RB1

Summary

RB1 (RB transcriptional corepressor 1, HGNC:9884) is a protein-coding gene on chromosome 13q14.2, encoding Retinoblastoma-associated protein (P06400). Tumor suppressor that is a key regulator of the G1/S transition of the cell cycle. In precision oncology, RB1 Mutation confers sensitivity to Chemotherapy in Lung Small Cell Carcinoma (CIViC Level B); 14 further curated variant–drug associations are listed below. It is haploinsufficient (ClinGen: sufficient evidence).

The protein encoded by this gene is a negative regulator of the cell cycle and was the first tumor suppressor gene found. The encoded protein also stabilizes constitutive heterochromatin to maintain the overall chromatin structure. The active, hypophosphorylated form of the protein binds transcription factor E2F1. Defects in this gene are a cause of childhood cancer retinoblastoma (RB), bladder cancer, and osteogenic sarcoma.

Source: NCBI Gene 5925 — RefSeq curated summary.

At a glance

• Gene–disease (curated): retinoblastoma (Definitive, ClinGen) — +2 more curated relationships
• GWAS associations: 8
• Clinical variants (ClinVar): 4,594 total — 838 pathogenic, 93 likely-pathogenic
• Phenotypes (HPO): 58
• Druggable target: yes — 1 molecules with ChEMBL bioactivity
• Precision-oncology evidence (CIViC): 15 curated variant–drug associations
• Cancer driver (intOGen): loss-of-function (tumor-suppressor-like) across 33 cancer types
• Dosage sensitivity (ClinGen): haploinsufficiency sufficient evidence, triplosensitivity no evidence
• Transcription factor: yes — 34 downstream targets (CollecTRI)
• MANE Select transcript: NM_000321

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:9884
Approved symbol	RB1
Name	RB transcriptional corepressor 1
Location	13q14.2
Locus type	gene with protein product
Status	Approved
Aliases	RB, PPP1R130
Ensembl gene	ENSG00000139687
Ensembl biotype	protein_coding
OMIM	614041
Entrez	5925

Gene structure

Transcript identifiers

Ensembl transcripts: 17 — 11 protein_coding, 2 nonsense_mediated_decay, 2 protein_coding_CDS_not_defined, 2 retained_intron

ENST00000267163, ENST00000467505, ENST00000480491, ENST00000484879, ENST00000525036, ENST00000531171, ENST00000643064, ENST00000646097, ENST00000650461, ENST00000713856, ENST00000713857, ENST00000713858, ENST00000713859, ENST00000859510, ENST00000859511, ENST00000924352, ENST00000941076

RefSeq mRNA: 5 — MANE Select: NM_000321 NM_000321, NM_001407165, NM_001407166, NM_001407167, NM_001407168

CCDS: CCDS31973

Canonical transcript exons

ENST00000267163 — 27 exons

Exon	Start	End
ENSE00000939670	48362815	48362957
ENSE00000939671	48364894	48364971
ENSE00000939672	48367494	48367603
ENSE00000939673	48368527	48368604
ENSE00000939674	48373405	48373492
ENSE00000939675	48376918	48377034
ENSE00000939676	48379594	48379650
ENSE00000939677	48380053	48380084
ENSE00000939678	48380165	48380241
ENSE00000939679	48381247	48381443
ENSE00000939681	48456204	48456349
ENSE00000939682	48459688	48459833
ENSE00000939683	48463731	48463835
ENSE00000939684	48464998	48465111
ENSE00000939685	48465205	48465368
ENSE00001003962	48473360	48473390
ENSE00001241067	48479998	48481890
ENSE00003461315	48360017	48360127
ENSE00003469272	48307280	48307406
ENSE00003474733	48348956	48349023
ENSE00003494338	48345080	48345199
ENSE00003541600	48476701	48476843
ENSE00003588059	48342599	48342714
ENSE00003599424	48452993	48453111
ENSE00003621237	48347825	48347863
ENSE00003641827	48477355	48477404
ENSE00003816215	48303751	48304049

Expression profiles

Bgee: expression breadth ubiquitous, 287 present calls, max score 97.39.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 27.8637 / max 245.0555, expressed in 1807 samples.

FANTOM5 promoters (7 alternative TSS)

Promoter ID	TPM avg	Samples expressed
135062	15.3498	1779
135059	5.8927	1655
135060	2.8766	1384
135061	1.9697	1032
135067	1.1289	208
135063	0.4554	220
135066	0.1906	76

Top tissues by expression

296 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
epithelium of nasopharynx	UBERON:0001951	97.39	gold quality
choroid plexus epithelium	UBERON:0003911	97.16	gold quality
visceral pleura	UBERON:0002401	96.50	gold quality
germinal epithelium of ovary	UBERON:0001304	96.24	gold quality
gingival epithelium	UBERON:0001949	96.09	gold quality
pleura	UBERON:0000977	95.70	gold quality
palpebral conjunctiva	UBERON:0001812	95.70	gold quality
parietal pleura	UBERON:0002400	95.67	gold quality
seminal vesicle	UBERON:0000998	95.58	gold quality
eye	UBERON:0000970	94.91	gold quality
mucosa of paranasal sinus	UBERON:0005030	94.83	gold quality
Brodmann (1909) area 23	UBERON:0013554	94.77	gold quality
gingiva	UBERON:0001828	94.07	gold quality
trabecular bone tissue	UBERON:0002483	94.05	gold quality
jejunal mucosa	UBERON:0000399	94.03	gold quality
jejunum	UBERON:0002115	94.03	gold quality
tibia	UBERON:0000979	93.98	gold quality
monocyte	CL:0000576	93.95	gold quality
superficial temporal artery	UBERON:0001614	93.79	gold quality
caput epididymis	UBERON:0004358	93.77	gold quality
corpus epididymis	UBERON:0004359	93.77	gold quality
mononuclear cell	CL:0000842	93.67	gold quality
endothelial cell	CL:0000115	93.65	gold quality
tonsil	UBERON:0002372	93.64	gold quality
endometrium	UBERON:0001295	93.42	gold quality
cauda epididymis	UBERON:0004360	93.40	gold quality
adrenal tissue	UBERON:0018303	93.36	gold quality
trigeminal ganglion	UBERON:0001675	93.28	gold quality
leukocyte	CL:0000738	93.19	gold quality
ventricular zone	UBERON:0003053	93.03	gold quality

Single-cell (SCXA)

Detected in 4 experiment(s), a significant marker in 4.

Experiment	Marker?	Max mean expression
E-MTAB-6075	yes	641.07
E-HCAD-10	yes	39.25
E-MTAB-8142	yes	16.54
E-ANND-3	yes	10.12

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

34 targets.

Target	Regulation
ATF2	Unknown
BIRC5	Unknown
BRCA1	Repression
CDH1	Unknown
CDK1	Unknown
CDKN1A	Activation
DDIT3	Unknown
DHFR	Repression
DNMT3A	Repression
E2F1	Repression
E2F2	Repression
E2F3	Repression
EBNA1BP2	Activation
ELF1	Unknown
FGFR1	Repression
FOS	Repression
GATA1
H1-5	Activation
HBP1	Unknown
IGF1	Unknown
ITGA10	Activation
MAP3K5	Unknown
MYC	Repression
PCNA	Repression
PPARG	Unknown
RB1	Repression
RBL1	Repression
SFTPD	Activation
SP1	Unknown
TFDP1	Repression

Upstream regulators (CollecTRI, top): AHR, AP1, ARID4A, ATF2, BCL3, BDP1, CEBPA, CEBPB, CEBPD, CREB1, CTCF, CTNNB1, CXXC1, DDIT3, DIDO1, DNMT1, DNMT3A, E2F1, E2F3, E2F4, EGR1, ELF1, FLI1, FOS, GABPA, GRHL3, GTF2IRD1, HBP1, HES1, HINFP, HMGA1, HR, ID2, IFI16, JARID2, JUN, KAT2B, MBD2, MYBL2, MYOD1

miRNA regulators (miRDB)

185 targeting RB1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-4682	100.00	68.89	1258
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-340-5P	100.00	72.50	4437
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-511-3P	99.99	68.85	1467
HSA-MIR-6077	99.99	68.04	2299
HSA-MIR-4282	99.99	75.36	6408
HSA-MIR-4500	99.99	72.72	2367
HSA-MIR-3185	99.99	68.12	1959
HSA-MIR-548P	99.98	72.25	3784
HSA-MIR-568	99.98	69.86	2084
HSA-MIR-4775	99.98	75.00	6394
HSA-LET-7A-5P	99.98	72.29	1790
HSA-LET-7B-5P	99.98	72.31	1790
HSA-LET-7C-5P	99.98	72.29	1790
HSA-LET-7E-5P	99.98	72.29	1790
HSA-LET-7F-5P	99.98	72.56	1784
HSA-LET-7G-5P	99.98	72.37	1784
HSA-LET-7I-5P	99.98	72.37	1788
HSA-MIR-98-5P	99.98	72.33	1787
HSA-MIR-5696	99.98	72.36	4487
HSA-MIR-507	99.97	70.11	1915
HSA-MIR-557	99.96	70.01	1640
HSA-MIR-3658	99.96	73.87	4379
HSA-MIR-548AJ-3P	99.96	73.38	5345
HSA-MIR-548X-3P	99.96	73.38	5345
HSA-MIR-590-3P	99.96	74.34	6478
HSA-MIR-1250-3P	99.96	70.04	4038
HSA-LET-7D-5P	99.96	71.76	1632

Functional genomics

ClinGen dosage: haploinsufficiency 3 (sufficient evidence), triplosensitivity 0 (no evidence). ClinGen Gene Dosage Map

Literature-anchored findings (GeneRIF, showing 40)

• K616E in exon 19 (c.1846A>G), an AA insertion in exon 7 (c.684-685insAA), R500G in exon 16 (c.1498A>G), and an A insertion in exon 23 (c.2391-2392insA). (PMID:11524739)
• novel mutations found in Polish patients with familial and/or bilateral retinoblastoma (PMID:11668642)
• Suppression of tumorigenicity of rat liver tumor cells by human chromosome 13: evidence against the involvement of pRb and BRCA2 (PMID:11788883)
• Tumor suppression by a severely truncated species of retinoblastoma protein (PMID:11940667)
• Allelic deletions of Rb in urine from bladder cancer patients (PMID:11956626)
• Activation of caspase-3 and cleavage of Rb are associated with p16-mediated apoptosis in human non-small cell lung cancer cells. (PMID:11960384)
• Results show that Tax directly interacts with CDK4. The Tax/CDK complex represents an active holoenzyme which capably phosphorylates the Rb protein in vitro and is resistant to repression by the inhibitor p21(CIP). (PMID:11971966)
• A parent-of-origin effect in two families with retinoblastoma is associated with a distinct splice mutation in the RB1 gene. (PMID:12016586)
• Three regions of the pRB pocket domain affects its inactivation by human papillomavirus E7 proteins in Hela cells (PMID:12021356)
• Human telomerase accelerates growth of lens epithelial cells through regulation of the genes mediating RB/E2F pathway (PMID:12032846)
• Oxidized low density lipoprotein induces the cyclin-dependent kinase inhibitor p21(waf1) and the tumor suppressor Rb. (PMID:12054658)
• Lack of functional pRb results in attenuated recovery of mRNA synthesis and increased apoptosis following UV radiation in human breast cancer cells. (PMID:12085226)
• The cyclin D1 high and cyclin E high subgroups of breast cancer: separate pathways in tumorogenesis based on pattern of genetic aberrations and inactivation of the pRb node. (PMID:12096344)
• The alpha-MSH-induced differentiation of COLO 853 human melanoma cells is associated with decreased pRB phosphorylation and accumulation of cells in the G(1) phase. (PMID:12140374)
• pRB expression and function are normal in 63 of 66 NHL cases, including 12 of 13 lymphomas with loss of one RB1 allele.There was no association between pRB expression/RB1 copy number and apoptotic fraction. (PMID:12145697)
• Expression of RB C pocket fragments in HSF induces delayed cell cycle progression and sensitizes to apoptosis upon cellular stresses. (PMID:12153616)
• The spectrum and frequencies of RB1 structural defects were studied in tumors and peripheral blood lymphocytes of patients with various forms of retinoblastoma (PMID:12173465)
• Localization and phosphorylation kinetics of this protein correlate with the cellular phenotype of cultured breast adenocarcinoma cells. (PMID:12197776)
• Low-penetrance retinoblastoma due to exons 24 and 25 deletions in the Rb1 gene (PMID:12362308)
• Review. Rb suppresses tumor formation through its multiple biological activities. A theme throughout its multiple cellular functions is its central role in controlling activities that involve chromatin remodeling. Rb may control global genome fluidity. (PMID:12374284)
• Gene aberrations at chromosome 13 are involved in the progression of laryngeal squamous cell carcinoma; results provided further evidence for the putative role of the RB1 gene alterations in the metastatic process (PMID:12377414)
• Data show that the retinoblastoma protein specifically activates transcription of the survival gene bcl-2 in epithelial cells but not in NIH 3T3 mesenchymal cells. (PMID:12391156)
• Aberrant methylation inactivating RB1 was detected in 14 (27%) tumors.Complex testing for RB1 mutations, loss of heterozygosity, and functional inactivation of the two genes revealed a molecular defect in at least one allele in 51 (98%) tumors. (PMID:12391839)
• Activation of cyclin D1-Cdk4 and Cdk4-directed phosphorylation in diabetic mesangial hypertrophy (PMID:12401721)
• novel mutations in Mexican patients with retinoblastoma: SSCP sequence showed new non-described mutations that produced a frameshift on the open reading frame (PMID:12419581)
• REVIEW: The retinoblastoma tumour suppressor in development and cancer (PMID:12459729)
• pRB has a role in eye cancer [review] (PMID:12461781)
• data suggest that hypophosphorylated Rb is anchored in the nucleus by the interaction of pocket C with LAP2alpha-lamin A/C complexes (PMID:12475961)
• The relationships and interactions between p53, Rb and bcl-2 immunostaining, clinical parameters and response to cisplatin-based chemotherapy were evaluated in the present study. (PMID:12499093)
• inactivation of both p16(INK4a) and pRb is associated with immortalization of human cells including fibroblasts and epithelial cells and telomerase-positive cells and ALT-positive cells (PMID:12507935)
• Results describe the relationship between Helicobacter pylori (H.pylori) infection and the expressions of the p53, Rb, c-myc, bcl-2 and hTERT mRNA in a series of diseases from chronic gastritis to gastric cancer. (PMID:12508351)
• Rb and its inactive phospho-isoform exhibit distinct expression patterns in Parkinson disease neurons most commonly associated with the disease, as well as in neurons elsewhere in the brain that also contribute to disease progression or symptoms. (PMID:12528819)
• Expression of p57kip2, Rb protein and PCNA and their relationships with clinicopathology in human pancreatic cancer. (PMID:12532471)
• RB1 CpG island hypermethylation is a common epigenetic event that is associated with the development of malignant nervous system tumours. (PMID:12556968)
• first preimplantation genetic diagnosis of hereditary retinoblastoma using microsatellite markers of this protein (PMID:12569181)
• p55gamma binds to Rb and modification of this association can lead to cell cycle arrest (PMID:12588990)
• retinoblastoma protein has cyclin D1-inducing activity that is abolished by adenovirus E1A and that involves multiple pocket sequences that are independently involved in cyclin D1 activation (PMID:12594215)
• report shows hypophosphorylation of the retinoblastoma family proteins induced by H2O2 was because of the activity of protein phosphatase 2A and pRb dephosphorylation may induce an intra-S-phase response that leads to a reduced rate of DNA synthesis (PMID:12621062)
• We found that E2F1 was present at most of the CpG islands bound by pRb, independent of the phase of the cell cycle, our data suggest that the majority of DNA-bound pRb is recruited to E2F target promoters during both G(0)/G(1) and S phases. (PMID:12629508)
• Senescence-associated heterochromatic foci formation coincides with the recruitment of heterochromatin proteins and the retinoblastoma (Rb) tumor suppressor to E2F-responsive promoters and is associated with the stable repression of E2F target genes. (PMID:12809602)

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio	rb1	ENSDARG00000006782
mus_musculus	Rb1	ENSMUSG00000022105
rattus_norvegicus	Rb1	ENSRNOG00000016029
drosophila_melanogaster	Rbf	FBGN0015799
drosophila_melanogaster	Rbf2	FBGN0038390
caenorhabditis_elegans	lin-35	WBGENE00003020

Paralogs (2): RBL1 (ENSG00000080839), RBL2 (ENSG00000103479)

Protein

Protein identifiers

Retinoblastoma-associated protein — P06400 (reviewed: P06400)

Alternative names: p105-Rb, p110-RB1, pRb, pp110

All UniProt accessions (9): P06400, A0A2R8Y743, A0A2R8YFL6, A0A3B3IS71, A0AAQ5BH01, A0AAQ5BH04, A0AAQ5BH24, A0AAQ5BH52, Q92728

UniProt curated annotations — full annotation on UniProt →

Function. Tumor suppressor that is a key regulator of the G1/S transition of the cell cycle. The hypophosphorylated form binds transcription regulators of the E2F family, preventing transcription of E2F-responsive genes. Both physically blocks E2Fs transactivating domain and recruits chromatin-modifying enzymes that actively repress transcription. Cyclin and CDK-dependent phosphorylation of RB1 induces its dissociation from E2Fs, thereby activating transcription of E2F responsive genes and triggering entry into S phase. RB1 also promotes the G0-G1 transition upon phosphorylation and activation by CDK3/cyclin-C. Directly involved in heterochromatin formation by maintaining overall chromatin structure and, in particular, that of constitutive heterochromatin by stabilizing histone methylation. Recruits and targets histone methyltransferases SUV39H1, KMT5B and KMT5C, leading to epigenetic transcriptional repression. Controls histone H4 ‘Lys-20’ trimethylation. Inhibits the intrinsic kinase activity of TAF1. Mediates transcriptional repression by SMARCA4/BRG1 by recruiting a histone deacetylase (HDAC) complex to the c-FOS promoter. In resting neurons, transcription of the c-FOS promoter is inhibited by BRG1-dependent recruitment of a phospho-RB1-HDAC1 repressor complex. Upon calcium influx, RB1 is dephosphorylated by calcineurin, which leads to release of the repressor complex. (Microbial infection) In case of viral infections, interactions with SV40 large T antigen, HPV E7 protein or adenovirus E1A protein induce the disassembly of RB1-E2F1 complex thereby disrupting RB1’s activity.

Subunit / interactions. The hypophosphorylated form interacts with and sequesters the E2F1 transcription factor, thereby inhibiting E2F1 transcription. Interacts with heterodimeric E2F/DP transcription factor complexes containing TFDP1 and either E2F1, E2F3, E2F4 or E2F5, or TFDP2 and E2F4. Interacts (when hyperphosphorylated and hypophosphorylated) with PKP3; the interaction inhibits RB1 interaction with and repression of the transcription factor E2F1, potentially via sequestering RB1 to the cytoplasm. The unphosphorylated form interacts with EID1, ARID3B, KDM5A, SUV39H1, MJD2A/JHDM3A and THOC1. Interacts with the N-terminal domain of TAF1. Interacts with SNW1, ATAD5, AATF, DNMT1, LIN9, LMNA, KMT5B, KMT5C, PELP1, UHRF2 and TMPO-alpha. Interacts with GRIP1 and UBR4. Interacts with ARID4A and KDM5B. Interacts with E4F1 and LIMD1. Interacts with SMARCA4/BRG1 and HDAC1. Interacts with PSMA3 and USP4. Interacts (when methylated at Lys-860) with L3MBTL1. Interacts with CHEK2; phosphorylates RB1. Interacts with CDK1 and CDK2. Interacts with PRMT2. Interacts with CEBPA. P-TEFB complex interacts with RB1; promotes phosphorylation of RB1. Interacts with RBBP9; the interaction disrupts RB1 binding to E2F1. Interacts with KAT2B/PCAF and EP300/P300. Interacts with PAX5. Interacts (phosphorylated and unphosphorylated) with BLCAP. May interact with NDC80. (Microbial infection) Interacts with adenovirus E1A protein. (Microbial infection) Interacts with HPV E7 protein. (Microbial infection) Interacts with SV40 large T antigen. (Microbial infection) Interacts with human cytomegalovirus/HHV-5 proteins UL82 and UL123. (Microbial infection) Interacts with molluscum contagiosum virus protein MC007.

Subcellular location. Nucleus. Cytoplasm.

Tissue specificity. Expressed in the retina. Expressed in foreskin keratinocytes (at protein level).

Post-translational modifications. Phosphorylated by CDK6 and CDK4, and subsequently by CDK2 at Ser-567 in G1, thereby releasing E2F1 which is then able to activate cell growth. Dephosphorylated at the late M phase. SV40 large T antigen, HPV E7 and adenovirus E1A bind to the underphosphorylated, active form of pRb. Phosphorylation at Thr-821 and Thr-826 promotes interaction between the C-terminal domain C and the Pocket domain, and thereby inhibits interactions with heterodimeric E2F/DP transcription factor complexes. Dephosphorylated at Ser-795 by calcineruin upon calcium stimulation. CDK3/cyclin-C-mediated phosphorylation at Ser-807 and Ser-811 is required for G0-G1 transition. Phosphorylated by CDK1 and CDK2 upon TGFB1-mediated apoptosis. N-terminus is methylated by METTL11A/NTM1. Monomethylation at Lys-810 by SMYD2 enhances phosphorylation at Ser-807 and Ser-811, and promotes cell cycle progression. Monomethylation at Lys-860 by SMYD2 promotes interaction with L3MBTL1. Acetylated during keratinocyte differentiation. Acetylation at Lys-873 and Lys-874 regulates subcellular localization. Can be deacetylated by SIRT1.

Disease relevance. Childhood cancer retinoblastoma (RB) [MIM:180200] Congenital malignant tumor that arises from the nuclear layers of the retina. It occurs in about 1:20'000 live births and represents about 2% of childhood malignancies. It is bilateral in about 30% of cases. Although most RB appear sporadically, about 20% are transmitted as an autosomal dominant trait with incomplete penetrance. The diagnosis is usually made before the age of 2 years when strabismus or a gray to yellow reflex from pupil (‘cat eye’) is investigated. The disease is caused by variants affecting the gene represented in this entry. Bladder cancer (BLC) [MIM:109800] A malignancy originating in tissues of the urinary bladder. It often presents with multiple tumors appearing at different times and at different sites in the bladder. Most bladder cancers are transitional cell carcinomas that begin in cells that normally make up the inner lining of the bladder. Other types of bladder cancer include squamous cell carcinoma (cancer that begins in thin, flat cells) and adenocarcinoma (cancer that begins in cells that make and release mucus and other fluids). Bladder cancer is a complex disorder with both genetic and environmental influences. Disease susceptibility is associated with variants affecting the gene represented in this entry. Osteogenic sarcoma (OSRC) [MIM:259500] A sarcoma originating in bone-forming cells, affecting the ends of long bones. The disease is caused by variants affecting the gene represented in this entry.

Domain organisation. The Pocket domain binds to the threonine-phosphorylated domain C, thereby preventing interaction with heterodimeric E2F/DP transcription factor complexes.

Similarity. Belongs to the retinoblastoma protein (RB) family.

RefSeq proteins (4): NP_000312, NP_001394094, NP_001394095, NP_001394096 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR002719	RB_B	Domain
IPR002720	RB_A	Domain
IPR013763	Cyclin-like_dom	Domain
IPR015030	RB_C	Domain
IPR024599	RB_N	Domain
IPR028309	RB_fam	Family
IPR036915	Cyclin-like_sf	Homologous_superfamily

Pfam: PF01857, PF01858, PF08934, PF11934

UniProt features (134 total): helix 42, sequence variant 31, modified residue 24, strand 11, region of interest 9, mutagenesis site 6, compositionally biased region 4, turn 3, initiator methionine 1, chain 1, short sequence motif 1, sequence conflict 1

Structure

Experimental structures (PDB)

19 structures.

PDB	Method	Resolution (Å)
2R7G	X-RAY DIFFRACTION	1.67
1GUX	X-RAY DIFFRACTION	1.85
4ELL	X-RAY DIFFRACTION	1.98
2QDJ	X-RAY DIFFRACTION	2
9DHU	X-RAY DIFFRACTION	2.16
1N4M	X-RAY DIFFRACTION	2.2
9DHF	X-RAY DIFFRACTION	2.26
1AD6	X-RAY DIFFRACTION	2.3
9DHC	X-RAY DIFFRACTION	2.32
4CRI	X-RAY DIFFRACTION	2.35
9DGK	X-RAY DIFFRACTION	2.38
1H25	X-RAY DIFFRACTION	2.5
1PJM	X-RAY DIFFRACTION	2.5
3POM	X-RAY DIFFRACTION	2.5
2AZE	X-RAY DIFFRACTION	2.55
1O9K	X-RAY DIFFRACTION	2.6
4ELJ	X-RAY DIFFRACTION	2.7
1GH6	X-RAY DIFFRACTION	3.2
3N5U	X-RAY DIFFRACTION	3.2

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P06400-F1	77.03	0.53

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (24): 2, 37, 249, 252, 356, 373, 567, 608, 612, 624, 780, 788, 795, 807, 810, 811, 821, 823, 826, 841 …

Mutagenesis-validated functional residues (6):

Position	Phenotype
821	abolishes interaction with pocket domain; when associated with a-826.
826	abolishes interaction with pocket domain; when associated with a-821.
860	abolishes monomethylation by smyd2 and subsequent interaction with l3mbtl1.
870	does not affect the ability to be methylated by smyd2; when associated with 873-r-r-874.
873–874	does not affect the ability to be methylated by smyd2; when associated with 873-r-r-874.
873–874	does not alter rb localization in cycling cells, but mislocalizes to the cytoplasm during keratinocyte differentiation.

Function

Pathways and Gene Ontology

Reactome pathways

18 pathways

ID	Pathway
R-HSA-113501	Inhibition of replication initiation of damaged DNA by RB1/E2F1
R-HSA-174178	APC/C:Cdh1 mediated degradation of Cdc20 and other APC/C:Cdh1 targeted proteins in late mitosis/early G1
R-HSA-2299718	Condensation of Prophase Chromosomes
R-HSA-2559584	Formation of Senescence-Associated Heterochromatin Foci (SAHF)
R-HSA-2559585	Oncogene Induced Senescence
R-HSA-69200	Phosphorylation of proteins involved in G1/S transition by active Cyclin E:Cdk2 complexes
R-HSA-69202	Cyclin E associated events during G1/S transition
R-HSA-69231	Cyclin D associated events in G1
R-HSA-69656	Cyclin A:Cdk2-associated events at S phase entry
R-HSA-8940973	RUNX2 regulates osteoblast differentiation
R-HSA-9661069	Defective binding of RB1 mutants to E2F1,(E2F2, E2F3)
R-HSA-9661070	Defective translocation of RB1 mutants to the nucleus
R-HSA-9682706	Replication of the SARS-CoV-1 genome
R-HSA-9687136	Aberrant regulation of mitotic exit in cancer due to RB1 defects
R-HSA-9694686	Replication of the SARS-CoV-2 genome
R-HSA-9725371	Nuclear events stimulated by ALK signaling in cancer
R-HSA-9764790	Positive Regulation of CDH1 Gene Transcription
R-HSA-9841922	MLL4 and MLL3 complexes regulate expression of PPARG target genes in adipogenesis and hepatic steatosis

MSigDB gene sets: 0 (showing top):

GO Biological Process (68): G1/S transition of mitotic cell cycle (GO:0000082), negative regulation of transcription by RNA polymerase II (GO:0000122), tissue homeostasis (GO:0001894), chondrocyte differentiation (GO:0002062), aortic valve morphogenesis (GO:0003180), chromatin remodeling (GO:0006338), regulation of DNA-templated transcription (GO:0006355), transcription by RNA polymerase II (GO:0006366), negative regulation of protein kinase activity (GO:0006469), smoothened signaling pathway (GO:0007224), Ras protein signal transduction (GO:0007265), spermatogenesis (GO:0007283), regulation of mitotic cell cycle (GO:0007346), negative regulation of gene expression (GO:0010629), glial cell proliferation (GO:0014009), cell differentiation (GO:0030154), negative regulation of cell growth (GO:0030308), sister chromatid biorientation (GO:0031134), neuron projection development (GO:0031175), heterochromatin formation (GO:0031507), cellular response to insulin stimulus (GO:0032869), maintenance of mitotic sister chromatid cohesion (GO:0034088), glial cell apoptotic process (GO:0034349), skeletal muscle cell differentiation (GO:0035914), neuron maturation (GO:0042551), enucleate erythrocyte differentiation (GO:0043353), regulation of lipid kinase activity (GO:0043550), myoblast differentiation (GO:0045445), positive regulation of macrophage differentiation (GO:0045651), negative regulation of cell cycle (GO:0045786), positive regulation of mitotic metaphase/anaphase transition (GO:0045842), negative regulation of smoothened signaling pathway (GO:0045879), negative regulation of DNA-templated transcription (GO:0045892), positive regulation of transcription by RNA polymerase II (GO:0045944), digestive tract development (GO:0048565), cell morphogenesis involved in neuron differentiation (GO:0048667), epithelial cell proliferation (GO:0050673), negative regulation of epithelial cell proliferation (GO:0050680), negative regulation of inflammatory response (GO:0050728), striated muscle cell differentiation (GO:0051146)

GO Molecular Function (15): RNA polymerase II transcription regulatory region sequence-specific DNA binding (GO:0000977), transcription corepressor activity (GO:0003714), kinase binding (GO:0019900), ubiquitin protein ligase binding (GO:0031625), identical protein binding (GO:0042802), phosphoprotein binding (GO:0051219), molecular adaptor activity (GO:0060090), RNA polymerase II-specific DNA-binding transcription factor binding (GO:0061629), importin-alpha family protein binding (GO:0061676), disordered domain specific binding (GO:0097718), DNA-binding transcription factor binding (GO:0140297), molecular_function (GO:0003674), DNA binding (GO:0003677), protein binding (GO:0005515), enzyme binding (GO:0019899)

GO Cellular Component (13): chromatin (GO:0000785), nucleus (GO:0005634), nucleoplasm (GO:0005654), cytoplasm (GO:0005737), spindle (GO:0005819), cytosol (GO:0005829), SWI/SNF complex (GO:0016514), PML body (GO:0016605), Rb-E2F complex (GO:0035189), chromatin lock complex (GO:0061793), cellular_component (GO:0005575), transcription regulator complex (GO:0005667), cyclin/CDK positive transcription elongation factor complex (GO:0008024)

Reactome top-level categories

Rollup of top-17 pathways:

Category	Pathways
Aberrant regulation of mitotic G1/S transition in cancer due to RB1 defects	2
E2F mediated regulation of DNA replication	1
APC/C-mediated degradation of cell cycle proteins	1
Mitotic Prophase	1
DNA Damage/Telomere Stress Induced Senescence	1
Cellular Senescence	1
Cyclin E associated events during G1/S transition	1
G1/S Transition	1
G1 Phase	1
S Phase	1
RUNX2 regulates bone development	1
SARS-CoV-1 Genome Replication and Transcription	1
Aberrant regulation of mitotic cell cycle due to RB1 defects	1
SARS-CoV-2 Genome Replication and Transcription	1
Signaling by ALK fusions and activated point mutants	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
protein binding	4
cellular anatomical structure	4
mitotic cell cycle	2
negative regulation of DNA-templated transcription	2
DNA-templated transcription	2
regulation of gene expression	2
binding	2
mitotic cell cycle phase transition	1
cell cycle G1/S phase transition	1
regulation of transcription by RNA polymerase II	1
transcription by RNA polymerase II	1
multicellular organismal-level homeostasis	1
anatomical structure homeostasis	1
cell differentiation	1
cartilage development	1
aortic valve development	1
heart valve morphogenesis	1
chromatin organization	1
regulation of RNA biosynthetic process	1
negative regulation of protein phosphorylation	1
protein kinase activity	1
negative regulation of kinase activity	1
regulation of protein kinase activity	1
cell surface receptor signaling pathway	1
small GTPase-mediated signal transduction	1
developmental process involved in reproduction	1
male gamete generation	1
regulation of cell cycle	1
gene expression	1
negative regulation of macromolecule biosynthetic process	1
cell population proliferation	1
gliogenesis	1
cellular developmental process	1
regulation of cell growth	1
cell growth	1
negative regulation of growth	1
negative regulation of cellular process	1
sister chromatid segregation	1
attachment of spindle microtubules to kinetochore	1
neuron development	1

Protein interactions and networks

STRING

2743 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
RB1	E2F1	Q01094	996
RB1	CDK4	P11802	985
RB1	HDAC1	Q13547	962
RB1	MDM2	Q00987	925
RB1	S100A6	P06703	921
RB1	CCNA2	P20248	911
RB1	CCNA1	P78396	908
RB1	E2F3	O00716	897
RB1	E2F4	Q16254	884
RB1	TP53	P04637	873
RB1	CCNL2	Q96S94	853
RB1	CDKN2A	P42771	842
RB1	CDK6	Q00534	841
RB1	CCND1	P24385	831
RB1	CDK2	P24941	821

IntAct

473 interactions, top by confidence:

A	B	Type	Score
RB1	E2F1	psi-mi:“MI:0915”(physical association)	0.980
E2F1	RB1	psi-mi:“MI:0407”(direct interaction)	0.980
E2F1	RB1	psi-mi:“MI:0915”(physical association)	0.980
E2F1	RB1	psi-mi:“MI:0914”(association)	0.980
E7	RB1	psi-mi:“MI:0407”(direct interaction)	0.970
RB1	E7	psi-mi:“MI:0915”(physical association)	0.970
RB1	HDAC1	psi-mi:“MI:0914”(association)	0.960
RB1	HDAC1	psi-mi:“MI:0915”(physical association)	0.960
HDAC1	RB1	psi-mi:“MI:0914”(association)	0.960
RB1	HDAC1	psi-mi:“MI:0407”(direct interaction)	0.960
HDAC1	RB1	psi-mi:“MI:2364”(proximity)	0.960
RB1		psi-mi:“MI:0915”(physical association)	0.930
	RB1	psi-mi:“MI:0915”(physical association)	0.930

BioGRID (1158): ABL1 (Reconstituted Complex), E2F1 (Reconstituted Complex), RB1 (Reconstituted Complex), RAF1 (Affinity Capture-Western), RB1 (Affinity Capture-Western), RB1 (Affinity Capture-Western), RB1 (Biochemical Activity), RB1 (Biochemical Activity), EP300 (Affinity Capture-Western), RB1 (Affinity Capture-Western), RB1 (Biochemical Activity), RB1 (Biochemical Activity), RB1 (Biochemical Activity), RB1 (Biochemical Activity), MDM2 (Reconstituted Complex)

ESM2 similar proteins: A1A5P5, A2YNY4, A2YXJ7, A7P514, A8KBY2, A9SVH7, A9UL13, A9UL14, B1ABR6, B1ABS0, B9GLX8, B9SVG9, D3ZYB7, D4A770, F1R3W0, O55081, O82677, P06400, P13405, P33568, P97358, Q08999, Q09263, Q24472, Q2ABE5, Q2R374, Q3LXA7, Q3UAW9, Q4JF75, Q4V8D6, Q620W3, Q64700, Q66IW8, Q66WV0, Q69ZR2, Q84QM3, Q8GSL4, Q8H0J6, Q8H252, Q8R0Z2

Diamond homologs: P06400, P13405, P33568, Q90600

SIGNOR signaling

54 interactions.

A	Effect	B	Mechanism
RB1	up-regulates	HDAC3
CDK3	down-regulates	RB1	phosphorylation
CDK5	down-regulates	RB1	phosphorylation
CDK4	down-regulates	RB1	phosphorylation
CDK6	down-regulates	RB1	phosphorylation
ABL1	unknown	RB1	phosphorylation
CHEK1	“up-regulates activity”	RB1	phosphorylation
CHEK2	“up-regulates activity”	RB1	phosphorylation
MAPK14	down-regulates	RB1	phosphorylation
CDK2	down-regulates	RB1	phosphorylation
RB1	up-regulates	MYOD1	binding
PRKAA1	down-regulates	RB1	phosphorylation
RB1	down-regulates	E2F2	binding
CDK1	down-regulates	RB1	phosphorylation
AMPK	unknown	RB1	phosphorylation
CyclinD/CDK4	“down-regulates activity”	RB1	phosphorylation
CyclinA2/CDK2	down-regulates	RB1	phosphorylation
TLX1	“down-regulates activity”	RB1	binding
RB1	down-regulates	G1/S_transition
RB1	up-regulates	Cell_cycle_block
CTDSPL	“up-regulates activity”	RB1	dephosphorylation

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 113 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Defective binding of RB1 mutants to E2F1,(E2F2, E2F3)	7	56.9×	3e-09
Transcription of E2F targets under negative control by p107 (RBL1) and p130 (RBL2) in complex with HDAC1	7	53.9×	4e-09
G0 and Early G1	8	45.0×	2e-09
Transcription of E2F targets under negative control by DREAM complex	6	41.8×	4e-07
Cyclin E associated events during G1/S transition	9	32.9×	2e-09
Cyclin A:Cdk2-associated events at S phase entry	9	30.6×	2e-09
Oncogene Induced Senescence	7	30.1×	2e-07
SMAD2/SMAD3:SMAD4 heterotrimer regulates transcription	7	27.7×	4e-07

GO biological processes:

GO term	Partners	Fold	FDR
intracellular glucose homeostasis	5	30.6×	9e-05
positive regulation of transcription elongation by RNA polymerase II	5	15.8×	1e-03
cellular senescence	5	15.6×	1e-03
G1/S transition of mitotic cell cycle	6	12.7×	6e-04
protein import into nucleus	8	12.1×	6e-05
cellular response to hypoxia	8	10.2×	1e-04
transcription by RNA polymerase II	9	6.7×	6e-04

Disease & clinical

Cancer significance

From intOGen — cancer-driver classification: loss-of-function (tumor-suppressor-like) across 33 cancer types — ACC, BLADDER, BLCA, BRCA, CESC, ESCA, GB, GBM, GIST, HCC, HNSC, LGGNOS…(+21 more).

Clinical variants and AI predictions

ClinVar

4594 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	838
Likely pathogenic	93
Uncertain significance	1880
Likely benign	1245
Benign	115

Top pathogenic / likely-pathogenic (30)

Variant ID	HGVS	Classification
100808	NM_000321.3(RB1):c.1960G>A (p.Val654Met)	Pathogenic
1064435	NM_000321.3(RB1):c.1050-8_1050-2del	Pathogenic
1068590	NM_000321.3(RB1):c.1049+2T>A	Pathogenic
1068629	NM_000321.3(RB1):c.566T>A (p.Leu189Ter)	Pathogenic
1069184	NM_000321.3(RB1):c.1937_1940del (p.Ser646fs)	Pathogenic
1069198	NM_000321.3(RB1):c.1166dup (p.Leu389fs)	Pathogenic
1069207	NM_000321.3(RB1):c.1237G>T (p.Glu413Ter)	Pathogenic
1069507	NM_000321.3(RB1):c.2236G>T (p.Glu746Ter)	Pathogenic
1070129	NM_000321.3(RB1):c.1519_1523dup (p.Gly509fs)	Pathogenic
1070330	NM_000321.3(RB1):c.43_80del (p.Ala15fs)	Pathogenic
1070857	NC_000013.10:g.(?48947531)(48947691_?)del	Pathogenic
1071013	NC_000013.10:g.(?48937921)(48942750_?)del	Pathogenic
1071015	NC_000013.10:g.(?48881406)(48955589_?)dup	Pathogenic
1071048	NM_000321.3(RB1):c.399del (p.Leu134fs)	Pathogenic
1071423	NM_000321.3(RB1):c.1281del (p.Glu428fs)	Pathogenic
1071424	NM_000321.3(RB1):c.1597G>T (p.Glu533Ter)	Pathogenic
1071425	NM_000321.3(RB1):c.1332G>A (p.Gln444=)	Pathogenic
1071426	NM_000321.3(RB1):c.1422-2A>G	Pathogenic
1071566	NM_000321.3(RB1):c.2536C>T (p.Gln846Ter)	Pathogenic
1072961	NM_000321.3(RB1):c.100G>T (p.Glu34Ter)	Pathogenic
1073217	NM_000321.3(RB1):c.19del (p.Arg7fs)	Pathogenic
1073218	NM_000321.3(RB1):c.62dup (p.Ala22fs)	Pathogenic
1073219	NM_000321.3(RB1):c.264+1G>T	Pathogenic
1073220	NM_000321.3(RB1):c.390del (p.Lys130fs)	Pathogenic
1073997	NM_000321.3(RB1):c.46_61GCC[2]GCGGAACCCCAGGCACCGCCGCCGCCGCCGCCGCGGAACCCC[1] (p.Pro21fs)	Pathogenic
1074044	NM_000321.3(RB1):c.1572del (p.Ala525fs)	Pathogenic
1074087	NM_000321.3(RB1):c.2384_2390del (p.Ser795fs)	Pathogenic
1074237	NM_000321.3(RB1):c.2420C>G (p.Ser807Ter)	Pathogenic
1074925	NC_000013.10:g.(?48878039)(48919345_?)del	Pathogenic
1075188	NM_000321.3(RB1):c.862-1G>C	Pathogenic

SpliceAI

6247 predictions. Top by Δscore:

Variant	Effect	Δscore
13:48304045:GTCAG:G	donor_gain	1.0000
13:48304050:GTG:G	donor_loss	1.0000
13:48307271:ATTT:A	acceptor_gain	1.0000
13:48307275:GGTAG:G	acceptor_loss	1.0000
13:48307276:GTAGG:G	acceptor_loss	1.0000
13:48307277:TAG:T	acceptor_loss	1.0000
13:48307278:A:AG	acceptor_gain	1.0000
13:48307278:A:C	acceptor_loss	1.0000
13:48307279:G:GG	acceptor_gain	1.0000
13:48307279:GGCTT:G	acceptor_gain	1.0000
13:48307403:ATTGG:A	donor_loss	1.0000
13:48307405:TGG:T	donor_loss	1.0000
13:48307407:G:GG	donor_gain	1.0000
13:48307408:T:G	donor_loss	1.0000
13:48342590:T:TA	acceptor_gain	1.0000
13:48342597:A:AG	acceptor_gain	1.0000
13:48342597:AG:A	acceptor_gain	1.0000
13:48342598:G:GG	acceptor_gain	1.0000
13:48342598:GG:G	acceptor_gain	1.0000
13:48342598:GGGA:G	acceptor_gain	1.0000
13:48342711:TCAGG:T	donor_loss	1.0000
13:48342712:CAGG:C	donor_loss	1.0000
13:48342713:AG:A	donor_loss	1.0000
13:48342714:GGTAA:G	donor_loss	1.0000
13:48342715:G:A	donor_loss	1.0000
13:48342716:T:A	donor_loss	1.0000
13:48345075:T:A	acceptor_gain	1.0000
13:48345076:GTAGT:G	acceptor_loss	1.0000
13:48345077:TA:T	acceptor_loss	1.0000
13:48345078:A:AG	acceptor_gain	1.0000

AlphaMissense

6110 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
13:48379643:T:C	L461P	1.000
13:48381435:T:A	W563R	1.000
13:48381435:T:C	W563R	1.000
13:48459712:T:C	L662P	1.000
13:48459768:T:A	W681R	1.000
13:48459768:T:C	W681R	1.000
13:48459820:G:T	R698M	1.000
13:48459821:G:C	R698S	1.000
13:48459821:G:T	R698S	1.000
13:48463738:T:G	M705R	1.000
13:48463740:T:C	C706R	1.000
13:48463741:G:A	C706Y	1.000
13:48463742:T:G	C706W	1.000
13:48463749:T:C	Y709H	1.000
13:48463753:G:A	G710D	1.000
13:48463761:A:G	K713E	1.000
13:48463763:A:C	K713N	1.000
13:48463763:A:T	K713N	1.000
13:48463785:T:C	F721L	1.000
13:48463786:T:C	F721S	1.000
13:48463786:T:G	F721C	1.000
13:48463787:C:A	F721L	1.000
13:48463787:C:G	F721L	1.000
13:48465049:T:C	F755L	1.000
13:48465050:T:C	F755S	1.000
13:48465051:C:A	F755L	1.000
13:48465051:C:G	F755L	1.000
13:48465052:T:G	Y756D	1.000
13:48465065:T:C	F760S	1.000
13:48348999:T:A	W195R	0.999

dbSNP variants (sampled 300 via entrez): RS1000008890 (13:48474704 C>A,T), RS1000025805 (13:48392012 G>T), RS1000027885 (13:48459269 G>T), RS1000040287 (13:48373625 C>T), RS1000040980 (13:48420125 G>A), RS1000073843 (13:48360878 A>G), RS1000109211 (13:48421757 A>G), RS1000122428 (13:48377795 T>G), RS1000166836 (13:48381635 T>C), RS1000191108 (13:48434868 C>A), RS1000193168 (13:48401232 A>T), RS1000200997 (13:48322560 A>G), RS1000208084 (13:48345790 C>A,T), RS1000269743 (13:48416237 C>T), RS1000275591 (13:48439014 G>A,T)

Disease associations

OMIM: gene MIM:614041 | disease phenotypes: MIM:109800, MIM:259500, MIM:182280, MIM:180200, MIM:167000, MIM:278150, MIM:614337, MIM:155255

GenCC curated gene-disease

Disease	Classification	Inheritance
hereditary retinoblastoma	Definitive	Autosomal dominant
retinoblastoma	Definitive	Autosomal dominant
melanoma	Moderate	Autosomal dominant

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
retinoblastoma	Definitive	AD

Mondo (19): urinary bladder cancer (MONDO:0001187), bone osteosarcoma (MONDO:0002629), retinoblastoma (MONDO:0008380), small cell lung carcinoma (MONDO:0008433), hereditary neoplastic syndrome (MONDO:0015356), hereditary retinoblastoma (MONDO:0018160), trilateral retinoblastoma (MONDO:0003073), ovarian cancer (MONDO:0008170), optic atrophy (MONDO:0003608), hypotrichosis 8 (MONDO:0010206), wooly hair, autosomal recessive 1, with or without hypotrichosis (MONDO:0800312), lung adenocarcinoma (MONDO:0005061), squamous cell carcinoma (MONDO:0005096), inherited retinal dystrophy (MONDO:0019118), Lynch syndrome 4 (MONDO:0013699)

Orphanet (12): Inherited cancer-predisposing syndrome (Orphanet:140162), Osteosarcoma (Orphanet:668), Small cell lung cancer (Orphanet:70573), Retinoblastoma (Orphanet:790), Hereditary retinoblastoma (Orphanet:357027), Rare ovarian cancer (Orphanet:213500), Hypotrichosis simplex (Orphanet:55654), OBSOLETE: Inherited retinal disorder (Orphanet:71862), Lynch syndrome (Orphanet:144), Medulloblastoma (Orphanet:616), NON RARE IN EUROPE: Bladder cancer (Orphanet:157980), NON RARE IN EUROPE: Adenocarcinoma of the lung (Orphanet:415268)

HPO phenotypes

58 total (30 of 58 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000175	Cleft palate
HP:0000243	Trigonocephaly
HP:0000252	Microcephaly
HP:0000286	Epicanthus
HP:0000316	Hypertelorism
HP:0000347	Micrognathia
HP:0000369	Low-set ears
HP:0000391	Thickened helices
HP:0000411	Protruding ear
HP:0000426	Prominent nasal bridge
HP:0000431	Wide nasal bridge
HP:0000465	Webbed neck
HP:0000470	Short neck
HP:0000508	Ptosis
HP:0000518	Cataract
HP:0000555	Leukocoria
HP:0000568	Microphthalmia
HP:0000612	Iris coloboma
HP:0000944	Abnormal metaphysis morphology
HP:0001156	Brachydactyly
HP:0001249	Intellectual disability
HP:0001252	Hypotonia
HP:0001360	Holoprosencephaly
HP:0001386	Joint swelling
HP:0001442	Typified by somatic mosaicism
HP:0001511	Intrauterine growth retardation
HP:0001824	Weight loss
HP:0001909	Leukemia
HP:0001945	Fever

GWAS associations

8 associations (top):

Study	Trait	p-value
GCST003140_5	Chronic kidney disease	4.000000e-06
GCST003264_106	Post bronchodilator FEV1/FVC ratio	2.000000e-06
GCST003264_82	Post bronchodilator FEV1/FVC ratio	2.000000e-06
GCST005146_57	Birth weight	2.000000e-08
GCST008362_16	Birth weight	7.000000e-11
GCST008363_97	Offspring birth weight	2.000000e-07
GCST012050_2	Diastolic blood pressure	2.000000e-07
GCST90002388_449	Lymphocyte count	4.000000e-11

EFO canonical traits (5, from GWAS)

EFO ID	Trait name
EFO:0004713	FEV/FVC ratio
EFO:0004344	birth weight
EFO:0005939	parental genotype effect measurement
EFO:0006336	diastolic blood pressure
EFO:0004587	lymphocyte count

MeSH disease descriptors (11)

Descriptor	Name	Tree numbers
D002294	Carcinoma, Squamous Cell	C04.557.470.200.400; C04.557.470.700.400
D008527	Medulloblastoma	C04.557.465.625.600.380.515; C04.557.465.625.600.590.500; C04.557.470.670.380.515; C04.557.470.670.590.500; C04.557.580.625.600.380.515; C04.557.580.625.600.590.500
D008545	Melanoma	C04.557.465.625.650.510; C04.557.580.625.650.510; C04.557.665.510; C04.588.805.377; C17.800.882.445
D009386	Neoplastic Syndromes, Hereditary	C04.700; C16.320.700
D009896	Optic Atrophy	C10.292.700.225; C11.640.451
D010051	Ovarian Neoplasms	C04.588.322.455; C12.050.351.500.056.630.705; C12.050.351.937.418.685; C12.100.250.056.630.705; C12.900.418.685; C19.344.410; C19.391.630.705
D058499	Retinal Dystrophies	C11.768.585.658
D012175	Retinoblastoma	C04.557.465.625.600.725; C04.557.470.670.725; C04.557.580.625.600.725; C04.588.364.818.760; C11.270.862; C11.319.475.760; C11.768.717.760
D055752	Small Cell Lung Carcinoma	C04.588.894.797.520.109.220.624; C08.381.540.140.750; C08.785.520.100.220.750
C563971	Colorectal Cancer, Hereditary Nonpolyposis, Type 4 (supp.)
C566950	Hypotrichosis, Localized, Autosomal Recessive, 3 (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (2): CHEMBL4523682 (PROTEIN-PROTEIN INTERACTION), CHEMBL5288 (SINGLE PROTEIN)

Molecules with ChEMBL bioactivity

1 molecules (phase ≥1), by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 599 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

Molecule	Name	Phase	Patents
CHEMBL4446357	EBVACICLIB	2	599

Clinical evidence (CIViC)

Drug × variant × indication: 15 predictive associations from 15 curated evidence items; also 1 oncogenic, 1 prognostic.

Variant	Therapy	Indication	Effect	Level	CIViC
RB1 Mutation	Chemotherapy	Lung Small Cell Carcinoma	Sensitivity/Response	CIViC B	EID1866
RB1 Wildtype AND ( CDKN2A Loss OR CDKN2A Mutation )	Palbociclib	Lung Non-small Cell Carcinoma	Sensitivity/Response	CIViC B	EID11665
PIK3CA Mutation OR RB1 Mutation OR ESR1 Mutation	Fulvestrant + Palbociclib	Breast Cancer	Resistance	CIViC B	EID12045
RB1 PHOSPHORYLATION	Alpelisib	Breast Cancer	Resistance	CIViC B	EID1609
RB1 Mutation	Palbociclib + Ribociclib	Breast Cancer	Resistance	CIViC C	EID6097
RB1 Loss-of-function	Olaparib + Niraparib + Talazoparib	Osteosarcoma	Sensitivity/Response	CIViC D	EID12032
RB1 Loss-of-function	Gemcitabine	Triple-receptor Negative Breast Cancer	Sensitivity/Response	CIViC D	EID12329
RB1 Loss-of-function	Checkpoint Kinase Inhibitor AZD7762	Triple-receptor Negative Breast Cancer	Sensitivity/Response	CIViC D	EID12330
RB1 Loss-of-function	Volasertib	Triple-receptor Negative Breast Cancer	Sensitivity/Response	CIViC D	EID12331
RB1 Loss-of-function	Pemrametostat + Fulvestrant	Breast Cancer	Sensitivity/Response	CIViC D	EID12579
RB1 Mutation	Aurora A Kinase Inhibitor LY3295668 Erbumine	Cancer	Sensitivity/Response	CIViC D	EID11899
RB1 Loss-of-function	Palbociclib	Breast Cancer	Resistance	CIViC D	EID1535
RB1 Loss-of-function	Palbociclib	Glioblastoma	Resistance	CIViC D	EID1595
RB1 M695FS*26	Palbociclib	Estrogen-receptor Positive Breast Cancer	Resistance	CIViC D	EID1630
RB1 Overexpression	Doxorubicin + Fluorouracil + Gemcitabine + Mitomycin	Pancreatic Adenocarcinoma	Resistance	CIViC D	EID1324

PharmGKB: 1 entry (VIP=true, CPIC=false)

ChEMBL bioactivities

19 potent at pChembl≥5 of 25 total, top 19 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
7.72	EC50	19	nM	EBVACICLIB
7.18	IC50	66	nM	STAUROSPORINE
6.70	IC50	200	nM	CHEMBL515631
6.57	IC50	270	nM	CHEMBL5285163
6.43	IC50	370	nM	CHEMBL490451
6.21	IC50	610	nM	CHEMBL504547
5.70	IC50	2000	nM	CHEMBL4092194
5.66	IC50	2200	nM	CHEMBL4070561
5.54	IC50	2900	nM	CHEMBL4070208
5.46	IC50	3500	nM	CHEMBL4068198
5.44	IC50	3600	nM	CHEMBL4086582
5.39	IC50	4100	nM	CHEMBL4077816
5.32	IC50	4810	nM	CHEMBL4068744
5.16	IC50	6920	nM	CHEMBL4061653
5.05	IC50	9000	nM	CHEMBL4065808
5.04	IC50	9200	nM	CHEMBL4076325
5.02	IC50	9500	nM	CHEMBL4075949
5.00	IC50	1e+04	nM	CHEMBL4092469
5.00	IC50	1e+04	nM	CHEMBL4075814

PubChem BioAssay actives

19 with measured affinity, of 101 total; 19 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
6-(difluoromethyl)-8-[(1R,2R)-2-hydroxy-2-methylcyclopentyl]-2-[(1-methylsulfonylpiperidin-4-yl)amino]pyrido[2,3-d]pyrimidin-7-one	1933538: Inhibition of RB1 phosphorylation in human OVCAR-3 cells assessed as reduction in phosphorylation at Serine 807/811 residue incubated for 1 hr by ELISA	ec50	0.0190	uM
(2S,3R,4R,6R)-3-methoxy-2-methyl-4-(methylamino)-29-oxa-1,7,17-triazaoctacyclo[12.12.2.12,6.07,28.08,13.015,19.020,27.021,26]nonacosa-8,10,12,14,19,21,23,25,27-nonaen-16-one	1452447: Inhibition of retinoblastoma protein phosphorylation in human MDA-MB-231 cells after 16 hrs by Hoechst 33342 staining based fluorescence assay	ic50	0.0660	uM
6-tert-butyl-3-hydroxy-4-[(4-oxo-5-propoxy-1H-pyridin-2-yl)methyliminomethyl]-2H-isoquinolin-1-one	415010: Inhibition of retinoblastoma susceptibility gene product phosphorylation in human MCF7 cells after 24 hrs	ic50	0.2000	uM
8-cyclopentyl-6-(2-hydroxyethyl)-2-[(1-methylsulfonylpiperidin-4-yl)amino]pyrido[2,3-d]pyrimidin-7-one	1933538: Inhibition of RB1 phosphorylation in human OVCAR-3 cells assessed as reduction in phosphorylation at Serine 807/811 residue incubated for 1 hr by ELISA	ic50	0.2700	uM
4-[[1-(furan-3-yl)-2-oxo-4-pyridinyl]methyliminomethyl]-3-hydroxy-6-iodo-2H-isoquinolin-1-one	415010: Inhibition of retinoblastoma susceptibility gene product phosphorylation in human MCF7 cells after 24 hrs	ic50	0.3700	uM
4-[[4-(furan-3-yl)-3-hydroxyphenyl]methyliminomethyl]-3-hydroxy-6-iodo-2H-isoquinolin-1-one	415010: Inhibition of retinoblastoma susceptibility gene product phosphorylation in human MCF7 cells after 24 hrs	ic50	0.6100	uM
6-methyl-N-(3-methylcyclopentyl)-2,3,4,9-tetrahydro-1H-carbazol-2-amine	1452447: Inhibition of retinoblastoma protein phosphorylation in human MDA-MB-231 cells after 16 hrs by Hoechst 33342 staining based fluorescence assay	ic50	2.0000	uM
N-benzyl-6-methyl-2,3,4,9-tetrahydro-1H-carbazol-2-amine;hydrochloride	1452447: Inhibition of retinoblastoma protein phosphorylation in human MDA-MB-231 cells after 16 hrs by Hoechst 33342 staining based fluorescence assay	ic50	2.2000	uM
6-methyl-N-[(4-methylphenyl)methyl]-2,3,4,9-tetrahydro-1H-carbazol-2-amine;hydrochloride	1452447: Inhibition of retinoblastoma protein phosphorylation in human MDA-MB-231 cells after 16 hrs by Hoechst 33342 staining based fluorescence assay	ic50	2.9000	uM
9-methyl-N-[(4-methylphenyl)methyl]-1,2,3,4-tetrahydrocarbazol-2-amine	1452447: Inhibition of retinoblastoma protein phosphorylation in human MDA-MB-231 cells after 16 hrs by Hoechst 33342 staining based fluorescence assay	ic50	3.5000	uM
6-methyl-N-(3-methylcyclopentyl)-2,3,4,9-tetrahydro-1H-carbazol-2-amine;hydrochloride	1452447: Inhibition of retinoblastoma protein phosphorylation in human MDA-MB-231 cells after 16 hrs by Hoechst 33342 staining based fluorescence assay	ic50	3.6000	uM
N-[(4-methylphenyl)methyl]-2,3,4,9-tetrahydro-1H-carbazol-2-amine	1452447: Inhibition of retinoblastoma protein phosphorylation in human MDA-MB-231 cells after 16 hrs by Hoechst 33342 staining based fluorescence assay	ic50	4.1000	uM
N-(3-methylcyclopentyl)-6-nitro-2,3,4,9-tetrahydro-1H-carbazol-1-amine	1452447: Inhibition of retinoblastoma protein phosphorylation in human MDA-MB-231 cells after 16 hrs by Hoechst 33342 staining based fluorescence assay	ic50	4.8100	uM
N-benzyl-2,3,4,9-tetrahydro-1H-carbazol-2-amine	1452447: Inhibition of retinoblastoma protein phosphorylation in human MDA-MB-231 cells after 16 hrs by Hoechst 33342 staining based fluorescence assay	ic50	6.9200	uM
N-(3-methylcyclopentyl)-2,3,4,9-tetrahydro-1H-carbazol-1-amine	1452447: Inhibition of retinoblastoma protein phosphorylation in human MDA-MB-231 cells after 16 hrs by Hoechst 33342 staining based fluorescence assay	ic50	9.0000	uM
4-fluoro-N-(2,3,4,9-tetrahydro-1H-carbazol-1-yl)benzenesulfonamide	1452447: Inhibition of retinoblastoma protein phosphorylation in human MDA-MB-231 cells after 16 hrs by Hoechst 33342 staining based fluorescence assay	ic50	9.2000	uM
4-fluoro-N-(2,3,4,9-tetrahydro-1H-carbazol-2-yl)benzenesulfonamide	1452447: Inhibition of retinoblastoma protein phosphorylation in human MDA-MB-231 cells after 16 hrs by Hoechst 33342 staining based fluorescence assay	ic50	9.5000	uM
N-cyclopentyl-2,3,4,9-tetrahydro-1H-carbazol-2-amine	1452447: Inhibition of retinoblastoma protein phosphorylation in human MDA-MB-231 cells after 16 hrs by Hoechst 33342 staining based fluorescence assay	ic50	10.0000	uM
N-cyclopentyl-2,3,4,9-tetrahydro-1H-carbazol-1-amine	1452447: Inhibition of retinoblastoma protein phosphorylation in human MDA-MB-231 cells after 16 hrs by Hoechst 33342 staining based fluorescence assay	ic50	10.0000	uM

CTD chemical–gene interactions

358 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
palbociclib	decreases response to substance, increases cleavage, decreases phosphorylation, affects phosphorylation, increases expression (+8 more)	32
Tretinoin	affects cotreatment, increases activity, increases expression, decreases expression, decreases phosphorylation (+4 more)	16
Sirolimus	increases phosphorylation, decreases expression, decreases phosphorylation, affects cotreatment, decreases reaction	11
Resveratrol	affects cotreatment, increases phosphorylation, decreases phosphorylation, decreases reaction	8
Calcitriol	decreases reaction, increases expression, increases reaction, decreases phosphorylation	8
Quercetin	increases phosphorylation, increases expression, affects cotreatment, decreases phosphorylation, affects expression (+1 more)	7
Estradiol	affects binding, decreases reaction, decreases expression, increases expression, increases phosphorylation	6
Fluorouracil	affects response to substance, affects cotreatment, decreases response to substance, affects expression, increases expression (+1 more)	6
Nicotine	affects binding, increases reaction, affects reaction, increases expression, decreases expression (+2 more)	6
abemaciclib	affects expression, decreases expression, decreases phosphorylation, affects reaction, affects response to substance	5
bisphenol A	decreases expression, increases phosphorylation, decreases reaction, increases expression, affects cotreatment (+2 more)	5
sodium arsenite	increases expression, increases phosphorylation, increases reaction, decreases phosphorylation, increases abundance (+3 more)	5
alvocidib	decreases response to substance, decreases activity, decreases expression, decreases phosphorylation, affects cotreatment	5
2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one	decreases phosphorylation, decreases reaction, increases expression, increases phosphorylation	5
Arsenic Trioxide	increases phosphorylation, affects binding, increases reaction, decreases activity, decreases phosphorylation (+2 more)	5
Troglitazone	decreases expression, decreases reaction, increases expression, increases reaction, decreases phosphorylation (+1 more)	5
Doxorubicin	decreases phosphorylation, affects expression, increases reaction, increases cleavage, decreases reaction (+3 more)	5
Hydrogen Peroxide	increases reaction, decreases expression, decreases phosphorylation, decreases reaction, affects cotreatment (+1 more)	5
Tetradecanoylphorbol Acetate	increases expression, affects cotreatment, affects expression, increases phosphorylation, increases reaction (+2 more)	5
trichostatin A	decreases phosphorylation, increases expression, affects expression, decreases activity	4
hydroquinone	affects reaction, decreases expression, affects response to substance, increases phosphorylation, increases expression (+3 more)	4
Fulvestrant	increases methylation, affects response to substance, decreases reaction, increases phosphorylation, increases reaction (+4 more)	4
Vorinostat	affects cotreatment, increases degradation, decreases phosphorylation, increases cleavage, increases expression	4
Benzo(a)pyrene	affects methylation, increases expression	4
Butyrates	affects cotreatment, increases degradation, decreases expression, decreases phosphorylation	4
Methotrexate	affects binding, decreases reaction, increases phosphorylation, affects response to substance, increases response to substance	4
Tetrachlorodibenzodioxin	affects binding, increases phosphorylation, decreases phosphorylation, decreases reaction	4
4-(2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl)benzoic acid	affects binding, affects cotreatment, decreases reaction, increases phosphorylation, increases reaction (+1 more)	3
(+)-JQ1 compound	decreases expression, decreases phosphorylation	3
Rosiglitazone	decreases phosphorylation, increases phosphorylation, decreases expression	3

ChEMBL screening assays

59 unique, capped per target: 59 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL4341458	Binding	Induction of CRBN-mediated RB degradation in human MIAPaCa2 cells at 0.5 uM measured after 4 hrs by western blot analysis	Selective degradation of CDK6 by a palbociclib based PROTAC. — Bioorg Med Chem Lett

Cellosaurus cell lines

318 cell lines: 289 cancer cell line, 17 embryonic stem cell, 10 induced pluripotent stem cell, 2 transformed cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_0105	DU145	Cancer cell line	Male
CVCL_0126	5637	Cancer cell line	Male
CVCL_0178	BT-20	Cancer cell line	Female
CVCL_0234	Caki-1	Cancer cell line	Male
CVCL_0290	HCC1937	Cancer cell line	Female
CVCL_0326	Hep 3B2.1-7	Cancer cell line	Male
CVCL_0359	J82	Cancer cell line	Male
CVCL_0419	MDA-MB-468	Cancer cell line	Female
CVCL_0533	SK-UT-1	Cancer cell line	Female
CVCL_0623	MDA-MB-436	Cancer cell line	Female

Clinical trials (associated diseases)

600 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00324272	PHASE4	COMPLETED	Post-Operative Drainage Following Lymph Node Dissection
NCT01053819	PHASE4	COMPLETED	Can We Miss Pigmented Lesions in Psoriasis Patients?
NCT01898585	PHASE4	COMPLETED	An Open-Label Study of Zelboraf (Vemurafenib) in Patients With Braf V600 Mutation Positive Metastatic Melanoma
NCT02068196	PHASE4	ACTIVE_NOT_RECRUITING	A National Phase IV Study With Ipilimumab for Patients With Advanced Malignant Melanoma.
NCT02451488	PHASE4	COMPLETED	Neoadjuvant Granulocyte-Macrophage Colony-Stimulating Factor (GM-CSF) in Cutaneous Stage L-lll Melanoma
NCT03313544	PHASE4	UNKNOWN	Evolution of the Heart Function When Monitoring Immunotherapies Anti-cancerous Inhibiting PD-1
NCT03340506	PHASE4	RECRUITING	Dabrafenib and/or Trametinib Rollover Study
NCT03715205	PHASE4	COMPLETED	Study to Evaluate the Safety of Pembrolizumab in Participants With Unresectable or Metastatic Melanoma or Non-small Cell Lung Cancer in India (MK-3475-593/KEYNOTE-593)
NCT04261179	PHASE4	UNKNOWN	Study Comparing Lymphoseek® vs. Albumin Nanocolloid in Head and Neck, Melanoma and Breast Cancer
NCT05467137	PHASE4	UNKNOWN	Sentinel Lymph Node Detection in Patients With Stage Ib-III Melanoma Using MSOT and ICG
NCT06116461	PHASE4	UNKNOWN	Nivolumab Dose Optimization in Patients With a Complete, Partial or Stable Response
NCT06785974	PHASE4	NOT_YET_RECRUITING	Statins to Prevent Immune Checkpoint Inhibitor-induced PRogression of AtherosLerosis
NCT07004335	PHASE4	NOT_YET_RECRUITING	Efficacy and Safety of Iparomlimab and Tuvonralimab Injection in Combination With Bevacizumab After Progression on Anti-PD-(L)1 Therapy in Advanced Melanoma: A Prospective, Single-Arm, Exploratory Clinical Study
NCT07405086	PHASE4	RECRUITING	Morning Versus Afternoon Administration of Immunotherapy for the Treatment of Advanced or Metastatic Solid Tumors, The Knight SHIFT Study
NCT07445022	PHASE4	RECRUITING	RWS of Tunlametinib in NRAS-Mutant Advanced Melanoma
NCT07504796	PHASE4	RECRUITING	ctDNA-guided Addition of Ipilimumab to Patients Receiving Nivolumab and Relatlimab
NCT07574047	PHASE4	NOT_YET_RECRUITING	MELCHRONO: A Prospective Randomized Study Investigating Chrono-immunotherapy for Advanced Melanoma.
NCT00336531	PHASE4	COMPLETED	Efficacy of Prophylactic Itraconazole in High-Dose Chemotherapy and Autologous Hematopoietic Stem Cell Transplantation
NCT02319486	PHASE4	COMPLETED	CEV With/Without Periocular Carboplatin Chemotherapy for Extraocular Retinoblastoma
NCT02933333	PHASE4	UNKNOWN	G-CSF Alone or Combination With GM-CSF on Prevention and Treatment of Infection in Children With Malignant Tumor
NCT02348450	PHASE4	UNKNOWN	Irinotecan Plus Cisplatin Compared With Etoposide Plus Cisplatin for Extensive Stage Small-cell Lung Cancer
NCT03890055	PHASE4	UNKNOWN	Clinical Study of First-line Treatment of Small Cell Lung Cancer (SCLC) With Anlotinib Hydrochloride
NCT06467786	PHASE4	RECRUITING	Study on the Therapeutic Effect of Irinotecan Liposomes in Small Cell Lung Cancer
NCT06951841	PHASE4	NOT_YET_RECRUITING	Prospective, Single-arm, Phase II Clinical Study of Irinotecan Hydrochloride Liposome Injection Combined With Platinum and Immune Checkpoint Inhibitors Combined With Anlotinib for the Maintenance of Extensive Small Cell Lung Cancer After First-line Induction
NCT00001296	PHASE3	COMPLETED	A Randomized Phase III Trial of Hyperthermic Isolated Limb Perfusion With Melphalan, Tumor Necrosis Factor, and Interferon-Gamma in Patients With Locally Advanced Extremity Melanoma
NCT00002455	PHASE3	UNKNOWN	Immunotherapy After Surgery in Treating Patients With Breast Cancer, Colon Cancer, or Melanoma
NCT00002763	PHASE3	UNKNOWN	High-Dose or Low-Dose Interferon Alfa Compared With No Further Therapy Following Surgery in Treating Patients With Stage III Melanoma
NCT00002767	PHASE3	UNKNOWN	Interferon Alfa With or Without Vaccine Therapy in Treating Patients With Metastatic Melanoma
NCT00002882	PHASE3	COMPLETED	Interferon Alfa With or Without Combination Chemotherapy Plus Interleukin-2 in Treating Patients With Melanoma
NCT00002892	PHASE3	COMPLETED	Interferon Alfa or No Further Therapy Following Surgery in Treating Patients With Stage II, Stage III, or Recurrent Melanoma
NCT00003027	PHASE3	COMPLETED	Combination Chemotherapy With or Without Interleukin-2 and Interferon Alfa in Treating Patients With Metastatic Melanoma
NCT00003444	PHASE3	COMPLETED	Interferon Alfa-2b With or Without Radiation Therapy in Treating Patients With Melanoma That Has Metastasized to Lymph Nodes in the Neck, Under the Arm, or in the Groin
NCT00003641	PHASE3	ACTIVE_NOT_RECRUITING	High-Dose Interferon Alfa in Treating Patients With Stage II or Stage III Melanoma
NCT00003647	PHASE3	COMPLETED	Chemotherapy With or Without Immunotherapy in Treating Patients With Stage III or Stage IV Melanoma
NCT00003789	PHASE3	COMPLETED	Melphalan With or Without Tumor Necrosis Factor in Treating Patients With Locally Advanced Melanoma of the Arm or Leg
NCT00004196	PHASE3	COMPLETED	Interferon Alfa-2b in Treating Patients With Melanoma and Early Lymph Node Metastasis
NCT00005052	PHASE3	UNKNOWN	Vaccine Therapy in Treating Patients With Primary Stage II Melanoma
NCT00006237	PHASE3	COMPLETED	S0008: Chemotherapy Plus Biological Therapy in Treating Patients With Melanoma
NCT00006249	PHASE3	UNKNOWN	Interferon Alfa Following Surgery in Treating Patients With Stage III Melanoma
NCT00016263	PHASE3	COMPLETED	Dacarbazine With or Without Oblimersen (G3139) in Treating Patients With Advanced Malignant Melanoma