RARRES2

Summary

RARRES2 (retinoic acid receptor responder 2, HGNC:9868) is a protein-coding gene on chromosome 7q36.1, encoding Retinoic acid receptor responder protein 2 (Q99969). Adipocyte-secreted protein (adipokine) that regulates adipogenesis, metabolism and inflammation through activation of the chemokine-like receptor 1 (CMKLR1).

This gene encodes a secreted chemotactic protein that initiates chemotaxis via the ChemR23 G protein-coupled seven-transmembrane domain ligand. Expression of this gene is upregulated by the synthetic retinoid tazarotene and occurs in a wide variety of tissues. The active protein has several roles, including that as an adipokine and as an antimicrobial protein with activity against bacteria and fungi.

Source: NCBI Gene 5919 — RefSeq curated summary.

At a glance

• GWAS associations: 7
• Clinical variants (ClinVar): 39 total
• MANE Select transcript: NM_002889

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:9868
Approved symbol	RARRES2
Name	retinoic acid receptor responder 2
Location	7q36.1
Locus type	gene with protein product
Status	Approved
Aliases	TIG2, HP10433
Ensembl gene	ENSG00000106538
Ensembl biotype	protein_coding
OMIM	601973
Entrez	5919

Gene structure

Transcript identifiers

Ensembl transcripts: 35 — 34 protein_coding, 1 retained_intron

ENST00000223271, ENST00000466675, ENST00000467793, ENST00000478771, ENST00000482669, ENST00000863321, ENST00000863322, ENST00000863323, ENST00000863324, ENST00000863325, ENST00000863326, ENST00000863327, ENST00000863328, ENST00000863329, ENST00000863330, ENST00000863331, ENST00000863332, ENST00000863333, ENST00000863334, ENST00000863335, ENST00000863336, ENST00000863337, ENST00000863338, ENST00000863339, ENST00000863340, ENST00000863341, ENST00000863342, ENST00000911588, ENST00000911589, ENST00000911590, ENST00000911591, ENST00000911592, ENST00000911593, ENST00000964558, ENST00000964559

RefSeq mRNA: 1 — MANE Select: NM_002889 NM_002889

CCDS: CCDS5902

Canonical transcript exons

ENST00000223271 — 6 exons

Exon	Start	End
ENSE00000729821	150340100	150340204
ENSE00000872353	150340436	150340629
ENSE00000872355	150338329	150338439
ENSE00001022309	150341578	150341629
ENSE00003540938	150338615	150338741
ENSE00003589888	150338986	150339081

Expression profiles

Bgee: expression breadth ubiquitous, 276 present calls, max score 99.91.

FANTOM5 (CAGE): breadth broad, TPM avg 36.6046 / max 1804.9915, expressed in 761 samples.

FANTOM5 promoters (7 alternative TSS)

Promoter ID	TPM avg	Samples expressed
86782	34.6272	744
86781	0.9714	203
86775	0.5275	184
86778	0.2246	86
205000	0.1301	75
86776	0.1007	58
86777	0.0231	6

Top tissues by expression

295 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
right adrenal gland cortex	UBERON:0035827	99.91	gold quality
left adrenal gland cortex	UBERON:0035825	99.90	gold quality
right adrenal gland	UBERON:0001233	99.89	gold quality
left adrenal gland	UBERON:0001234	99.89	gold quality
adrenal cortex	UBERON:0001235	99.88	gold quality
right lobe of liver	UBERON:0001114	99.75	gold quality
left ovary	UBERON:0002119	99.53	gold quality
right ovary	UBERON:0002118	99.50	gold quality
endocervix	UBERON:0000458	99.48	gold quality
left uterine tube	UBERON:0001303	99.46	gold quality
body of pancreas	UBERON:0001150	99.42	gold quality
liver	UBERON:0002107	99.42	gold quality
body of uterus	UBERON:0009853	99.40	gold quality
adrenal gland	UBERON:0002369	99.38	gold quality
tibial nerve	UBERON:0001323	99.27	gold quality
muscle layer of sigmoid colon	UBERON:0035805	99.25	gold quality
upper lobe of left lung	UBERON:0008952	99.09	gold quality
adipose tissue of abdominal region	UBERON:0007808	99.08	gold quality
omental fat pad	UBERON:0010414	99.06	gold quality
peritoneum	UBERON:0002358	99.05	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	99.03	gold quality
right lung	UBERON:0002167	98.97	gold quality
metanephros cortex	UBERON:0010533	98.95	gold quality
lower esophagus muscularis layer	UBERON:0035833	98.95	gold quality
lower esophagus	UBERON:0013473	98.94	gold quality
upper lobe of lung	UBERON:0008948	98.91	gold quality
mucosa of stomach	UBERON:0001199	98.89	gold quality
germinal epithelium of ovary	UBERON:0001304	98.86	gold quality
ectocervix	UBERON:0012249	98.75	gold quality
right uterine tube	UBERON:0001302	98.73	gold quality

Single-cell (SCXA)

Detected in 35 experiment(s), a significant marker in 32.

Experiment	Marker?	Max mean expression
E-MTAB-6653	yes	5199.03
E-HCAD-11	yes	3668.96
E-CURD-126	yes	3075.17
E-MTAB-8530	yes	2452.79
E-MTAB-10283	yes	2069.51
E-MTAB-8221	yes	1762.10
E-MTAB-6308	yes	1721.17
E-HCAD-15	yes	1529.23
E-MTAB-10287	yes	1079.05
E-GEOD-125970	yes	804.79
E-GEOD-84465	yes	762.08
E-MTAB-5061	yes	731.10
E-MTAB-10018	yes	227.85
E-MTAB-3929	yes	162.64
E-MTAB-6701	yes	125.37

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): KLF15, NR1D1, NR1H4, NR2E3, NR3C2, PPARG

miRNA regulators (miRDB)

6 targeting RARRES2, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4795-3P	100.00	74.62	4024
HSA-MIR-4731-5P	99.89	67.23	2537
HSA-MIR-646	99.68	67.84	1645
HSA-MIR-4505	99.27	67.81	2678
HSA-MIR-5787	99.22	67.86	2628
HSA-MIR-2681-3P	98.18	65.28	577

Literature-anchored findings (GeneRIF, showing 40)

• Chemerin is a chemotactic agent and ligand of CMKLR1 (ChemR23). The CMKLR1/chemerin axis may play a key role in directing plasmacytoid monocyte-derived dendritic cell trafficking. (PMID:15728234)
• degranulated PMNs release proteases that efficiently convert prochemerin into active chemerin (PMID:15972683)
• chemerin is activated by serine proteases of the coagulation, fibrinolytic, and inflammatory cascades (PMID:16096270)
• chemerin is a novel adipose-derived signaling molecule that regulates adipogenesis and adipocyte metabolism (PMID:17635925)
• These data establish that chemerin is a novel adipokine that regulates adipocyte function. (PMID:18242188)
• Results identify chemerin as a natural nonsignaling protein ligand for both human and mouse CCRL2. (PMID:18794339)
• TIG2-protein and transcript were detected in all layers of normal epidermis and uninvolved skin adjacent to SCC lesions. (PMID:18955196)
• circulating carboxypeptidase N/ carboxypeptidase B and platelets may potentially contribute to regulating the bioactivity of leukocyte chemoattractant chemerin (PMID:19010784)
• Chemerin expression specifically marks the early phases of evolving skin psoriatic lesions and is temporally strictly associated with plasmacytoid dendritic cells. (PMID:19114666)
• Magnetic resonance imaging-quantified visceral fat mass was associated with RARRES2 SNP rs17173608 and nominally associated with RARRES2 SNP rs10278590 in nonobese subjects, with carriers of the minor alleles displaying lower visceral adipose tissue mass (PMID:19303973)
• Epithelial cells in fetal intestine produce chemerin to recruit macrophages. (PMID:19443732)
• Circulating chemerin levels were associated with metabolic syndrome phenotypes in a second, unrelated human population. (PMID:19470637)
• differences in the distribution of NK cells and pDC in skin lesions suggest that recruitment of both NK cells and pDC is unlikely to be controlled solely by chemerin (PMID:19543554)
• Elevated systemic levels of chemerin in obesity and type 2 diabetes seem to be associated with inflammation rather than body mass index. (PMID:19558533)
• Circulating levels of chemerin are higher in ulcerative colitis and Crohn’s disease. (PMID:19714754)
• Adipocyte-derived secretion of chemerin may be involved in the negative cross talk between adipose tissue and skeletal muscle contributing to the negative relationship between obesity and insulin sensitivity. (PMID:19720798)
• Data demonstrate that markers of renal function are independently related to circulating chemerin levels. (PMID:19837789)
• Serum chemerin concentration was significantly higher in non-alcoholic fatty liver disease patients. (PMID:20095887)
• Plasma chemerin levels are significantly heritable and are identify a novel role for chemerin as a stimulator of angiogenesis. (PMID:20237162)
• This study suggests that chemerin might mediate metabolic alterations in obesity, drastically improving after gastric bypass. (PMID:20375212)
• potential link of chemerin with the pathogenesis of insulin resistance, obesity, and metabolic syndrome (PMID:20601896)
• The dual role of chemerin in inflammation and metabolism might provide a link between chronic inflammation and obesity, as well as obesity-related disorders such as type 2 diabetes and cardiovascular disease. (PMID:20817486)
• Elevated systemic levels of chemerin and leptin in psoriasis seem to be associated not only with metabolic syndrome risk factors but also with psoriasis. (PMID:20822885)
• Data show that comparing to T2D the IFG subjects had higher serum chemerin, progranulin, fetuin-A and RBP4 levels which was not detectable in the comparison of the T2D and IGT group. (PMID:21085476)
• Serum chemerin levels are strongly associated with renal function in diabetic patients. (PMID:21144611)
• These results demonstrate that human chondrocytes express both the receptor ChemR23 and the ligand chemerin…which may play pivotal roles in joint inflammation. (PMID:21192818)
• The ChemR23/Chemerin axis may have a role in the recruitment of dendritic cells within the kidney in patients affected by lupus nephritis. (PMID:21346723)
• maternal chemerin serum concentrations are significantly increased in preeclampsia during and after pregnancy (PMID:21477622)
• Serum chemerin levels were significantly elevated in metabolic syndrome patients with coronary artery disease (CAD) compared to in those without CAD and healthy subjects. (PMID:21576834)
• Cathepsin L- and K-cleaved chemerin trigger robust migration of human blood-derived plasmacytoid dendritic cells ex vivo (PMID:21715684)
• Data indicating a possible role of leptin, adiponectin, visfatin, chemerin and vaspin in the pathogenesis of chronic hepatitis are summarized. (PMID:21738955)
• Chemerin may be a mediator that links visceral obesity to cardiovascular risk factors. (PMID:21895733)
• chemerin undergoes extensive proteolytic processing in vivo, underlining the importance of measuring individual isoforms. (PMID:21930706)
• the necessity of appropriate C-terminal proteolytic processing to generate the likely physiologic form of active chemerin, chem157S, and suggested a possible role in malignant GBM. (PMID:21949124)
• Chemerin and ChemR23 were highly expressed in the rheumatoid arthritis synovium compared with osteoarthritis. (PMID:21959042)
• Expressions of chemerin mRNA and protein are significantly higher in epicardial adipose tissue of Han Chinese patients who have atherosclerosis. (PMID:21981776)
• Human synovial fibroblasts express both chemerin and its receptor. Chemerin enhanced expression of TLR4 and induced release of CCL2 in synovial fibroblasts. (PMID:22037282)
• Data suggest that serum chemerin levels are increased with increases in the number of diseased vessels in subjects with coronary artery disease in China. (PMID:22042485)
• High circulating chemerin level is correlated with arterial stiffness. (PMID:22104178)
• Chemerin levels are significantly increased in preeclampsia and independently associated with markers of dyslipidemia and with the severity of the preeclampsia (PMID:22117111)

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Rarres2	ENSMUSG00000009281
rattus_norvegicus	Rarres2	ENSRNOG00000024705

Protein

Protein identifiers

Retinoic acid receptor responder protein 2 — Q99969 (reviewed: Q99969)

Alternative names: Chemerin, RAR-responsive protein TIG2, Tazarotene-induced gene 2 protein

All UniProt accessions (3): Q99969, A0A090N7U9, C9J8S2

UniProt curated annotations — full annotation on UniProt →

Function. Adipocyte-secreted protein (adipokine) that regulates adipogenesis, metabolism and inflammation through activation of the chemokine-like receptor 1 (CMKLR1). Also acts as a ligand for CMKLR2. Can also bind to C-C chemokine receptor-like 2 (CCRL2), but with a lower affinity than it does to CMKLR1 or CMKLR2. Positively regulates adipocyte differentiation, modulates the expression of adipocyte genes involved in lipid and glucose metabolism and might play a role in angiogenesis, a process essential for the expansion of white adipose tissue. Also acts as a pro-inflammatory adipokine, causing an increase in secretion of pro-inflammatory and prodiabetic adipokines, which further impair adipose tissue metabolic function and have negative systemic effects including impaired insulin sensitivity, altered glucose and lipid metabolism, and a decrease in vascular function in other tissues. Can have both pro- and anti-inflammatory properties depending on the modality of enzymatic cleavage by different classes of proteases. Acts as a chemotactic factor for leukocyte populations expressing CMKLR1, particularly immature plasmacytoid dendritic cells, but also immature myeloid DCs, macrophages and natural killer cells. Exerts an anti-inflammatory role by preventing TNF/TNFA-induced VCAM1 expression and monocytes adhesion in vascular endothelial cells. The effect is mediated via inhibiting activation of NF-kappa-B and CRK/p38 through stimulation of AKT1/NOS3 signaling and nitric oxide production. Its dual role in inflammation and metabolism might provide a link between chronic inflammation and obesity, as well as obesity-related disorders such as type 2 diabetes and cardiovascular disease. Exhibits an antimicrobial function in the skin.

Subcellular location. Secreted.

Tissue specificity. Expressed at the highest levels in placenta, liver, and white adipose tissue (WAT), and to a lesser extent in many other tissues such as lung, brown adipose tissue, heart, ovary, kidney, skeletal muscle and pancreas. Within WAT, expression is enriched in adipocytes as compared to the stromal vascular fraction. Expression and secretion increases dramatically with adipogenesis. Highly expressed in skin (basal and suprabasal layers of the epidermis, hair follicles and endothelial cells). Expression is elevated in numerous metabolic and inflammatory diseases including psoriasis, obesity, type 2 diabetes, metabolic syndrome and cardiovascular disease.

Post-translational modifications. Secreted in an inactive precursor form, prochemerin, which is proteolytically processed by a variety of extracellular proteases to generate forms with differing levels of bioactivity. For example, the removal of six amino acids results in chemerin-157, which exhibits the highest activity, while removal of seven amino acids results in chemerin-156 which has slightly less activity. Some proteases are able to cleave at more than one site and chemerin forms may be sequentially processed by different enzymes to modulate activity levels. The coordinated expression and activity of chemerin-modifying enzymes is essential for regulating its bioactivation, inactivation and, consequently, biological function. Cathepsin G cleaves seven C-terminal amino acids from prochemerin (chemerin-156), elastase is able to cleave six (chemerin-157), eight (chemerin-155) or eleven (chemerin-152), plasmin cleaves five amino acids (chemerin-158), and tryptase cleaves five (chemerin-158) or eight (chemerin-155). Multiple cleavages might be required to fully activate chemerin, with an initial tryptase cleavage resulting in chemerin with low activity (chemerin-158), and a second cleavage by carboxypeptidase N or B producing highly active chemerin (chemerin-157).

Induction. Inhibited in psoriatic lesions. Activated by tazarotene in skin rafts and in the epidermis of psoriatic lesions.

RefSeq proteins (1): NP_002880* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR029562	Chemerin	Family
IPR046350	Cystatin_sf	Homologous_superfamily

UniProt features (18 total): strand 6, helix 4, disulfide bond 3, turn 2, signal peptide 1, chain 1, propeptide 1

Structure

Experimental structures (PDB)

12 structures.

PDB	Method	Resolution (Å)
7YKD	ELECTRON MICROSCOPY	2.81
8JJP	ELECTRON MICROSCOPY	2.9
8SG1	ELECTRON MICROSCOPY	2.94
8ZJG	ELECTRON MICROSCOPY	3.18
9UYI	ELECTRON MICROSCOPY	3.2
8XGM	ELECTRON MICROSCOPY	3.29
9UYH	ELECTRON MICROSCOPY	3.3
9UYJ	ELECTRON MICROSCOPY	3.3
9UYL	ELECTRON MICROSCOPY	3.3
9L3W	ELECTRON MICROSCOPY	3.5
9UYM	ELECTRON MICROSCOPY	3.5
9L3Y	ELECTRON MICROSCOPY	3.6

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q99969-F1	86.58	0.65

Antibody-complex structures (SAbDab): 10 — 7YKD, 8JJP, 8SG1, 8XGM, 8ZJG, 9UYH, 9UYI, 9UYJ, 9UYL, 9UYM

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Disulfide bonds (3): 77–87, 98–117, 101–135

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-114608	Platelet degranulation

MSigDB gene sets: 260 (showing top): GSE45365_CD8A_DC_VS_CD11B_DC_IFNAR_KO_DN, GSE45365_HEALTHY_VS_MCMV_INFECTION_CD8_TCELL_IFNAR_KO_DN, GOBP_RESPONSE_TO_NITROGEN_COMPOUND, GOBP_REGULATION_OF_FAT_CELL_DIFFERENTIATION, GOBP_REGULATION_OF_PROTEIN_BINDING, BENPORATH_ES_WITH_H3K27ME3, GOBP_ANTIMICROBIAL_HUMORAL_RESPONSE, GRUETZMANN_PANCREATIC_CANCER_DN, GOBP_REGULATION_OF_BLOOD_PRESSURE, GOBP_MYELOID_LEUKOCYTE_MIGRATION, GOBP_CIRCULATORY_SYSTEM_PROCESS, GOBP_CELL_CHEMOTAXIS, GOBP_REGULATION_OF_PHOSPHORYLATION, GOBP_INFLAMMATORY_RESPONSE, YAO_HOXA10_TARGETS_VIA_PROGESTERONE_UP

GO Biological Process (22): retinoid metabolic process (GO:0001523), positive regulation of protein phosphorylation (GO:0001934), positive regulation of systemic arterial blood pressure (GO:0003084), chemotaxis (GO:0006935), inflammatory response (GO:0006954), insulin receptor signaling pathway (GO:0008286), positive regulation of macrophage chemotaxis (GO:0010759), response to activity (GO:0014823), antifungal humoral response (GO:0019732), cell differentiation (GO:0030154), innate immune response (GO:0045087), positive regulation of fat cell differentiation (GO:0045600), embryonic digestive tract development (GO:0048566), defense response to Gram-negative bacterium (GO:0050829), defense response to Gram-positive bacterium (GO:0050830), positive regulation of chemotaxis (GO:0050921), regulation of lipid catabolic process (GO:0050994), antifungal innate immune response (GO:0061760), response to caloric restriction (GO:0061771), response to nutrient levels (GO:0031667), developmental process (GO:0032502), cellular response to insulin stimulus (GO:0032869)

GO Molecular Function (2): signaling receptor binding (GO:0005102), protein binding (GO:0005515)

GO Cellular Component (4): extracellular region (GO:0005576), obsolete extracellular space (GO:0005615), extracellular matrix (GO:0031012), platelet dense granule lumen (GO:0031089)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Response to elevated platelet cytosolic Ca2+	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
response to stimulus	2
defense response to fungus	2
defense response to bacterium	2
diterpenoid metabolic process	1
regulation of protein phosphorylation	1
protein phosphorylation	1
positive regulation of protein modification process	1
positive regulation of phosphorylation	1
regulation of systemic arterial blood pressure	1
positive regulation of blood pressure	1
response to chemical	1
taxis	1
defense response	1
cell surface receptor protein tyrosine kinase signaling pathway	1
cellular response to insulin stimulus	1
positive regulation of leukocyte chemotaxis	1
regulation of macrophage chemotaxis	1
macrophage chemotaxis	1
regulation of granulocyte chemotaxis	1
positive regulation of macrophage migration	1
antimicrobial humoral response	1
cellular developmental process	1
immune response	1
defense response to symbiont	1
fat cell differentiation	1
positive regulation of cell differentiation	1
regulation of fat cell differentiation	1
digestive tract development	1
embryonic organ development	1
chemotaxis	1
positive regulation of response to external stimulus	1
positive regulation of locomotion	1
regulation of chemotaxis	1
regulation of catabolic process	1
lipid catabolic process	1
regulation of lipid metabolic process	1
innate immune response	1
response to stress	1
response to nutrient levels	1
protein binding	1

Protein interactions and networks

STRING

1098 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
RARRES2	CMKLR1	Q99788	999
RARRES2	CCRL2	O00421	996
RARRES2	CMKLR2	P46091	996
RARRES2	LTB4R	Q15722	841
RARRES2	ITLN1	Q8WWA0	790
RARRES2	SERPINA12	Q8IW75	790
RARRES2	NAMPT	P43490	784
RARRES2	RETN	Q9HD89	773
RARRES2	ADIPOQ	Q15848	773
RARRES2	RETNLB	Q9BQ08	771
RARRES2	APLN	Q9ULZ1	760
RARRES2	LEP	P41159	720
RARRES2	ADIPOR2	Q86V24	692
RARRES2	CRP	P02741	683
RARRES2	RBP4	P02753	657

IntAct

4 interactions, top by confidence:

A	B	Type	Score
RARRES2	TNFSF9	psi-mi:“MI:0915”(physical association)	0.500
	CD5L	psi-mi:“MI:0915”(physical association)	0.400
RARRES2	HLA-DPB1	psi-mi:“MI:0914”(association)	0.350

BioGRID (4): TUBB8 (Affinity Capture-MS), CDKN2D (Affinity Capture-MS), TNFSF9 (Affinity Capture-MS), HLA-DPB1 (Affinity Capture-MS)

ESM2 similar proteins: A8WCC4, O19011, O35757, O88273, O95715, P01137, P03970, P04202, P07200, P07995, P08476, P09533, P17246, P18331, P18341, P27092, P43032, P49767, P50414, P50555, P54831, P55102, P58658, P58659, P97953, Q04998, Q29108, Q29RS5, Q38HS2, Q5R551, Q60GF7, Q62522, Q68US5, Q6WN34, Q6X2S4, Q8CI19, Q8HDG8, Q8TBF5, Q99969, Q99LV7

Diamond homologs: Q29RS5, Q5R551, Q8HDG8, Q99969, Q9DD06

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

39 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	16
Likely benign	2
Benign	2

Top pathogenic / likely-pathogenic (0)

SpliceAI

1036 predictions. Top by Δscore:

Variant	Effect	Δscore
7:150339077:TTCCT:T	acceptor_gain	1.0000
7:150339078:TCCT:T	acceptor_gain	1.0000
7:150339079:CCTC:C	acceptor_gain	1.0000
7:150339080:CT:C	acceptor_gain	1.0000
7:150339082:C:CC	acceptor_gain	1.0000
7:150340432:TCA:T	donor_loss	1.0000
7:150340433:CAC:C	donor_loss	1.0000
7:150340434:A:AC	donor_gain	1.0000
7:150340434:A:T	donor_loss	1.0000
7:150340435:C:CA	donor_gain	1.0000
7:150341571:T:TA	donor_gain	1.0000
7:150341583:T:TA	donor_gain	1.0000
7:150341603:C:A	donor_gain	1.0000
7:150341619:G:C	donor_gain	1.0000
7:150338435:CATCT:C	acceptor_gain	0.9900
7:150338438:CT:C	acceptor_gain	0.9900
7:150338440:C:CC	acceptor_gain	0.9900
7:150338628:G:C	donor_gain	0.9900
7:150338980:TCTTA:T	donor_loss	0.9900
7:150338982:TTACC:T	donor_loss	0.9900
7:150338983:TACC:T	donor_loss	0.9900
7:150338984:A:AC	donor_gain	0.9900
7:150338984:AC:A	donor_gain	0.9900
7:150338985:C:A	donor_loss	0.9900
7:150338985:C:CC	donor_gain	0.9900
7:150338985:CC:C	donor_gain	0.9900
7:150338985:CCCG:C	donor_gain	0.9900
7:150339078:TCCTC:T	acceptor_loss	0.9900
7:150339081:TC:T	acceptor_loss	0.9900
7:150339082:CT:C	acceptor_loss	0.9900

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000391241 (7:150340395 G>A,T), RS1000717158 (7:150339290 A>G), RS1000769980 (7:150339522 T>C), RS1001187217 (7:150342200 G>A), RS1001728076 (7:150342427 C>T), RS1002994079 (7:150341334 C>T), RS1003194925 (7:150339721 G>A), RS1003267429 (7:150341070 C>A,T), RS1004230995 (7:150341268 C>G), RS1004379740 (7:150338810 TCCTCCACATCC>T,TCCTCCACATCCCCTCCACATCC), RS1004555852 (7:150340124 G>A,T), RS1004670384 (7:150339826 G>A,C,T), RS1005115672 (7:150341371 A>AT), RS1005506063 (7:150339791 C>T), RS1006563182 (7:150337844 G>A,C,T)

Disease associations

OMIM: gene MIM:601973 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

7 associations (top):

Study	Trait	p-value
GCST002503_1	Suicide attempts in depression or bipolar disorder	2.000000e-07
GCST004389_4	Circulating chemerin levels	3.000000e-08
GCST004389_5	Circulating chemerin levels	2.000000e-10
GCST006585_2366	Blood protein levels	9.000000e-46
GCST006624_25	Systolic blood pressure	3.000000e-10
GCST007900_1	Chemerin levels	2.000000e-21
GCST012031_1	Chemerin levels	4.000000e-35

EFO canonical traits (3, from GWAS)

EFO ID	Trait name
EFO:0004321	attempted suicide
EFO:0004573	chemerin measurement
EFO:0006335	systolic blood pressure

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

53 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	increases expression, decreases expression, affects cotreatment	5
Tetrachlorodibenzodioxin	affects cotreatment, increases expression	4
Cyclosporine	decreases expression	4
Estradiol	decreases expression, affects cotreatment	3
bisphenol A	decreases expression, decreases reaction, decreases secretion, affects expression	2
entinostat	increases expression, affects cotreatment	2
belinostat	increases expression, affects cotreatment	2
Panobinostat	affects cotreatment, increases expression	2
Air Pollutants	increases expression, decreases expression, increases abundance	2
Benzo(a)pyrene	affects methylation, increases expression, increases methylation	2
Smoke	increases abundance, increases expression	2
Tobacco Smoke Pollution	affects expression, increases expression	2
methylmercuric chloride	increases expression	1
tris(2-butoxyethyl) phosphate	affects expression	1
beta-lapachone	decreases expression	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
tetrabromobisphenol A	decreases expression, decreases reaction, decreases secretion	1
perfluorooctanoic acid	decreases expression	1
tetrachlorodian	decreases expression, decreases reaction, decreases secretion	1
CGP 52608	affects binding, increases reaction	1
K 7174	decreases expression	1
2-chloro-5-nitrobenzanilide	decreases expression, decreases reaction, decreases secretion	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
torcetrapib	decreases reaction, increases expression	1
dorsomorphin	affects cotreatment, increases expression	1
NSC 74859	decreases reaction, increases expression	1
eprenetapopt	affects expression, affects reaction	1
licochalcone B	decreases expression	1
MK 2206	decreases reaction, decreases secretion, increases expression, affects binding, increases secretion (+1 more)	1
setanaxib	decreases reaction, increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.