.3(RAC3):c.276T>A (p.Asn92Lys)	Likely pathogenic
3347558	NM_005052.3(RAC3):c.193G>A (p.Asp65Asn)	Likely pathogenic
871529	NM_005052.3(RAC3):c.187G>A (p.Asp63Asn)	Likely pathogenic
977758	NM_005052.3(RAC3):c.34G>C (p.Gly12Arg)	Likely pathogenic
982386	NM_005052.3(RAC3):c.191A>G (p.Tyr64Cys)	Likely pathogenic

SpliceAI

0 predictions. Top by Δscore:

AlphaMissense

1234 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
17:82031789:G:C	G10R	1.000
17:82031789:G:T	G10C	1.000
17:82031790:G:T	G10V	1.000
17:82032394:G:A	G15R	1.000
17:82032394:G:C	G15R	1.000
17:82032394:G:T	G15W	1.000
17:82032395:G:A	G15E	1.000
17:82032397:A:C	K16Q	1.000
17:82032398:A:T	K16M	1.000
17:82032401:C:T	T17I	1.000
17:82032433:T:C	F28L	1.000
17:82032435:C:A	F28L	1.000
17:82032435:C:G	F28L	1.000
17:82032712:T:C	F37L	1.000
17:82032714:T:A	F37L	1.000
17:82032714:T:G	F37L	1.000
17:82032716:A:T	D38V	1.000
17:82032769:T:A	W56R	1.000
17:82032769:T:C	W56R	1.000
17:82032772:G:C	D57H	1.000
17:82032772:G:T	D57Y	1.000
17:82032773:A:C	D57A	1.000
17:82032773:A:G	D57G	1.000
17:82032773:A:T	D57V	1.000
17:82032774:C:A	D57E	1.000
17:82032774:C:G	D57E	1.000
17:82032781:G:C	G60R	1.000
17:82032781:G:T	G60C	1.000
17:82032782:G:A	G60D	1.000
17:82032803:T:A	L67Q	1.000

dbSNP variants (sampled 300 via entrez): RS1001060305 (17:82031245 C>G,T), RS1001188123 (17:82032059 G>A,C,T), RS1001387664 (17:82031886 C>T), RS1001611613 (17:82031546 GCCCCGCCAGCCGCGCGGCCGGGCGCC>G), RS1002189287 (17:82032166 G>A,C,T), RS1002197189 (17:82033060 G>A,T), RS1002865320 (17:82034039 G>A), RS1003193711 (17:82033239 C>G,T), RS1004242876 (17:82032641 C>A,G,T), RS1004679834 (17:82032402 A>G), RS1004756594 (17:82031909 C>T), RS1004821935 (17:82032287 C>G,T), RS1005091379 (17:82032074 G>A), RS1005280185 (17:82033466 C>T), RS1005527303 (17:82034089 G>A)

Disease associations

OMIM: gene MIM:602050 | disease phenotypes: MIM:618577

GenCC curated gene-disease

Disease	Classification	Inheritance
neurodevelopmental disorder with structural brain anomalies and dysmorphic facies	Strong	Autosomal dominant

Mondo (2): neurodevelopmental disorder with structural brain anomalies and dysmorphic facies (MONDO:0032820), intellectual disability (MONDO:0001071)

Orphanet (2): Facial dysmorphism-global developmental delay-hypotonia-polymicrogyria syndrome (Orphanet:659609), NON RARE IN EUROPE: Unexplained intellectual disability (Orphanet:319658)

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D008607	Intellectual Disability	C10.597.606.360; C23.888.592.604.646; F01.700.687; F03.625.539

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (2): CHEMBL5482993 (PROTEIN FAMILY), CHEMBL6087 (SINGLE PROTEIN)

Molecules with ChEMBL bioactivity

1 molecules (phase ≥1), by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 68 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

Molecule	Name	Phase	Patents
CHEMBL5290216	MBQ-167	1	68

PharmGKB: 1 entry (VIP=true, CPIC=false)

ChEMBL bioactivities

2 potent at pChembl≥5 of 2 total, top 2 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
6.99	IC50	103	nM	MBQ-167
6.64	Kd	230	nM	CHEMBL1186585

PubChem BioAssay actives

2 with measured affinity, of 3 total; 2 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
9-ethyl-3-(5-phenyltriazol-1-yl)carbazole	1974815: Inhibition of Rac1/Rac2/Rac3 P21-binding domain in human MDA-MB-231 cells incubated for 24 hrs by pulldown assay	ic50	0.1030	uM
2-(morpholin-4-ylmethyl)-5-[5-[7-(trifluoromethyl)quinolin-4-yl]sulfanylpentoxy]pyran-4-one	1974805: Binding affinity to Rac3 (unknown origin) assessed as dissociation constant	kd	0.2300	uM

CTD chemical–gene interactions

47 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	decreases expression, affects cotreatment, increases abundance, increases expression	2
Parathion	decreases reaction, increases expression, affects cotreatment	2
Valproic Acid	affects expression, increases methylation	2
Particulate Matter	increases abundance, decreases expression	2
aristolochic acid I	decreases expression	1
beauvericin	affects cotreatment, increases expression	1
propionaldehyde	increases expression	1
bisphenol A	increases expression	1
quercitrin	affects expression	1
11-nor-delta(9)-tetrahydrocannabinol-9-carboxylic acid	affects methylation, increases abundance	1
cobaltous chloride	decreases expression	1
butyraldehyde	increases expression	1
manganese chloride	affects cotreatment, increases abundance, increases expression	1
pentanal	increases expression	1
enniatins	increases expression, affects cotreatment	1
2-palmitoylglycerol	increases expression	1
jinfukang	affects cotreatment, increases expression	1
(+)-JQ1 compound	decreases expression	1
4-(4-((5-(4,5-dimethyl-2-nitrophenyl)-2-furanyl)methylene)-4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)benzoic acid	decreases expression	1
Irinotecan	increases expression	1
Resveratrol	decreases expression	1
Temozolomide	increases expression	1
Vorinostat	increases expression	1
Air Pollutants	decreases expression, increases abundance	1
Aldehydes	increases expression	1
Amiodarone	increases expression	1
Arsenic	affects cotreatment, increases abundance, increases expression	1
Atropine	decreases reaction, increases expression	1
Benzo(a)pyrene	increases methylation	1
Cannabinoids	affects methylation, increases abundance	1

ChEMBL screening assays

4 unique, capped per target: 4 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL5327317	Binding	Inhibition of Rac1/Rac2/Rac3 P21-binding domain in human MDA-MB-231 cells incubated for 24 hrs by pulldown assay	Advances in the development of Rho GTPase inhibitors. — Bioorg Med Chem

Clinical trials (associated diseases)

197 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT05657860	PHASE4	COMPLETED	Guanfacine Extended Release for the Reduction of Aggression and Self-injurious Behavior Associated With Prader-Willi Syndrome
NCT05744479	PHASE4	RECRUITING	Metformin for Antipsychotic-induced Weight Gain in Adults With Intellectual Disability
NCT06107829	PHASE4	WITHDRAWN	Valbenazine Treatment of Tardive Dyskinesia in Adults With Intellectual/Developmental Disabilities
NCT06997198	PHASE4	NOT_YET_RECRUITING	Deutetrabenazine Treatment for Tardive Dyskinesia in Intellectual/Developmental Disabilities
NCT02270736	PHASE3	COMPLETED	Clinical Study to Investigate the Efficacy and Safety of NT 201 Compared to Placebo in the Treatment of Chronic Troublesome Drooling Associated With Neurological Disorders and/or Intellectual Disability
NCT02304302	PHASE2	COMPLETED	Down Syndrome Memantine Follow-up Study
NCT03862950	PHASE2	COMPLETED	A Trial of Metformin in Individuals With Fragile X Syndrome (Met)
NCT04529226	PHASE2	UNKNOWN	Study to Compare Clozapine vs Treatment as Usual in People With Intellectual Disability & Treatment-resistant Psychosis
NCT04821856	PHASE2	COMPLETED	Evaluation of the Effectiveness of Cannabidiol in Treating Severe Behavioural Problems in Children and Adolescents With Intellectual Disability
NCT05273320	PHASE1	COMPLETED	Clinical Trial of Nabilone for Aggression in Adults With Intellectual and Developmental Disabilities
NCT05301361	PHASE1	ENROLLING_BY_INVITATION	Sensitivity of the NIH Toolbox to Stimulant Treatment in Intellectual Disabilities
NCT06016764	PHASE1	COMPLETED	Use of MRI and cTBS for Catatonia in Autism
NCT06586827	PHASE1	COMPLETED	Impact of Competency-Based Training and Technical Assistance Employment Outcomes of Individuals With ID/DD
NCT07531940	PHASE1	NOT_YET_RECRUITING	Escalating Doses of Memantine in Down Syndrome (MEDS-123)
NCT03479476	PHASE2/PHASE3	COMPLETED	A Trial of Metformin in Individuals With Fragile X Syndrome
NCT02616796	PHASE1/PHASE2	COMPLETED	Effects of Social Gaze Training on Brain and Behavior in Fragile X Syndrome
NCT06860672	EARLY_PHASE1	RECRUITING	Clinical Trial of the Dual Vector Base Editor for the Treatment of the CHD3-R1025W Mutation
NCT00597948	Not specified	COMPLETED	Healthy Lifestyles for People With Intellectual Disabilities
NCT01087320	Not specified	RECRUITING	Genome Medical Sequencing for Gene Discovery
NCT01652963	Not specified	UNKNOWN	Picture-based Computerised Assessment and Training of Cognitive Behaviour Therapy Skills
NCT01695395	Not specified	COMPLETED	Mental Health Care Provision for Adults With Intellectual Disability and a Mental Disorder
NCT01867554	Not specified	COMPLETED	Research and Characterization of New Genes Involved in Intellectual Disability
NCT01915381	Not specified	COMPLETED	Improving Adherence Healthy Lifestyle With a Smartphone Application Based on Adults With Intellectual Disabilities
NCT01988623	Not specified	COMPLETED	Pivotal Response Treatment for Individuals With Intellectual Disabilities
NCT02099773	Not specified	COMPLETED	Support Staff-client Interactions With Augmentative and Alternative Communication
NCT02136849	Not specified	COMPLETED	Inter-regional Project of the Great Western Exploration Approach for Exome Molecular Causes Severe Intellectual Disability Isolated or Syndromic
NCT02225041	Not specified	COMPLETED	Sedation Strategy and Cognitive Outcome After Critical Illness in Early Childhood
NCT02414438	Not specified	COMPLETED	Establishing the Clinical Utility of First StepDx PLUS and NextStepDx PLUS Study
NCT02451761	Not specified	COMPLETED	Apparently Balanced Chromosomal Translocation/ Next-generation Sequencing/ Intellectual Disability
NCT02461420	Not specified	ACTIVE_NOT_RECRUITING	Mapping the Genotype, Phenotype, and Natural History of Phelan-McDermid Syndrome
NCT02461459	Not specified	ACTIVE_NOT_RECRUITING	Autism Spectrum Disorder (ASD) and Intellectual Disability (ID) Determinants in Tuberous Sclerosis Complex (TSC)
NCT02486081	Not specified	COMPLETED	Development and Application-Smart Football for Movement Evaluation and Training in the Special Education Population
NCT02504502	Not specified	COMPLETED	Enhancing Genomic Laboratory Reports to Enhance Communication and Empower Patients
NCT02513277	Not specified	COMPLETED	Diabetes Screening & Prevention for People With Learning (Intellectual) Disabilities:STOP Diabetes Study
NCT02561754	Not specified	COMPLETED	Weight Management for Adolescents With IDD
NCT02591446	Not specified	COMPLETED	Transcranial Magnetic Stimulation Studies in Autism Spectrum Disorders
NCT02714868	Not specified	COMPLETED	Evaluation of Project TEAM (Teens Making Environmental and Activity Modifications)
NCT02721394	Not specified	UNKNOWN	FCT With Young Children With ID in the UK: A Feasibility Project V.1
NCT02746614	Not specified	COMPLETED	Psychomotor Therapy Effects in Adaptive Behavior and Motor Proficiency in Intellectual Disability
NCT02836405	Not specified	COMPLETED	TMS for the Investigation of Brain Plasticity in Autism Spectrum Disorders