RARRES1

Summary

RARRES1 (retinoic acid receptor responder 1, HGNC:9867) is a protein-coding gene on chromosome 3q25.32, encoding Retinoic acid receptor responder protein 1 (P49788). Inhibitor of the cytoplasmic carboxypeptidase AGBL2, may regulate the alpha-tubulin tyrosination cycle.

This gene was identified as a retinoid acid (RA) receptor-responsive gene. It encodes a type 1 membrane protein. The expression of this gene is upregulated by tazarotene as well as by retinoic acid receptors. The expression of this gene is found to be downregulated in prostate cancer, which is caused by the methylation of its promoter and CpG island. Alternatively spliced transcript variant encoding distinct isoforms have been observed.

Source: NCBI Gene 5918 — RefSeq curated summary.

At a glance

• GWAS associations: 4
• Clinical variants (ClinVar): 51 total
• MANE Select transcript: NM_206963

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:9867
Approved symbol	RARRES1
Name	retinoic acid receptor responder 1
Location	3q25.32
Locus type	gene with protein product
Status	Approved
Aliases	TIG1, LXNL
Ensembl gene	ENSG00000118849
Ensembl biotype	protein_coding
OMIM	605090
Entrez	5918

Gene structure

Transcript identifiers

Ensembl transcripts: 9 — 6 protein_coding, 3 protein_coding_CDS_not_defined

ENST00000237696, ENST00000462663, ENST00000471444, ENST00000479756, ENST00000498640, ENST00000879325, ENST00000950251, ENST00000950252, ENST00000950253

RefSeq mRNA: 2 — MANE Select: NM_206963 NM_002888, NM_206963

CCDS: CCDS3184, CCDS54665

Canonical transcript exons

ENST00000237696 — 6 exons

Exon	Start	End
ENSE00000801677	158710738	158710933
ENSE00001192529	158696892	158697827
ENSE00001192534	158697908	158697970
ENSE00001883911	158732140	158732457
ENSE00003486303	158704791	158704927
ENSE00003697725	158713797	158713859

Expression profiles

Bgee: expression breadth ubiquitous, 234 present calls, max score 99.74.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 18.0712 / max 1284.8399, expressed in 937 samples.

FANTOM5 promoters (8 alternative TSS)

Promoter ID	TPM avg	Samples expressed
45333	15.8010	762
45338	1.0537	443
45331	0.4438	246
45335	0.3220	148
45332	0.2425	128
45336	0.1549	81
45337	0.0429	13
45334	0.0104	2

Top tissues by expression

290 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
pericardium	UBERON:0002407	99.74	gold quality
palpebral conjunctiva	UBERON:0001812	99.45	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	99.14	gold quality
left uterine tube	UBERON:0001303	98.51	gold quality
germinal epithelium of ovary	UBERON:0001304	98.42	gold quality
nasal cavity mucosa	UBERON:0001826	97.98	gold quality
nasal cavity epithelium	UBERON:0005384	97.70	gold quality
omental fat pad	UBERON:0010414	97.49	gold quality
peritoneum	UBERON:0002358	97.48	gold quality
mucosa of stomach	UBERON:0001199	97.30	gold quality
urethra	UBERON:0000057	96.82	gold quality
parietal pleura	UBERON:0002400	96.81	gold quality
cauda epididymis	UBERON:0004360	96.79	gold quality
adipose tissue of abdominal region	UBERON:0007808	95.72	gold quality
minor salivary gland	UBERON:0001830	95.59	gold quality
right ovary	UBERON:0002118	95.43	gold quality
right atrium auricular region	UBERON:0006631	95.14	gold quality
caput epididymis	UBERON:0004358	95.13	gold quality
left ovary	UBERON:0002119	94.50	gold quality
mucosa of paranasal sinus	UBERON:0005030	94.19	gold quality
rectum	UBERON:0001052	94.02	gold quality
cardiac atrium	UBERON:0002081	93.92	gold quality
corpus epididymis	UBERON:0004359	93.87	gold quality
pleura	UBERON:0000977	93.63	gold quality
endocervix	UBERON:0000458	93.25	gold quality
tibial nerve	UBERON:0001323	93.22	gold quality
saliva-secreting gland	UBERON:0001044	93.04	gold quality
left coronary artery	UBERON:0001626	92.90	gold quality
upper lobe of left lung	UBERON:0008952	92.32	gold quality
coronary artery	UBERON:0001621	92.26	gold quality

Single-cell (SCXA)

Detected in 9 experiment(s), a significant marker in 9.

Experiment	Marker?	Max mean expression
E-CURD-114	yes	4836.65
E-GEOD-135922	yes	3665.96
E-HCAD-15	yes	2423.28
E-CURD-126	yes	2374.72
E-MTAB-8559	yes	2177.06
E-MTAB-10662	yes	1906.31
E-MTAB-10885	yes	359.20
E-HCAD-1	yes	82.37
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): CTCF, RARA

miRNA regulators (miRDB)

6 targeting RARRES1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3688-5P	99.12	69.67	1091
HSA-MIR-8070	99.07	69.30	1303
HSA-MIR-8066	99.05	68.66	1532
HSA-MIR-508-3P	98.66	69.62	887
HSA-MIR-891A-3P	98.05	67.99	970
HSA-MIR-6750-3P	96.79	67.50	740

Literature-anchored findings (GeneRIF, showing 35)

• Silencing of TIG1 promoter by hypermethylation is common in human cancers and may contribute to the loss of retinoic acid responsiveness in some neoplastic cells. (PMID:15059893)
• results show that inactivation of the retinoic acid signaling-associated genes RAR-beta, CRBP1, and TIG1 by DNA methylation occurs frequently in esophageal squamous cell carcinoma (PMID:16128742)
• Hypermethylation of tazarotene-induced gene 1 is associated with gastric carcinogenesis (PMID:16134180)
• TIG1 overexpression in SASC inhibited their differentiation into osteocytes and the expression of osteocalcin (PMID:19250291)
• Findings suggest that TIG1 may play a role in cellular proliferation and invasion in NPC cells and that its function may be dependent on the EBV status. (PMID:19737656)
• TIG1 undergoes frequent epigenetic inactivation due to aberrant DNA hypermethylation in gastric cancers. (PMID:19806788)
• The results of this study suggested that short RAI1 alleles might be releated to schizophreina disease. (PMID:21168224)
• RARRES1, its interacting partners AGBL2, Eg5/KIF11, another EEY-bearing protein (EB1), and the microtubule tyrosination cycle are important in tumorigenesis. (PMID:21303978)
• GRK5 mediates cell growth suppression by TIG1A. Thus, TIG1 may participate in the downregulation of G-protein coupled signaling by upregulating GRK5 expression. (PMID:21575264)
• TIG1 suppressed PGE2-stimulated Wnt and cAMP signaling pathways in colon cancer cells through GRK5. (PMID:22126303)
• genotype-associated hypermethylation of the ETS-family target gene RARRES1 influences methylation at its neighbor gene LXN and could be useful as a prognostic biomarker. (PMID:22573467)
• Knocking-down CTCF expression hampered RARRES1 expression. (PMID:22615834)
• Analysis of a standard liver fibrosis model (CCl(4)) demonstrated an early induction of RARRES1 mRNA and protein expression. (PMID:22669512)
• All-trans retinoic acid modulated secretion of RARRES1 in a dose dependent manner. (PMID:22942771)
• our data suggested that epigenetic silencing of TIG1 gene expression by promoter hypermethylation may play an important role in hepatocellular carcinoma . (PMID:24006221)
• High TIG1 expression is associated with inflammatory breast cancer through activation of Axl kinase. (PMID:24014597)
• Data show that retinoic acid receptor responder 1 (RARRES1) expression is subtype-dependent and regulated by DNA methylation and the expression of aldehyde dehydrogenase 1A3 (ALDH1A3). (PMID:27286452)
• Authors found that transmembrane protein 192 (TMEM192) interacted with TIG1. Authors also found that both TIG1A and TIG1B isoforms interacted and co-localized with TMEM192 in HtTA cervical cancer cells. The expression of TIG1 induced the expression of autophagy-related proteins. (PMID:27989102)
• Data suggest that Retinoic Acid Receptor Responder (RARRES1)/ Tazarotene-induced gene-1 (TIG-1) may serve as a target for therapeutic intervention both in cancer and in angiogenesis-related disorders. (PMID:28678839)
• Data demonstrated that RARRES1 expression is lost in choriocarcinoma tumors due to promotor hypermethylation. Also, further results hypothesized that RARRES1 might be a negative regulator of EMT through induction of contact inhibition. (PMID:29169400)
• TIG1 interacted with DNAJC8 in the cytosol, and this interaction completely blocked DNAJC8-mediated PKM2 translocation and inhibited glucose uptake. Furthermore, increased glycose uptake was observed in cells in which TIG1 was silenced. (PMID:29902837)
• Study demonstrates that RARRES1 depletion in epithelial cells caused a global increase in lipid synthesis. RARRES1-depleted cells rewire glucose metabolism by switching from aerobic glycolysis to glucose-dependent de novo lipogenesis. Treatment with fatty acid synthase inhibitor reversed the effects of RARRES1 depletion. (PMID:30557378)
• Investigated whether tazarotene-induced gene 1 protein (TIG1) affects the activity of urokinase plasminogen-type activator, which is negatively regulated by serine peptidase inhibitor Kazal type 2 (SPINK2), potentially preventing epithelial mesenchymal transition and suppressing cell migration and invasion. (PMID:31886233)
• Expression of RARRES1 and AGBL2 and progression of conventional renal cell carcinoma. (PMID:32307444)
• Soluble RARRES1 induces podocyte apoptosis to promote glomerular disease progression. (PMID:32634130)
• Cathepsin V Mediates the Tazarotene-induced Gene 1-induced Reduction in Invasion in Colorectal Cancer Cells. (PMID:32918681)
• Tazarotene-induced gene 1 interacts with Polo-like kinase 2 and inhibits cell proliferation in HCT116 colorectal cancer cells. (PMID:34314079)
• Autocrine and paracrine effects of a novel podocyte gene, RARRES1. (PMID:34556297)
• Involvement of miR-769-5p/Retinoic Acid Receptor Responder 1 Axis in the Progression of Osteosarcoma: Characterization of Potential Therapeutic Targets. (PMID:35152215)
• Interaction of RARRES1 with ICAM1 modulates macrophages to suppress the progression of kidney renal clear cell carcinoma. (PMID:36353618)
• GDF15 Mediates the Effect of Skeletal Muscle Contraction on Glucose-Stimulated Insulin Secretion. (PMID:37224335)
• TIG1 Inhibits the mTOR Signaling Pathway in Malignant Melanoma Through the VAC14 Protein. (PMID:37247911)
• Podocyte-derived soluble RARRES1 drives kidney disease progression through direct podocyte and proximal tubular injury. (PMID:38697478)
• RARRES1 identified by comprehensive bioinformatic analysis and experimental validation as a promising biomarker in Skin Cutaneous Melanoma. (PMID:38898266)
• Tazarotene-induced Gene 1 Induces Melanoma Cell Death by Triggering Endoplasmic Reticulum Stress Response. (PMID:38940043)

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Rarres1	ENSMUSG00000049404
rattus_norvegicus	Rarres1	ENSRNOG00000037853

Paralogs (1): LXN (ENSG00000079257)

Protein

Protein identifiers

Retinoic acid receptor responder protein 1 — P49788 (reviewed: P49788)

Alternative names: Phorbol ester-induced gene 1 protein, RAR-responsive protein TIG1, Tazarotene-induced gene 1 protein

All UniProt accessions (1): P49788

UniProt curated annotations — full annotation on UniProt →

Function. Inhibitor of the cytoplasmic carboxypeptidase AGBL2, may regulate the alpha-tubulin tyrosination cycle.

Subunit / interactions. Interacts with AGBL2, KIF11 and MAPRE1.

Subcellular location. Membrane. Secreted.

Tissue specificity. Detected in urine (at protein level).

Post-translational modifications. Not N-glycosylated. O-glycosylated; contains chondroitin sulfate.

Induction. By tazarotene and by all the retinoic acid receptors tested.

Similarity. Belongs to the protease inhibitor I47 (latexin) family.

Isoforms (2)

UniProt ID	Names	Canonical?
P49788-1	2	yes
P49788-2	1

RefSeq proteins (2): NP_002879, NP_996846* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR009684	Latexin	Family
IPR027261	TIG1	Family
IPR046350	Cystatin_sf	Homologous_superfamily
IPR049897	CYSTATIN_LXN	Domain

Pfam: PF06907

UniProt features (13 total): topological domain 2, sequence variant 2, domain 2, splice variant 2, chain 1, sequence conflict 1, transmembrane region 1, region of interest 1, glycosylation site 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P49788-F1	79.64	0.60

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Glycosylation sites (1): 40

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 156 (showing top): GSE18804_SPLEEN_MACROPHAGE_VS_COLON_TUMORAL_MACROPHAGE_UP, LI_PROSTATE_CANCER_EPIGENETIC, RIZKI_TUMOR_INVASIVENESS_3D_DN, SARRIO_EPITHELIAL_MESENCHYMAL_TRANSITION_DN, CHANDRAN_METASTASIS_DN, HINATA_NFKB_TARGETS_KERATINOCYTE_UP, MISSIAGLIA_REGULATED_BY_METHYLATION_UP, RUTELLA_RESPONSE_TO_CSF2RB_AND_IL4_UP, YANG_BREAST_CANCER_ESR1_DN, RIGGI_EWING_SARCOMA_PROGENITOR_DN, SCHLOSSER_SERUM_RESPONSE_DN, TURASHVILI_BREAST_DUCTAL_CARCINOMA_VS_DUCTAL_NORMAL_DN, NAKAMURA_TUMOR_ZONE_PERIPHERAL_VS_CENTRAL_DN, SMID_BREAST_CANCER_RELAPSE_IN_BRAIN_UP, MODULE_6

GO Biological Process (1): negative regulation of cell population proliferation (GO:0008285)

GO Molecular Function (3): metalloendopeptidase inhibitor activity (GO:0008191), protein binding (GO:0005515), peptidase inhibitor activity (GO:0030414)

GO Cellular Component (4): obsolete extracellular space (GO:0005615), membrane (GO:0016020), extracellular exosome (GO:0070062), extracellular region (GO:0005576)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	2
cell population proliferation	1
regulation of cell population proliferation	1
negative regulation of cellular process	1
metalloendopeptidase activity	1
endopeptidase inhibitor activity	1
binding	1
enzyme inhibitor activity	1
peptidase activity	1
peptidase regulator activity	1
extracellular vesicle	1

Protein interactions and networks

STRING

718 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
RARRES1	AGBL2	Q5U5Z8	697
RARRES1	CD38	P28907	636
RARRES1	CRABP2	P29373	617
RARRES1	RARA	P10276	613
RARRES1	TMEM192	Q8IY95	604
RARRES1	RARB	P10826	570
RARRES1	RARG	P13631	533
RARRES1	DHRS3	O75911	519
RARRES1	PLAAT4	Q9UL19	415
RARRES1	SNAPC4	Q5SXM2	400
RARRES1	SMYD5	Q6GMV2	384
RARRES1	EXOC1L	A0A1B0GW35	379
RARRES1	MEPE	Q9NQ76	352
RARRES1	BPIFB4	P59827	348
RARRES1	NREP	Q16612	347

IntAct

10 interactions, top by confidence:

A	B	Type	Score
SPINK2	RARRES1	psi-mi:“MI:0915”(physical association)	0.460
RARRES1	SPINK2	psi-mi:“MI:0915”(physical association)	0.460
SPINK2	RARRES1	psi-mi:“MI:0403”(colocalization)	0.460
GJB5	IGLL5	psi-mi:“MI:0914”(association)	0.350
METAP2	LAD1	psi-mi:“MI:0914”(association)	0.350
DAPP1	GAK	psi-mi:“MI:0914”(association)	0.350
RARRES1	ZNF609	psi-mi:“MI:0914”(association)	0.350

BioGRID (23): RARRES1 (Affinity Capture-MS), ZNF318 (Affinity Capture-MS), SULF2 (Affinity Capture-MS), RARRES1 (Affinity Capture-MS), RARRES1 (Affinity Capture-MS), WIZ (Affinity Capture-MS), EPS15 (Affinity Capture-MS), RAPGEF6 (Affinity Capture-MS), KHDRBS3 (Affinity Capture-MS), ZNF644 (Affinity Capture-MS), TPX2 (Affinity Capture-MS), ITPKC (Affinity Capture-MS), LRIG3 (Affinity Capture-MS), KHDRBS1 (Affinity Capture-MS), ZNF609 (Affinity Capture-MS)

ESM2 similar proteins: O19131, O70280, O95998, P19438, P29590, P49788, P50555, Q06VW1, Q0ZFW8, Q13477, Q27967, Q29108, Q29RH0, Q29RS5, Q2IAL6, Q2IAL7, Q2NKZ5, Q5DRQ8, Q5R551, Q5W186, Q62522, Q62740, Q68US5, Q6AZ51, Q6BAA4, Q6QLQ5, Q6UWN0, Q6WN34, Q6ZVW7, Q70TH4, Q711S8, Q76LW6, Q8BH06, Q8HDG8, Q8IZI9, Q8K1I3, Q8N1F8, Q8N907, Q8NAC3, Q8NFR9

Diamond homologs: P49788, P70202, Q64361, Q90YI1, Q9BS40

SIGNOR signaling

1 interactions.

A	Effect	B	Mechanism
CTCF	“up-regulates quantity by expression”	RARRES1	“transcriptional regulation”

Disease & clinical

Clinical variants and AI predictions

ClinVar

51 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	40
Likely benign	1
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

1287 predictions. Top by Δscore:

Variant	Effect	Δscore
3:158704790:CCCA:C	donor_gain	1.0000
3:158697796:C:CT	acceptor_gain	0.9900
3:158697824:TTTC:T	acceptor_gain	0.9900
3:158697825:TTCC:T	acceptor_loss	0.9900
3:158697826:TCCTA:T	acceptor_loss	0.9900
3:158697827:CCTAG:C	acceptor_loss	0.9900
3:158697828:C:CC	acceptor_gain	0.9900
3:158697828:C:G	acceptor_loss	0.9900
3:158697829:T:C	acceptor_loss	0.9900
3:158698056:G:A	donor_gain	0.9900
3:158698070:ACTG:A	donor_gain	0.9900
3:158698071:CTGC:C	donor_gain	0.9900
3:158698073:G:GA	donor_gain	0.9900
3:158699464:C:A	donor_gain	0.9900
3:158708220:T:TA	donor_gain	0.9900
3:158708244:T:TA	donor_gain	0.9900
3:158713790:AGCTT:A	donor_loss	0.9900
3:158713792:CTTA:C	donor_loss	0.9900
3:158713793:TTACC:T	donor_loss	0.9900
3:158713794:T:TA	donor_loss	0.9900
3:158713795:A:AG	donor_loss	0.9900
3:158713796:CCT:C	donor_gain	0.9900
3:158732031:C:A	donor_gain	0.9900
3:158732623:A:AC	donor_gain	0.9900
3:158697825:TTC:T	acceptor_gain	0.9800
3:158697971:C:CC	acceptor_gain	0.9800
3:158698070:A:AC	donor_gain	0.9800
3:158698071:C:CC	donor_gain	0.9800
3:158699463:C:CA	donor_gain	0.9800
3:158704789:AC:A	donor_gain	0.9800

AlphaMissense

1897 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
3:158713821:G:C	F105L	0.986
3:158713821:G:T	F105L	0.986
3:158713823:A:G	F105L	0.986
3:158697797:A:G	W256R	0.985
3:158697797:A:T	W256R	0.985
3:158704866:G:C	S199R	0.979
3:158704866:G:T	S199R	0.979
3:158704868:T:G	S199R	0.979
3:158732203:G:C	N71K	0.975
3:158732203:G:T	N71K	0.975
3:158697795:C:A	W256C	0.972
3:158697795:C:G	W256C	0.972
3:158713822:A:C	F105C	0.969
3:158713822:A:G	F105S	0.969
3:158704853:A:G	W204R	0.968
3:158704853:A:T	W204R	0.968
3:158704851:C:A	W204C	0.967
3:158704851:C:G	W204C	0.967
3:158710877:G:C	F132L	0.962
3:158710877:G:T	F132L	0.962
3:158710879:A:G	F132L	0.962
3:158697815:A:G	C250R	0.960
3:158710890:G:T	A128D	0.960
3:158710896:C:G	C126S	0.960
3:158710897:A:T	C126S	0.960
3:158710878:A:C	F132C	0.958
3:158710897:A:G	C126R	0.955
3:158732200:G:C	F72L	0.954
3:158732200:G:T	F72L	0.954
3:158732202:A:G	F72L	0.954

dbSNP variants (sampled 300 via entrez): RS1000002439 (3:158713531 CTCCCAGGGGTCCCAAGGAAGAGGGAGG>C), RS1000041900 (3:158719365 G>A), RS1000088176 (3:158697939 T>C,G), RS1000300190 (3:158701186 A>G), RS1000301221 (3:158729394 A>G), RS1000309893 (3:158715766 C>T), RS1000409050 (3:158707162 A>G), RS1000455646 (3:158722725 A>G), RS1000591663 (3:158730593 C>T), RS1000818676 (3:158702639 C>T), RS1000948684 (3:158716583 A>C,G,T), RS1000956645 (3:158711335 C>T), RS1000994098 (3:158723567 G>A), RS1001218072 (3:158726838 G>A), RS1001302579 (3:158711647 G>A)

Disease associations

OMIM: gene MIM:605090 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

4 associations (top):

Study	Trait	p-value
GCST006479_44	Diverticular disease	4.000000e-06
GCST006585_498	Blood protein levels	0.000000e+00
GCST007267_184	Systolic blood pressure	2.000000e-09
GCST007611_15	Chronic obstructive pulmonary disease or high blood pressure (pleiotropy)	1.000000e-09

EFO canonical traits (2, from GWAS)

EFO ID	Trait name
EFO:0009959	diverticular disease
EFO:0006335	systolic blood pressure

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

72 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	decreases expression, affects expression, increases expression, affects cotreatment	6
sodium arsenite	decreases expression, increases expression	4
bisphenol A	increases expression, affects cotreatment, decreases expression	3
trichostatin A	increases expression, affects cotreatment, affects expression, affects methylation, decreases expression	2
Decitabine	affects cotreatment, affects expression, affects methylation, decreases expression, decreases reaction	2
Acetaminophen	decreases expression	2
Benzo(a)pyrene	affects methylation, decreases methylation	2
Calcitriol	increases expression	2
Dexamethasone	increases expression, decreases expression, affects cotreatment	2
Progesterone	affects cotreatment, decreases expression, increases expression	2
Smoke	decreases expression, increases abundance, increases expression	2
Aflatoxin B1	decreases expression, increases methylation, decreases reaction	2
aristolochic acid I	increases expression	1
4-oxoretinoic acid	increases expression	1
urushiol	increases expression	1
methylmercuric chloride	decreases expression	1
apocarotenal	increases expression	1
pirinixic acid	affects binding, increases activity, increases expression	1
sodium arsenate	decreases expression, increases abundance	1
2,5,2’,5’-tetrachlorobiphenyl	decreases expression	1
3,4-dichloroaniline	increases expression	1
cobaltous chloride	decreases expression	1
butyraldehyde	decreases expression	1
16 alpha-ethyl-21-hydroxy-19-nor-4-pregnene-3,20-dione	increases expression	1
perfluorooctanoic acid	increases expression	1
potassium chromate(VI)	decreases expression, affects cotreatment	1
aflatoxin B2	increases methylation	1
cupric chloride	decreases expression	1
S-(1,2-dichlorovinyl)cysteine	affects response to substance, increases expression	1
4-oxoretinol	increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.