RAD21

Summary

RAD21 (RAD21 cohesin complex component, HGNC:9811) is a protein-coding gene on chromosome 8q24.11, encoding Double-strand-break repair protein rad21 homolog (O60216). As a member of the cohesin complex, involved in sister chromatid cohesion from the time of DNA replication in S phase to their segregation in mitosis, a function that is essential for proper chromosome segregation, post-replicative DNA repair, and the prevention of inappropriate…. It is a common-essential gene (DepMap: required in 99.5% of cancer cell lines) and haploinsufficient (ClinGen: sufficient evidence).

The protein encoded by this gene is highly similar to the gene product of Schizosaccharomyces pombe rad21, a gene involved in the repair of DNA double-strand breaks, as well as in chromatid cohesion during mitosis. This protein is a nuclear phospho-protein, which becomes hyperphosphorylated in cell cycle M phase. The highly regulated association of this protein with mitotic chromatin specifically at the centromere region suggests its role in sister chromatid cohesion in mitotic cells.

Source: NCBI Gene 5885 — RefSeq curated summary.

At a glance

• Gene–disease (curated): Cornelia de Lange syndrome (Definitive, ClinGen) — +2 more curated relationships
• GWAS associations: 2
• Clinical variants (ClinVar): 536 total — 39 pathogenic, 17 likely-pathogenic
• Phenotypes (HPO): 160
• Cancer driver (intOGen): loss-of-function (tumor-suppressor-like) across 2 cancer types
• Cancer dependency (DepMap): dependent in 99.5% of screened cell lines (common-essential)
• Dosage sensitivity (ClinGen): haploinsufficiency sufficient evidence, triplosensitivity no evidence
• MANE Select transcript: NM_006265

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:9811
Approved symbol	RAD21
Name	RAD21 cohesin complex component
Location	8q24.11
Locus type	gene with protein product
Status	Approved
Aliases	KIAA0078, hHR21, SCC1
Ensembl gene	ENSG00000164754
Ensembl biotype	protein_coding
OMIM	606462
Entrez	5885

Gene structure

Transcript identifiers

Ensembl transcripts: 34 — 20 protein_coding, 12 retained_intron, 1 protein_coding_CDS_not_defined, 1 nonsense_mediated_decay

ENST00000297338, ENST00000517485, ENST00000517749, ENST00000518055, ENST00000519469, ENST00000519837, ENST00000520992, ENST00000522699, ENST00000523547, ENST00000523986, ENST00000685972, ENST00000686622, ENST00000687122, ENST00000687358, ENST00000687902, ENST00000688033, ENST00000689124, ENST00000689154, ENST00000689504, ENST00000690166, ENST00000690189, ENST00000900008, ENST00000900009, ENST00000900010, ENST00000900011, ENST00000927337, ENST00000927338, ENST00000927339, ENST00000927340, ENST00000927341, ENST00000958516, ENST00000958517, ENST00000958518, ENST00000958519

RefSeq mRNA: 1 — MANE Select: NM_006265 NM_006265

CCDS: CCDS6321

Canonical transcript exons

ENST00000297338 — 14 exons

Exon	Start	End
ENSE00001087180	116848946	116849029
ENSE00001087181	116857267	116857473
ENSE00001087182	116856646	116856771
ENSE00001087184	116851948	116852096
ENSE00001087186	116856166	116856288
ENSE00001087189	116850618	116850767
ENSE00001087190	116854245	116854468
ENSE00001087191	116852549	116852708
ENSE00001276365	116845934	116847691
ENSE00001356828	116874611	116874776
ENSE00003464321	116861841	116861940
ENSE00003464650	116866586	116866761
ENSE00003525419	116863130	116863259
ENSE00003579379	116858352	116858458

Expression profiles

Bgee: expression breadth ubiquitous, 301 present calls, max score 99.47.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 84.2621 / max 1535.8367, expressed in 1822 samples.

FANTOM5 promoters (14 alternative TSS)

Promoter ID	TPM avg	Samples expressed
94550	84.2621	1822
94543	5.2653	1378
94549	3.1339	1109
94542	0.7315	177
94547	0.2810	112
94545	0.2576	132
94546	0.1360	41
94544	0.1335	36
94548	0.0770	25
94535	0.0534	2

Top tissues by expression

301 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
ventricular zone	UBERON:0003053	99.47	gold quality
ganglionic eminence	UBERON:0004023	99.04	gold quality
superficial temporal artery	UBERON:0001614	98.85	gold quality
endometrium epithelium	UBERON:0004811	98.81	gold quality
epithelium of nasopharynx	UBERON:0001951	98.79	gold quality
germinal epithelium of ovary	UBERON:0001304	98.76	gold quality
cerebellar vermis	UBERON:0004720	98.76	gold quality
substantia nigra pars reticulata	UBERON:0001966	98.69	gold quality
subthalamic nucleus	UBERON:0001906	98.66	gold quality
substantia nigra pars compacta	UBERON:0001965	98.66	gold quality
embryo	UBERON:0000922	98.63	gold quality
trabecular bone tissue	UBERON:0002483	98.53	gold quality
inferior vagus X ganglion	UBERON:0005363	98.53	gold quality
seminal vesicle	UBERON:0000998	98.51	gold quality
superior vestibular nucleus	UBERON:0007227	98.47	gold quality
corpus callosum	UBERON:0002336	98.44	gold quality
adult organism	UBERON:0007023	98.44	gold quality
lower lobe of lung	UBERON:0008949	98.38	gold quality
pigmented layer of retina	UBERON:0001782	98.34	gold quality
retina	UBERON:0000966	98.31	gold quality
colonic epithelium	UBERON:0000397	98.29	gold quality
middle frontal gyrus	UBERON:0002702	98.20	gold quality
lateral globus pallidus	UBERON:0002476	98.19	gold quality
medulla oblongata	UBERON:0001896	98.16	gold quality
thymus	UBERON:0002370	98.15	gold quality
trigeminal ganglion	UBERON:0001675	98.13	gold quality
bone marrow	UBERON:0002371	98.11	gold quality
bone element	UBERON:0001474	98.10	gold quality
mucosa of paranasal sinus	UBERON:0005030	98.10	gold quality
paraflocculus	UBERON:0005351	98.06	gold quality

Single-cell (SCXA)

Detected in 7 experiment(s), a significant marker in 6.

Experiment	Marker?	Max mean expression
E-CURD-112	yes	37.08
E-CURD-122	yes	23.02
E-GEOD-125970	yes	16.52
E-MTAB-6678	yes	8.21
E-MTAB-10553	yes	7.48
E-GEOD-106540	no	818.43
E-ANND-3	no	0.00

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

2 targets.

Target	Regulation
APOB	Repression
RUNX1	Repression

Upstream regulators (CollecTRI, top): CTCF, ESR1, MYC, NR5A1, TFAP2A, TFAP2C

miRNA regulators (miRDB)

153 targeting RAD21, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-LET-7A-3P	100.00	74.03	3932
HSA-LET-7B-3P	100.00	74.08	3913
HSA-LET-7F-1-3P	100.00	74.02	3928
HSA-MIR-98-3P	100.00	74.08	3907
HSA-MIR-4262	100.00	73.26	3931
HSA-MIR-188-3P	100.00	68.76	1240
HSA-MIR-1252-5P	100.00	69.80	2774
HSA-MIR-574-5P	100.00	66.01	989
HSA-MIR-3646	100.00	73.56	5283
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-181A-5P	99.99	72.96	2995
HSA-MIR-181B-5P	99.99	72.97	2996
HSA-MIR-181C-5P	99.99	72.95	2996
HSA-MIR-181D-5P	99.99	73.04	2997
HSA-MIR-511-3P	99.99	68.85	1467
HSA-MIR-3185	99.99	68.12	1959
HSA-MIR-3662	99.99	73.82	5684
HSA-MIR-4775	99.98	75.00	6394
HSA-MIR-12136	99.98	72.81	5713
HSA-MIR-32-5P	99.98	75.21	1964
HSA-MIR-92A-3P	99.98	75.21	1960
HSA-MIR-92B-3P	99.98	75.25	1955
HSA-MIR-4789-5P	99.98	70.76	2721
HSA-MIR-25-3P	99.98	74.60	1817
HSA-MIR-363-3P	99.98	74.72	1821
HSA-MIR-367-3P	99.98	74.83	1819
HSA-MIR-433-3P	99.98	69.37	1203
HSA-LET-7F-2-3P	99.98	70.98	2588
HSA-MIR-1185-1-3P	99.98	71.04	2593
HSA-MIR-1185-2-3P	99.98	71.04	2593

Functional genomics

ClinGen dosage: haploinsufficiency 3 (sufficient evidence), triplosensitivity 0 (no evidence). ClinGen Gene Dosage Map DepMap (CRISPR cell-line fitness): dependent in 99.5% of screened cell lines, common-essential.

Literature-anchored findings (GeneRIF, showing 40)

• Caspase proteolysis of the cohesin component RAD21 promotes apoptosis (PMID:11875078)
• RAD21 subunit of the cohesin complex directly interacts with ATPase subunit SNF2; mapping of RAD21, SNF2 and Mi2 binding sites reveals specific association of these three proteins with DNA elements containing Alu sequences (PMID:12198550)
• Scc1 is essential for the association of kinetochores with microtubules. (PMID:12200439)
• plays a role in apoptosis, and its cleavage during apoptosis may act as a nuclear signal to initiate cytoplasmic events involved in the apoptotic pathway (PMID:12417729)
• RAD21 shows increased expression in clinical prostate carcinomas and is also amplified in 30-40% of xenografts and hormone-refractory tumors. (PMID:14603436)
• Phosphorylation of SA2 is essential for cohesin dissociation during prophase and prometaphase, but is not required for cohesin cleavage by separase. (PMID:15737063)
• RAD21 suppression enhances the antitumor activity of chemotherapeutic agents acting via induction of DNA damage (PMID:15767545)
• The RAD21 gene was closely related to the invasion and metastasis of cancer cells. (PMID:16416296)
• As compared to the telomerase group, the alternative lengthening of telomeres group presents higher expression of hRad21, thinner tumor invasion depth, and higher survival rate. (PMID:18197499)
• These data argue that the regulation of the IL-3 and the GM-CSF promoters depends on the positions of their enhancers relative to the conserved CTCF/cohesin-binding sites. (PMID:19158269)
• The depletion of either CTCF or RAD21 disrupts the chromatin loop structure, together with significant changes in the APO expression. (PMID:19322193)
• Ectopic expression of Rad21 repressed CTCF-regulated transcription of KSHV lytic genes. (PMID:19369356)
• hRAD21 was significantly differently expressed in cells maintaining telomere length through a telomerase-independent mechanism, termed the alternative lengthening of telomeres (ALT). (PMID:20364118)
• Rad21 protein depletion causes centrosome defects in interphase and prophase of mitosis. (PMID:20404533)
• Rad21 protein are cleaved by separase are required for the localization of Rad21 to the centrosome. (PMID:20404544)
• RAD21 expression confers poor prognosis and resistance to chemotherapy in high grade luminal, basal and HER2 breast cancers. (PMID:21255398)
• Rad21 cleavage by calpain-1 promotes separation of chromosome arms, which coincides with a calcium-induced partial loss of cohesin at several chromosomal loci. (PMID:21876002)
• RAD21 expression is associated with a poorer prognosis in BRCA2, but not in BRCA1 breast cancers. (PMID:22537934)
• RAD21 mutations cause a human cohesinopathy (PMID:22633399)
• show that the Smc5/6 subunit Mms21 sumoylates multiple lysines of the cohesin subunit Scc1 (PMID:22751501)
• ASURA specifically binds to chromatin when Scc1 is associated with chromatin. (PMID:23548868)
• Rad21 binds to SA proteins through two SA-binding motifs on Rad21. (PMID:23874961)
• -RAD21 and EIF3H, both on chromosome 8q23, CHRAC1 on chromosome 8q24.3 and TANC2 on chromosome 17q23-were confirmed to be driver genes regulating the proliferation/survival of clonogenic breast cancer cells (PMID:24148822)
• This study reports the first intragenic deletion and frameshift mutations identified in RAD21 in two patients presenting with atypical Cornelia de Lange syndrome. (PMID:24378232)
• CTCF and Rad21 act as host cell restriction factors for Kaposi’s sarcoma-associated herpesvirus (KSHV) lytic replication by modulating viral gene transcription. (PMID:24415941)
• RAD21 expression in CRC is associated with aggressive disease especially in KRAS mutant tumours and resistance to chemoradiotherapy. (PMID:24548858)
• Cross-sectional deep-sequencing analysis for clonal hierarchy demonstrated STAG2, SMC3, and RAD21 mutations to be ancestral in 18%, 18%, and 47% of cases, respectively, and each expanded to clonal dominance concordant with disease transformation (PMID:25006131)
• Studied the role of looping in large-scale (supra Mb) folding of human chromosomes by knocking down the gene that codes for CTCF and the one coding for Rad21, an essential subunit of cohesin. (PMID:25299688)
• cohesin’s proposed DNA exit gate is formed by interactions between Scc1 and the coiled-coil region of Smc3. (PMID:25414306)
• Elevated RAD21 expression tracks with reactivation of L1 expression in human sporadic colorectal cancer. (PMID:25464844)
• Some patients with chronic intestinal pseudo-obstruction carry mutations in RAD21 that disrupt the ability of its product to regulate genes such as RUNX1 and APOB. (PMID:25575569)
• found well-positioned CTCF and RAD21 peaks approximately 60-80 bp upstream of the TSS in the unidirectional genes. The peak heights were related to the amount of antisense transcription. Results provide insights into the distribution of histone modifications at promoters and suggest a novel role of CTCF and cohesin as regulators of transcriptional direction. (PMID:25881024)
• Reduced RAD21 destabilizes high-level gene amplification by disrupting pre-replication complex bindings in human cancers with chromosomal instability. (PMID:26420833)
• Data indicate that RAD21 plays an important role in cellular senescence breast cancer cells, mainly through RB1 pathway activation via c-Myc downregulation. (PMID:26529363)
• This study together with previous reports suggests incomplete penetrance associated with RAD21 variants and these individuals may therefore be underdiagnosed. (PMID:27882533)
• With tissue microarrays of hepatocellular carcinoma (HCC) patients, we determined the prognostic values of the core genes in the network and found that RAD21, CDK1, and HDAC2 expression levels were negatively associated with overall survival for HCC patients. (PMID:28434945)
• evidence for a possible pathogenetic role of RAD21 promoter methylation in the development of chronic lymphocytic leukemia. (PMID:29587287)
• depletion of Rad21 in a Pds5-deficient background rescues the phenotype observed upon Pds5 depletion alone. These findings support a model where loss of either component of the cohesin releasin complex perturbs cohesin dynamics on replication forks, hindering fork progression and promoting MRE11-dependent fork slowing (PMID:29917110)
• A subset of PGP9.5- and HuC/D-IR neuronal cell bodies and nerve fibers in the myenteric plexus of human and mouse small intestine also displayed cytoplasmic RAD21 (PMID:30069982)
• We demonstrate that infection of hepatoma cells with HCV leads to up regulation of the expression of the RAD21 cohesin subunit and changes cohesin residency on the chromatin. (PMID:30698808)

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio	rad21a	ENSDARG00000006092
danio_rerio	rad21b	ENSDARG00000035655
mus_musculus	Rad21	ENSMUSG00000022314
rattus_norvegicus	Rad21	ENSRNOG00000004420
drosophila_melanogaster	vtd	FBGN0260987
caenorhabditis_elegans		WBGENE00004737

Paralogs (2): REC8 (ENSG00000100918), RAD21L1 (ENSG00000244588)

Protein

Protein identifiers

Double-strand-break repair protein rad21 homolog — O60216 (reviewed: O60216)

Alternative names: Nuclear matrix protein 1, SCC1 homolog

All UniProt accessions (7): A0A8I5KWV3, O60216, E5RFV8, E5RG18, E5RIN7, E5RJK5, E5RJW1

UniProt curated annotations — full annotation on UniProt →

Function. As a member of the cohesin complex, involved in sister chromatid cohesion from the time of DNA replication in S phase to their segregation in mitosis, a function that is essential for proper chromosome segregation, post-replicative DNA repair, and the prevention of inappropriate recombination between repetitive regions. The cohesin complex may also play a role in spindle pole assembly during mitosis. In interphase, cohesins may function in the control of gene expression by binding to numerous sites within the genome. May control RUNX1 gene expression. Binds to and represses APOB gene promoter. May play a role in embryonic gut development, possibly through the regulation of enteric neuron development. May promote apoptosis.

Subunit / interactions. Component of the cohesin complex, which consists of an SMC1A/B and SMC3 heterodimer core and 2 non-Smc subunits RAD21 and STAG1/SA1, STAG2/SA2 or STAG3/SA3. Interacts (via C-terminus) with SMC1A and (via N-terminus) with SMC3; these interactions are direct. The cohesin complex interacts with NUMA1. The cohesin complex also interacts with CDCA5, PDS5A and PDS5B; this interaction might regulate the ability of the cohesin complex to mediate sister chromatid cohesion. The interaction with PDS5B is direct and is stimulated by STAG1/SA1. The cohesin complex interacts with the cohesin loading complex subunits NIPBL/Scc2 (via HEAT repeats) and MAU2/Scc4. NIPBL directly contacts all members of the complex, RAD21, SMC1A/B, SMC3 and STAG1. The cohesin complex interacts with DDX11/ChIR1. Directly interacts with WAPL; this interaction is stimulated by STAG1/SA1. Interacts with the ISWI chromatin remodeling complex component SMARCA5/SNF2h; the interaction is direct. Interacts with the NuRD complex component CHD4; the interaction is direct.

Subcellular location. Nucleus. Nucleus matrix. Chromosome. Centromere. Cytoplasm. Cytoskeleton. Spindle pole Cytoplasm. Cytosol.

Tissue specificity. Expressed in the gut (at protein level).

Post-translational modifications. Cleaved by separase/ESPL1 at the onset of anaphase; this cleavage is required for sister chromatid separation and cytokinesis. Cleaved by caspase-3/CASP3 or caspase-7/CASP7 at the beginning of apoptosis. Phosphorylated; becomes hyperphosphorylated in M phase of cell cycle. The large dissociation of cohesin from chromosome arms during prophase may be partly due to its phosphorylation by PLK1.

Disease relevance. Cornelia de Lange syndrome 4 with or without midline brain defects (CDLS4) [MIM:614701] A form of Cornelia de Lange syndrome, a clinically heterogeneous developmental disorder associated with malformations affecting multiple systems. It is characterized by facial dysmorphisms, abnormal hands and feet, growth delay, cognitive retardation, hirsutism, gastroesophageal dysfunction and cardiac, ophthalmologic and genitourinary anomalies. The disease is caused by variants affecting the gene represented in this entry. Mungan syndrome (MGS) [MIM:611376] An autosomal recessive disease characterized by visceral neuromyopathy, intestinal dysmotility and chronic intestinal pseudoobstruction, megaduodenum, long-segment Barrett esophagus, and a variety of cardiac valve or septal defects such as membranous ventricular septal defect, pulmonary and tricuspid valve regurgitation. The disease is caused by variants affecting the gene represented in this entry.

Domain organisation. The C-terminal part associates with the ATPase head of SMC1A, while the N-terminal part binds to the ATPase head of SMC3.

Similarity. Belongs to the rad21 family.

RefSeq proteins (1): NP_006256* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR006909	Rad21/Rec8_C_eu	Domain
IPR006910	Rad21_Rec8_N	Domain
IPR023093	ScpA-like_C	Homologous_superfamily
IPR036390	WH_DNA-bd_sf	Homologous_superfamily
IPR039781	Rad21/Rec8-like	Family
IPR049589	NXP1_M-like	Domain

Pfam: PF04824, PF04825

UniProt features (58 total): helix 12, modified residue 8, region of interest 7, mutagenesis site 7, sequence variant 5, compositionally biased region 4, site 3, cross-link 3, strand 3, turn 3, chain 2, sequence conflict 1

Structure

Experimental structures (PDB)

36 structures, top 30 by resolution.

PDB	Method	Resolution (Å)
8ROE	X-RAY DIFFRACTION	1.36
8ROD	X-RAY DIFFRACTION	1.5
8ROF	X-RAY DIFFRACTION	1.65
8RO9	X-RAY DIFFRACTION	1.77
8ROC	X-RAY DIFFRACTION	1.85
8RO8	X-RAY DIFFRACTION	1.9
8ROG	X-RAY DIFFRACTION	1.94
8RO7	X-RAY DIFFRACTION	2.09
8RO6	X-RAY DIFFRACTION	2.2
8ROK	X-RAY DIFFRACTION	2.25
6RRC	X-RAY DIFFRACTION	2.37
8ROA	X-RAY DIFFRACTION	2.44
8ROI	X-RAY DIFFRACTION	2.45
8ROB	X-RAY DIFFRACTION	2.5
8ROH	X-RAY DIFFRACTION	2.6
6QNX	X-RAY DIFFRACTION	2.7
9HN0	ELECTRON MICROSCOPY	2.8
4PJW	X-RAY DIFFRACTION	2.85
9HMV	ELECTRON MICROSCOPY	2.9
9HN4	ELECTRON MICROSCOPY	2.93
4PK7	X-RAY DIFFRACTION	2.95
9HN5	ELECTRON MICROSCOPY	2.96
8ROJ	X-RAY DIFFRACTION	3
4PJU	X-RAY DIFFRACTION	3.05
9EP3	X-RAY DIFFRACTION	3.08
8ROL	X-RAY DIFFRACTION	3.11
6RRK	X-RAY DIFFRACTION	3.17
7ZJS	X-RAY DIFFRACTION	3.24
9HMS	ELECTRON MICROSCOPY	3.4
9HVY	ELECTRON MICROSCOPY	3.5

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O60216-F1	61.49	0.20

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (3): 172–173 (cleavage; by espl1); 279–280 (cleavage; by caspase-3 or caspase-7); 450–451 (cleavage; by espl1)

Post-translational modifications (11): 46, 153, 175, 249, 394, 454, 545, 623, 48, 216, 418

Mutagenesis-validated functional residues (7):

Position	Phenotype
1–126	abolishes interaction with smc1.
126–282	abolishes binding to smarca5.
172	abolishes first cleavage by espl1, no effect on nuclear localization.
276–280	loss of cleavage by caspase-3 or caspase-7.
279	loss of cleavage by caspase-3 or caspase-7.
282	no effect on cleavage by caspase-3 or caspase-7.
450	abolishes second cleavage by espl1, no effect on nuclear localization.

Function

Pathways and Gene Ontology

Reactome pathways

7 pathways

ID	Pathway
R-HSA-1221632	Meiotic synapsis
R-HSA-2467813	Separation of Sister Chromatids
R-HSA-2468052	Establishment of Sister Chromatid Cohesion
R-HSA-2470946	Cohesin Loading onto Chromatin
R-HSA-2500257	Resolution of Sister Chromatid Cohesion
R-HSA-3108214	SUMOylation of DNA damage response and repair proteins
R-HSA-9018519	Estrogen-dependent gene expression

MSigDB gene sets: 742 (showing top): GSE45365_CD8A_DC_VS_CD11B_DC_IFNAR_KO_DN, GSE18804_BRAIN_VS_COLON_TUMORAL_MACROPHAGE_DN, GSE45365_CTRL_VS_MCMV_INFECTION_NK_CELL_DN, MORF_MTA1, GOBP_CHROMOSOME_ORGANIZATION, BORCZUK_MALIGNANT_MESOTHELIOMA_UP, FREAC2_01, MORF_MBD4, TGCGCANK_UNKNOWN, REACTOME_MEIOTIC_SYNAPSIS, GOBP_REGULATION_OF_NUCLEAR_DIVISION, GOBP_CELL_CYCLE_PHASE_TRANSITION, GEORGES_CELL_CYCLE_MIR192_TARGETS, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, MORF_RAD21

GO Biological Process (26): response to hypoxia (GO:0001666), double-strand break repair (GO:0006302), DNA recombination (GO:0006310), regulation of transcription by RNA polymerase II (GO:0006357), apoptotic process (GO:0006915), chromosome segregation (GO:0007059), sister chromatid cohesion (GO:0007062), reciprocal meiotic recombination (GO:0007131), negative regulation of G2/M transition of mitotic cell cycle (GO:0010972), negative regulation of interleukin-1 beta production (GO:0032691), negative regulation of tumor necrosis factor production (GO:0032720), positive regulation of interleukin-10 production (GO:0032733), establishment of mitotic sister chromatid cohesion (GO:0034087), establishment of meiotic sister chromatid cohesion (GO:0034089), negative regulation of glial cell apoptotic process (GO:0034351), negative regulation of neuron apoptotic process (GO:0043524), negative regulation of mitotic metaphase/anaphase transition (GO:0045841), positive regulation of sister chromatid cohesion (GO:0045876), cell division (GO:0051301), protein localization to chromatin (GO:0071168), chromatin looping (GO:0140588), replication-born double-strand break repair via sister chromatid exchange (GO:1990414), DNA repair (GO:0006281), DNA damage response (GO:0006974), positive regulation of gene expression (GO:0010628), negative regulation of gene expression (GO:0010629)

GO Molecular Function (6): cis-regulatory region sequence-specific DNA binding (GO:0000987), chromatin binding (GO:0003682), lncRNA binding (GO:0106222), DNA-binding transcription factor binding (GO:0140297), DNA binding (GO:0003677), protein binding (GO:0005515)

GO Cellular Component (16): chromosome, centromeric region (GO:0000775), chromatin (GO:0000785), condensed nuclear chromosome (GO:0000794), spindle pole (GO:0000922), nucleus (GO:0005634), nucleoplasm (GO:0005654), chromosome (GO:0005694), cytosol (GO:0005829), cohesin complex (GO:0008278), membrane (GO:0016020), nuclear matrix (GO:0016363), midbody (GO:0030496), mitotic cohesin complex (GO:0030892), meiotic cohesin complex (GO:0030893), cytoplasm (GO:0005737), cytoskeleton (GO:0005856)

Reactome top-level categories

Rollup of top-7 pathways:

Category	Pathways
Meiosis	1
Mitotic Anaphase	1
S Phase	1
Mitotic Telophase/Cytokinesis	1
Mitotic Prometaphase	1
SUMO E3 ligases SUMOylate target proteins	1
ESR-mediated signaling	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	8
cell cycle process	2
negative regulation of mitotic cell cycle phase transition	2
establishment of sister chromatid cohesion	2
negative regulation of apoptotic process	2
binding	2
chromosome	2
nuclear lumen	2
intracellular membraneless organelle	2
cohesin complex	2
response to stress	1
response to decreased oxygen levels	1
DNA repair	1
DNA metabolic process	1
regulation of DNA-templated transcription	1
transcription by RNA polymerase II	1
programmed cell death	1
apoptotic signaling pathway	1
execution phase of apoptosis	1
chromosome organization	1
meiosis I	1
reciprocal homologous recombination	1
meiotic cell cycle process	1
G2/M transition of mitotic cell cycle	1
regulation of G2/M transition of mitotic cell cycle	1
negative regulation of cell cycle G2/M phase transition	1
interleukin-1 beta production	1
regulation of interleukin-1 beta production	1
negative regulation of interleukin-1 production	1
tumor necrosis factor production	1
regulation of tumor necrosis factor production	1
negative regulation of tumor necrosis factor superfamily cytokine production	1
positive regulation of cytokine production	1
interleukin-10 production	1
regulation of interleukin-10 production	1
mitotic cell cycle	1
mitotic sister chromatid cohesion	1
mitotic cell cycle process	1
meiotic sister chromatid cohesion	1
glial cell apoptotic process	1

Protein interactions and networks

STRING

4192 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
RAD21	STAG2	Q8N3U4	999
RAD21	SMC1A	Q14683	999
RAD21	STAG1	Q8WVM7	999
RAD21	SMC3	Q9UQE7	999
RAD21	PDS5A	Q29RF7	998
RAD21	CTCF	P49711	997
RAD21	WAPL	Q7Z5K2	990
RAD21	SMC1B	Q8NDV3	990
RAD21	STAG3	Q9UJ98	988
RAD21	NIPBL	Q6KC79	961
RAD21	ESPL1	Q14674	953
RAD21	SGO1	Q5FBB7	917
RAD21	SMC4	Q9NTJ3	903
RAD21	ESCO2	Q56NI9	895
RAD21	PDS5B	Q9NTI5	890

IntAct

241 interactions, top by confidence:

A	B	Type	Score
STAG2	RAD21	psi-mi:“MI:0914”(association)	0.970
STAG2	RAD21	psi-mi:“MI:0407”(direct interaction)	0.970
STAG2	RAD21	psi-mi:“MI:0915”(physical association)	0.970
RAD21	STAG2	psi-mi:“MI:0915”(physical association)	0.970
RAD21	SMC3	psi-mi:“MI:0915”(physical association)	0.960
SMC3	RAD21	psi-mi:“MI:0914”(association)	0.960
SMC3	RAD21	psi-mi:“MI:0915”(physical association)	0.960
CCM2	KRIT1	psi-mi:“MI:0914”(association)	0.960
STAG1	RAD21	psi-mi:“MI:0914”(association)	0.930
RAD21	SMC1A	psi-mi:“MI:0915”(physical association)	0.930
SMC1A	RAD21	psi-mi:“MI:0914”(association)	0.930
SMC1A	RAD21	psi-mi:“MI:0915”(physical association)	0.930

BioGRID (609): RAD21 (Two-hybrid), RAD21 (Affinity Capture-MS), RAD21 (Affinity Capture-MS), RAD21 (Affinity Capture-MS), RAD21 (Affinity Capture-MS), RAD21 (Affinity Capture-MS), RAD21 (Affinity Capture-MS), RAD21 (Affinity Capture-MS), RAD21 (Affinity Capture-MS), RAD21 (Affinity Capture-Western), RAD21 (Affinity Capture-Western), RAD21 (Affinity Capture-RNA), MCM7 (Co-fractionation), RAD21 (Co-fractionation), RAD21 (Co-fractionation)

ESM2 similar proteins: A0A1P8AW69, A2AU37, A4IF98, A6QPC8, D2HSB3, D3ZWE7, F4JET1, F6RRD7, I3XHK1, O13067, O60216, O93310, P14629, P30776, P36626, Q08DB0, Q0P4S5, Q12158, Q14AW5, Q15003, Q19325, Q28GV1, Q3B7T8, Q3SWX9, Q4R7I0, Q564K3, Q5F3D1, Q5RH01, Q61550, Q641G4, Q67W65, Q6AUQ7, Q6TEL1, Q75PQ8, Q86VD1, Q8C156, Q8W1Y0, Q9C0F1, Q9D4G9, Q9D5T7

Diamond homologs: A2AU37, D2HSB3, O60216, O93310, P30776, Q12158, Q3SWX9, Q61550, Q6TEL1, Q8W1Y0, Q9FQ19, Q9FQ20, Q9H4I0, Q9S7T7, O95072, Q19325, Q6AYJ4, Q8C5S7, P36626

SIGNOR signaling

13 interactions.

A	Effect	B	Mechanism
PRSS21	up-regulates	RAD21	cleavage
RAD21	“down-regulates quantity by repression”	RUNX1	“transcriptional regulation”
RAD21	“down-regulates quantity”	APOB	“transcriptional regulation”
STAG2	“up-regulates quantity by stabilization”	RAD21	binding
RAD21	“down-regulates activity”	GATA2	relocalization
RAD21	“down-regulates activity”	RUNX1	relocalization
RAD21	“down-regulates activity”	ERG	relocalization
PLK1	“down-regulates quantity by destabilization”	RAD21	dephosphorylation
ESPL1	“down-regulates quantity by destabilization”	RAD21	cleavage
RAD21	“up-regulates activity”	DNA_repair
RAD21	“form complex”	“Cohesin complex”	binding
CC2D1A	“up-regulates activity”	RAD21	binding

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 143 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
S Phase	6	10.9×	9e-04
Resolution of Sister Chromatid Cohesion	12	10.4×	3e-07
Separation of Sister Chromatids	16	9.7×	1e-09
ESR-mediated signaling	7	9.0×	6e-04
Mitotic Metaphase and Anaphase	9	8.7×	7e-05
Mitotic Anaphase	9	8.7×	7e-05
Mitotic Prometaphase	10	6.9×	1e-04
Estrogen-dependent gene expression	9	6.8×	4e-04

GO biological processes:

GO term	Partners	Fold	FDR
mitotic sister chromatid cohesion	6	51.9×	5e-07
sister chromatid cohesion	5	29.5×	2e-04
mitotic spindle assembly	5	13.2×	9e-03
cell division	15	5.3×	6e-05

Disease & clinical

Cancer significance

From intOGen — cancer-driver classification: loss-of-function (tumor-suppressor-like) across 2 cancer types — AML, LUSC.

Clinical variants and AI predictions

ClinVar

536 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	39
Likely pathogenic	17
Uncertain significance	207
Likely benign	159
Benign	57

Top pathogenic / likely-pathogenic (30)

Variant ID	HGVS	Classification
1034259	NM_006265.3(RAD21):c.85delinsCCT (p.Lys29fs)	Pathogenic
1185047	NM_006265.3(RAD21):c.1621-384_1704+199del	Pathogenic
1185048	NM_006265.3(RAD21):c.593dup (p.Ser198fs)	Pathogenic
1185049	NM_006265.3(RAD21):c.943_946del (p.Glu315fs)	Pathogenic
1192852	NM_006265.3(RAD21):c.52_67del (p.Trp18fs)	Pathogenic
1805433	NM_006265.3(RAD21):c.1635del (p.Gly547fs)	Pathogenic
2001811	NM_006265.3(RAD21):c.1045dup (p.Thr349fs)	Pathogenic
211993	NM_006265.3(RAD21):c.56_62del (p.Leu19fs)	Pathogenic
211994	NM_006265.3(RAD21):c.579dup (p.Glu194fs)	Pathogenic
211995	NM_006265.3(RAD21):c.592_593dup (p.Ser198fs)	Pathogenic
2444617	NM_006265.3(RAD21):c.688G>C (p.Asp230His)	Pathogenic
2738121	NM_006265.3(RAD21):c.683del (p.Ile228fs)	Pathogenic
280268	NM_006265.3(RAD21):c.578T>A (p.Leu193Ter)	Pathogenic
3064208	NM_006265.3(RAD21):c.68G>A (p.Trp23Ter)	Pathogenic
3066324	NM_006265.3(RAD21):c.464del (p.Leu155fs)	Pathogenic
3340858	NM_006265.3(RAD21):c.1756C>T (p.Arg586Ter)	Pathogenic
3361510	NM_006265.3(RAD21):c.1722_1723del (p.Gly575fs)	Pathogenic
3385383	NM_006265.3(RAD21):c.660del (p.Phe220fs)	Pathogenic
35459	NM_006265.3(RAD21):c.1127C>G (p.Pro376Arg)	Pathogenic
3632951	NM_006265.3(RAD21):c.839C>G (p.Ser280Ter)	Pathogenic
4149685	NM_006265.3(RAD21):c.447dup (p.Gly150fs)	Pathogenic
418706	NM_006265.3(RAD21):c.1651del (p.Gln551fs)	Pathogenic
436481	NM_006265.3(RAD21):c.181_182dup (p.Gly62fs)	Pathogenic
4537918	NM_006265.3(RAD21):c.622_623insGGTT (p.His208fs)	Pathogenic
523217	NM_006265.3(RAD21):c.1550dup (p.Glu518fs)	Pathogenic
523218	NM_006265.3(RAD21):c.1161+1G>A	Pathogenic
559920	NM_006265.3(RAD21):c.208A>T (p.Lys70Ter)	Pathogenic
560415	NM_006265.3(RAD21):c.1864G>A (p.Ala622Thr)	Pathogenic
802434	NM_006265.3(RAD21):c.144+1G>A	Pathogenic
807668	NM_006265.3(RAD21):c.3G>A (p.Met1Ile)	Pathogenic

SpliceAI

2224 predictions. Top by Δscore:

Variant	Effect	Δscore
8:116847688:CACG:C	acceptor_gain	1.0000
8:116847689:ACGC:A	acceptor_loss	1.0000
8:116847690:CG:C	acceptor_gain	1.0000
8:116847690:CGCT:C	acceptor_loss	1.0000
8:116847691:GCTG:G	acceptor_loss	1.0000
8:116847692:C:CC	acceptor_gain	1.0000
8:116847692:CTG:C	acceptor_loss	1.0000
8:116847693:T:A	acceptor_loss	1.0000
8:116848947:TGAAG:T	donor_gain	1.0000
8:116850613:TTTAC:T	donor_loss	1.0000
8:116850614:TTACC:T	donor_loss	1.0000
8:116850615:TACCT:T	donor_loss	1.0000
8:116850616:A:AC	donor_gain	1.0000
8:116850617:C:CA	donor_loss	1.0000
8:116850617:C:CC	donor_gain	1.0000
8:116850617:CCT:C	donor_gain	1.0000
8:116850622:T:TA	donor_gain	1.0000
8:116850766:GGCT:G	acceptor_loss	1.0000
8:116850767:GC:G	acceptor_loss	1.0000
8:116850768:C:CC	acceptor_gain	1.0000
8:116850768:C:G	acceptor_loss	1.0000
8:116850769:T:C	acceptor_gain	1.0000
8:116850769:T:TC	acceptor_gain	1.0000
8:116850775:CAA:C	acceptor_gain	1.0000
8:116850776:A:T	acceptor_gain	1.0000
8:116850777:A:C	acceptor_gain	1.0000
8:116851942:A:AC	donor_gain	1.0000
8:116851943:C:CA	donor_gain	1.0000
8:116851943:CTT:C	donor_gain	1.0000
8:116851943:CTTA:C	donor_gain	1.0000

AlphaMissense

4235 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
8:116847522:C:T	G625E	1.000
8:116847588:A:G	L603P	1.000
8:116847588:A:T	L603H	1.000
8:116847594:A:C	L601W	1.000
8:116847594:A:G	L601S	1.000
8:116847599:G:C	S599R	1.000
8:116847599:G:T	S599R	1.000
8:116847601:T:G	S599R	1.000
8:116847604:A:C	Y598D	1.000
8:116847606:A:G	F597S	1.000
8:116847615:G:T	A594D	1.000
8:116848950:A:G	L567P	1.000
8:116848959:A:G	L564P	1.000
8:116848973:C:A	R559S	1.000
8:116848973:C:G	R559S	1.000
8:116848974:C:A	R559M	1.000
8:116852692:A:G	L393P	1.000
8:116854291:A:G	L372P	1.000
8:116854291:A:T	L372Q	1.000
8:116854306:C:A	G367V	1.000
8:116854306:C:T	G367E	1.000
8:116854307:C:G	G367R	1.000
8:116854307:C:T	G367R	1.000
8:116854314:T:A	K364N	1.000
8:116854314:T:G	K364N	1.000
8:116854315:T:A	K364I	1.000
8:116854317:C:A	W363C	1.000
8:116854317:C:G	W363C	1.000
8:116854319:A:G	W363R	1.000
8:116854319:A:T	W363R	1.000

dbSNP variants (sampled 300 via entrez): RS1000003688 (8:116857060 T>A,G), RS1000062304 (8:116859344 A>T), RS1000120314 (8:116862967 G>A,T), RS1000168320 (8:116849767 G>A), RS1000248225 (8:116851169 A>G,T), RS1000374860 (8:116869541 CGACACTGCATTCTAGCCTGGGTGACACAGCAA>C), RS1000410566 (8:116859068 T>C), RS1000513580 (8:116863399 T>C), RS1000844413 (8:116846648 G>A), RS1000934247 (8:116869105 G>A,T), RS1000986494 (8:116868897 G>A,C,T), RS1001053453 (8:116874101 C>A,T), RS1001084287 (8:116874775 A>G), RS1001164606 (8:116858687 T>C), RS1001228972 (8:116848379 C>A,T)

Disease associations

OMIM: gene MIM:606462 | disease phenotypes: MIM:614701, MIM:122470, MIM:611376, MIM:120970

GenCC curated gene-disease

Disease	Classification	Inheritance
Cornelia de Lange syndrome 4	Definitive	Autosomal dominant
Cornelia de Lange syndrome	Definitive	Autosomal dominant
Mungan syndrome	Strong	Autosomal recessive

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
Cornelia de Lange syndrome	Definitive	AD

Mondo (8): Cornelia de Lange syndrome 4 (MONDO:0013864), Cornelia de Lange syndrome (MONDO:0016033), Mungan syndrome (MONDO:0012657), Cornelia de Lange syndrome 1 (MONDO:0007387), intellectual disability (MONDO:0001071), cone-rod dystrophy (MONDO:0015993), hereditary neoplastic syndrome (MONDO:0015356), acute megakaryoblastic leukemia in down syndrome (MONDO:0020526)

Orphanet (5): Cornelia de Lange syndrome (Orphanet:199), Cone rod dystrophy (Orphanet:1872), Inherited cancer-predisposing syndrome (Orphanet:140162), Acute megakaryoblastic leukemia in children with Down syndrome (Orphanet:99887), NON RARE IN EUROPE: Unexplained intellectual disability (Orphanet:319658)

HPO phenotypes

160 total (30 of 160 shown, HPO-id order):

HPO	Term
HP:0000003	Multicystic kidney dysplasia
HP:0000006	Autosomal dominant inheritance
HP:0000007	Autosomal recessive inheritance
HP:0000010	Recurrent urinary tract infections
HP:0000028	Cryptorchidism
HP:0000047	Hypospadias
HP:0000059	Hypoplastic labia majora
HP:0000076	Vesicoureteral reflux
HP:0000083	Renal insufficiency
HP:0000089	Renal hypoplasia
HP:0000130	Abnormality of the uterus
HP:0000164	Abnormality of the dentition
HP:0000174	Abnormal palate morphology
HP:0000175	Cleft palate
HP:0000176	Submucous cleft hard palate
HP:0000218	High palate
HP:0000219	Thin upper lip vermilion
HP:0000220	Velopharyngeal insufficiency
HP:0000233	Thin vermilion border
HP:0000248	Brachycephaly
HP:0000252	Microcephaly
HP:0000294	Low anterior hairline
HP:0000316	Hypertelorism
HP:0000319	Smooth philtrum
HP:0000343	Long philtrum
HP:0000347	Micrognathia
HP:0000358	Posteriorly rotated ears
HP:0000369	Low-set ears
HP:0000381	Stapes ankylosis
HP:0000400	Macrotia

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST005863_14	Menopause (age at onset)	2.000000e-08
GCST005863_27	Menopause (age at onset)	3.000000e-07

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0004704	age at menopause

MeSH disease descriptors (4)

Descriptor	Name	Tree numbers
D000071700	Cone-Rod Dystrophies	C11.270.152; C11.768.585.658.250; C16.320.290.152
D008607	Intellectual Disability	C10.597.606.360; C23.888.592.604.646; F01.700.687; F03.625.539
D009386	Neoplastic Syndromes, Hereditary	C04.700; C16.320.700
C548078	Mungan Syndrome (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

56 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
bisphenol A	decreases expression, affects cotreatment, increases expression	2
trichostatin A	affects cotreatment, decreases expression	2
Air Pollutants	increases abundance, decreases expression	2
Cadmium Chloride	increases expression, decreases expression, increases abundance	2
Particulate Matter	decreases expression, increases abundance	2
aristolochic acid I	decreases expression	1
GSK-J4	increases expression	1
echimidine	decreases expression, increases metabolic processing	1
TAK-243	decreases sumoylation	1
pradimicin-IRD	decreases expression	1
2,4,6-tribromophenol	decreases expression	1
lasiocarpine	decreases expression, increases metabolic processing	1
triphenyl phosphate	affects expression	1
riddelliine	decreases expression, increases metabolic processing	1
beta-lapachone	decreases expression	1
arsenite	decreases reaction, affects binding	1
afimoxifene	affects response to substance	1
sodium arsenite	decreases expression	1
2,3-bis(3’-hydroxybenzyl)butyrolactone	affects cotreatment, increases expression	1
coumarin	decreases phosphorylation	1
beta-methylcholine	affects expression	1
deguelin	increases expression	1
nickel acetate	affects expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
torcetrapib	increases expression	1
ICG 001	decreases expression	1
2,2’,4,4’-tetrabromodiphenyl ether	decreases expression	1
dorsomorphin	affects cotreatment, decreases expression	1
hexabrominated diphenyl ether 153	decreases expression	1
jinfukang	decreases expression	1

Cellosaurus cell lines

32 cell lines: 29 cancer cell line, 3 embryonic stem cell

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_0393	LN-229	Cancer cell line	Female
CVCL_0589	Kasumi-1	Cancer cell line	Male
CVCL_1632	P31/FUJ	Cancer cell line	Male
CVCL_A5S0	SEES3-1V human RAD21, clone1	Embryonic stem cell	Male
CVCL_A5S1	SEES3-1V human RAD21, clone2	Embryonic stem cell	Male
CVCL_A5S2	SEES3-1V human RAD21, clone3	Embryonic stem cell	Male
CVCL_A602	CMY	Cancer cell line	Male
CVCL_A8V5	LN229/CD20	Cancer cell line	Female
CVCL_D2R8	LN229/mCCR3	Cancer cell line	Female
CVCL_D2RM	LN229/mCD39	Cancer cell line	Female

Clinical trials (associated diseases)

243 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT05657860	PHASE4	COMPLETED	Guanfacine Extended Release for the Reduction of Aggression and Self-injurious Behavior Associated With Prader-Willi Syndrome
NCT05744479	PHASE4	RECRUITING	Metformin for Antipsychotic-induced Weight Gain in Adults With Intellectual Disability
NCT06107829	PHASE4	WITHDRAWN	Valbenazine Treatment of Tardive Dyskinesia in Adults With Intellectual/Developmental Disabilities
NCT06997198	PHASE4	NOT_YET_RECRUITING	Deutetrabenazine Treatment for Tardive Dyskinesia in Intellectual/Developmental Disabilities
NCT02270736	PHASE3	COMPLETED	Clinical Study to Investigate the Efficacy and Safety of NT 201 Compared to Placebo in the Treatment of Chronic Troublesome Drooling Associated With Neurological Disorders and/or Intellectual Disability
NCT04381897	PHASE2	NOT_YET_RECRUITING	Use of N-Acetylcysteine in the Treatment of Repetitive and Self-Injurious Behaviors in Cornelia de Lange Syndrome
NCT02304302	PHASE2	COMPLETED	Down Syndrome Memantine Follow-up Study
NCT03862950	PHASE2	COMPLETED	A Trial of Metformin in Individuals With Fragile X Syndrome (Met)
NCT04529226	PHASE2	UNKNOWN	Study to Compare Clozapine vs Treatment as Usual in People With Intellectual Disability & Treatment-resistant Psychosis
NCT04821856	PHASE2	COMPLETED	Evaluation of the Effectiveness of Cannabidiol in Treating Severe Behavioural Problems in Children and Adolescents With Intellectual Disability
NCT01773278	PHASE2	RECRUITING	Cholesterol and Antioxidant Treatment in Patients With Smith-Lemli-Opitz Syndrome (SLOS)
NCT05273320	PHASE1	COMPLETED	Clinical Trial of Nabilone for Aggression in Adults With Intellectual and Developmental Disabilities
NCT05301361	PHASE1	ENROLLING_BY_INVITATION	Sensitivity of the NIH Toolbox to Stimulant Treatment in Intellectual Disabilities
NCT06016764	PHASE1	COMPLETED	Use of MRI and cTBS for Catatonia in Autism
NCT06586827	PHASE1	COMPLETED	Impact of Competency-Based Training and Technical Assistance Employment Outcomes of Individuals With ID/DD
NCT07531940	PHASE1	NOT_YET_RECRUITING	Escalating Doses of Memantine in Down Syndrome (MEDS-123)
NCT06789783	PHASE2/PHASE3	RECRUITING	Cornelia De Lange Syndrome: Assessing Positive Effects of Lithium Treatment
NCT01793168	Not specified	RECRUITING	Rare Disease Patient Registry & Natural History Study - Coordination of Rare Diseases at Sanford
NCT03113877	Not specified	TERMINATED	Evaluation of Autonomic Function in Individuals With Cornelia de Lange Syndrome (CdLS)
NCT04463316	Not specified	RECRUITING	GROWing Up With Rare GENEtic Syndromes
NCT05829668	Not specified	RECRUITING	Behavioral Assessment and Treatment of Problem Behavior in Children With Cornelia de Lange Syndrome
NCT03479476	PHASE2/PHASE3	COMPLETED	A Trial of Metformin in Individuals With Fragile X Syndrome
NCT02616796	PHASE1/PHASE2	COMPLETED	Effects of Social Gaze Training on Brain and Behavior in Fragile X Syndrome
NCT06860672	EARLY_PHASE1	RECRUITING	Clinical Trial of the Dual Vector Base Editor for the Treatment of the CHD3-R1025W Mutation
NCT00597948	Not specified	COMPLETED	Healthy Lifestyles for People With Intellectual Disabilities
NCT01087320	Not specified	RECRUITING	Genome Medical Sequencing for Gene Discovery
NCT01652963	Not specified	UNKNOWN	Picture-based Computerised Assessment and Training of Cognitive Behaviour Therapy Skills
NCT01695395	Not specified	COMPLETED	Mental Health Care Provision for Adults With Intellectual Disability and a Mental Disorder
NCT01867554	Not specified	COMPLETED	Research and Characterization of New Genes Involved in Intellectual Disability
NCT01915381	Not specified	COMPLETED	Improving Adherence Healthy Lifestyle With a Smartphone Application Based on Adults With Intellectual Disabilities
NCT01988623	Not specified	COMPLETED	Pivotal Response Treatment for Individuals With Intellectual Disabilities
NCT02099773	Not specified	COMPLETED	Support Staff-client Interactions With Augmentative and Alternative Communication
NCT02136849	Not specified	COMPLETED	Inter-regional Project of the Great Western Exploration Approach for Exome Molecular Causes Severe Intellectual Disability Isolated or Syndromic
NCT02225041	Not specified	COMPLETED	Sedation Strategy and Cognitive Outcome After Critical Illness in Early Childhood
NCT02414438	Not specified	COMPLETED	Establishing the Clinical Utility of First StepDx PLUS and NextStepDx PLUS Study
NCT02451761	Not specified	COMPLETED	Apparently Balanced Chromosomal Translocation/ Next-generation Sequencing/ Intellectual Disability
NCT02461420	Not specified	ACTIVE_NOT_RECRUITING	Mapping the Genotype, Phenotype, and Natural History of Phelan-McDermid Syndrome
NCT02461459	Not specified	ACTIVE_NOT_RECRUITING	Autism Spectrum Disorder (ASD) and Intellectual Disability (ID) Determinants in Tuberous Sclerosis Complex (TSC)
NCT02486081	Not specified	COMPLETED	Development and Application-Smart Football for Movement Evaluation and Training in the Special Education Population
NCT02504502	Not specified	COMPLETED	Enhancing Genomic Laboratory Reports to Enhance Communication and Empower Patients