RERE

Summary

RERE (arginine-glutamic acid dipeptide repeats, HGNC:9965) is a protein-coding gene on chromosome 1p36.23, encoding Arginine-glutamic acid dipeptide repeats protein (Q9P2R6). Plays a role as a transcriptional repressor during development.

This gene encodes a member of the atrophin family of arginine-glutamic acid (RE) dipeptide repeat-containing proteins. The encoded protein co-localizes with a transcription factor in the nucleus, and its overexpression triggers apoptosis. A similar protein in mouse associates with histone deacetylase and is thought to function as a transcriptional co-repressor during embryonic development. Multiple transcript variants encoding different isoforms have been found for this gene.

Source: NCBI Gene 473 — RefSeq curated summary.

At a glance

• Gene–disease (curated): complex neurodevelopmental disorder with or without congenital anomalies (Definitive, ClinGen) — +1 more curated relationship
• GWAS associations: 77
• Clinical variants (ClinVar): 1,119 total — 25 pathogenic, 35 likely-pathogenic
• Phenotypes (HPO): 182
• Dosage sensitivity (ClinGen): haploinsufficiency little evidence, triplosensitivity unscored
• MANE Select transcript: NM_001042681

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:9965
Approved symbol	RERE
Name	arginine-glutamic acid dipeptide repeats
Location	1p36.23
Locus type	gene with protein product
Status	Approved
Aliases	KIAA0458, ARP, ARG, DNB1, ATN2
Ensembl gene	ENSG00000142599
Ensembl biotype	protein_coding
OMIM	605226
Entrez	473

Gene structure

Transcript identifiers

Ensembl transcripts: 23 — 16 protein_coding, 5 protein_coding_CDS_not_defined, 1 non_stop_decay, 1 retained_intron

ENST00000337907, ENST00000377464, ENST00000400907, ENST00000400908, ENST00000460659, ENST00000464367, ENST00000464972, ENST00000465125, ENST00000467350, ENST00000468247, ENST00000469251, ENST00000476556, ENST00000480342, ENST00000488215, ENST00000492766, ENST00000505225, ENST00000507012, ENST00000514428, ENST00000656437, ENST00000659924, ENST00000704049, ENST00000704050, ENST00000864419

RefSeq mRNA: 3 — MANE Select: NM_001042681 NM_001042681, NM_001042682, NM_012102

CCDS: CCDS41243, CCDS95

Canonical transcript exons

ENST00000400908 — 23 exons

Exon	Start	End
ENSE00000955057	8359764	8359986
ENSE00000955060	8355419	8355599
ENSE00001041607	8362683	8362844
ENSE00001230239	8360112	8361490
ENSE00001230273	8356100	8356246
ENSE00001230277	8358196	8358916
ENSE00001230292	8361763	8361876
ENSE00002044319	8817160	8817640
ENSE00002062025	8352404	8355120
ENSE00002965848	8465925	8466023
ENSE00003459584	8557418	8557523
ENSE00003460721	8614561	8614686
ENSE00003476162	8655973	8656441
ENSE00003477817	8508627	8508675
ENSE00003494724	8364056	8364255
ENSE00003511856	8422727	8422807
ENSE00003514202	8495063	8495162
ENSE00003539169	8541214	8541318
ENSE00003561191	8497405	8497529
ENSE00003578401	8624310	8624380
ENSE00003578543	8365812	8365974
ENSE00003594807	8556475	8556571
ENSE00003664145	8364746	8364838

Expression profiles

Bgee: expression breadth ubiquitous, 293 present calls, max score 98.38.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 47.5788 / max 1148.2891, expressed in 1821 samples.

FANTOM5 promoters (29 alternative TSS)

Promoter ID	TPM avg	Samples expressed
10148	14.4354	1729
10141	5.8395	1374
10131	4.0779	1039
10119	3.2805	1279
10142	2.5180	1062
10116	2.3644	1020
10149	2.3278	1106
10123	2.1354	1099
10121	1.8222	1014
10139	1.8022	912

Top tissues by expression

294 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
sural nerve	UBERON:0015488	98.38	gold quality
colonic epithelium	UBERON:0000397	97.72	gold quality
gastrocnemius	UBERON:0001388	97.49	gold quality
body of uterus	UBERON:0009853	97.37	gold quality
muscle of leg	UBERON:0001383	97.18	gold quality
hindlimb stylopod muscle	UBERON:0004252	97.01	gold quality
paraflocculus	UBERON:0005351	96.96	gold quality
apex of heart	UBERON:0002098	96.86	gold quality
lower esophagus muscularis layer	UBERON:0035833	96.76	gold quality
lower esophagus	UBERON:0013473	96.74	gold quality
endocervix	UBERON:0000458	96.53	gold quality
ganglionic eminence	UBERON:0004023	96.50	gold quality
muscle organ	UBERON:0001630	96.42	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	96.33	gold quality
tibialis anterior	UBERON:0001385	96.32	gold quality
prostate gland	UBERON:0002367	96.31	gold quality
muscle layer of sigmoid colon	UBERON:0035805	96.27	gold quality
mucosa of stomach	UBERON:0001199	96.23	gold quality
ventricular zone	UBERON:0003053	96.13	gold quality
popliteal artery	UBERON:0002250	96.12	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	96.12	gold quality
tibial artery	UBERON:0007610	96.11	gold quality
calcaneal tendon	UBERON:0003701	95.99	gold quality
descending thoracic aorta	UBERON:0002345	95.93	gold quality
aorta	UBERON:0000947	95.81	gold quality
middle frontal gyrus	UBERON:0002702	95.81	gold quality
diaphragm	UBERON:0001103	95.76	gold quality
metanephros cortex	UBERON:0010533	95.73	gold quality
tendon	UBERON:0000043	95.51	gold quality
cortical plate	UBERON:0005343	95.49	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	12.66

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

4 targets.

Target	Regulation
APOB
ARG1
CD34
RARB

miRNA regulators (miRDB)

195 targeting RERE, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-29A-3P	100.00	73.11	1835
HSA-MIR-29B-3P	100.00	73.18	1833
HSA-MIR-29C-3P	100.00	73.15	1833
HSA-MIR-4455	100.00	65.48	1587
HSA-MIR-3646	100.00	73.56	5283
HSA-MIR-1252-5P	100.00	69.80	2774
HSA-MIR-6748-5P	100.00	65.81	1057
HSA-MIR-9-5P	100.00	72.28	2361
HSA-MIR-12118	100.00	65.88	1270
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-3924	100.00	72.09	2394
HSA-MIR-4481	100.00	66.42	1669
HSA-MIR-6759-5P	99.99	66.54	785
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-6077	99.99	68.04	2299
HSA-MIR-186-5P	99.99	70.83	3707
HSA-MIR-12136	99.98	72.81	5713
HSA-MIR-19A-3P	99.98	75.33	2762
HSA-MIR-19B-3P	99.98	75.44	2754
HSA-MIR-3173-3P	99.98	66.49	1217
HSA-MIR-6891-5P	99.98	66.53	1372
HSA-MIR-3148	99.97	75.06	6478
HSA-MIR-6793-5P	99.97	65.95	758
HSA-MIR-6888-3P	99.97	65.95	1170
HSA-MIR-607	99.97	73.62	5593
HSA-MIR-1250-3P	99.96	70.04	4038
HSA-MIR-551B-5P	99.96	71.28	3493

Functional genomics

ClinGen dosage: haploinsufficiency 1 (little evidence), triplosensitivity Not yet evaluated (unscored). ClinGen Gene Dosage Map

Literature-anchored findings (GeneRIF, showing 2)

• The mouse ortholog of RERE is required for embryonic development (PMID:14645126)
• suggest that mutations in RERE cause a genetic syndrome and that haploinsufficiency of RERE might be sufficient to cause many of the phenotypes associated with proximal 1p36 deletions (PMID:27087320)

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio	rereb	ENSDARG00000075670
danio_rerio	rerea	ENSDARG00000077353
mus_musculus	Rere	ENSMUSG00000039852
rattus_norvegicus	Rere	ENSRNOG00000017940
drosophila_melanogaster	Gug	FBGN0010825
caenorhabditis_elegans		WBGENE00001194

Paralogs (1): ATN1 (ENSG00000111676)

Protein

Protein identifiers

Arginine-glutamic acid dipeptide repeats protein — Q9P2R6 (reviewed: Q9P2R6)

Alternative names: Atrophin-1-like protein, Atrophin-1-related protein

All UniProt accessions (13): Q9P2R6, A0A075B770, A0A590UJ84, A0A590UK57, A0A994J475, A0A994J792, B1AKN3, D6RA28, H0Y975, H7BYW9, K7EIE3, K7EIQ4, K7EJQ1

UniProt curated annotations — full annotation on UniProt →

Function. Plays a role as a transcriptional repressor during development. May play a role in the control of cell survival. Overexpression of RERE recruits BAX to the nucleus particularly to POD and triggers caspase-3 activation, leading to cell death.

Subunit / interactions. Interacts with HDAC1. Interacts with ATN1. Interaction with ATN1 is improved when the poly-Gln region of ATN1 is extended. Interacts with FAT1.

Subcellular location. Nucleus.

Tissue specificity. Widely expressed. Expressed in tumor cell lines.

Disease relevance. A chromosomal aberration involving RERE is found in the neuroblastoma cell line NGP. Translocation t(1;15)(p36.2;q24). Neurodevelopmental disorder with or without anomalies of the brain, eye, or heart (NEDBEH) [MIM:616975] An autosomal dominant syndrome characterized by developmental delay, intellectual disability, brain anomalies, and neurological abnormalities including seizures, hypotonia, and behavioral problems such as autism spectrum disorders. Brain anomalies include abnormalities and/or thinning of the corpus callosum, diminished white matter volume, abnormal cerebellar vermis, and ventriculomegaly. Congenital defects of the eye, heart and genitourinary system are present in half of the patients. The disease may be caused by variants affecting the gene represented in this entry.

Domain organisation. The interaction with ATN1 is mediated by the coiled coil domain.

Isoforms (2)

UniProt ID	Names	Canonical?
Q9P2R6-1	1	yes
Q9P2R6-2	2

RefSeq proteins (3): NP_001036146, NP_001036147, NP_036234 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000679	Znf_GATA	Domain
IPR000949	ELM2_dom	Domain
IPR001005	SANT/Myb	Domain
IPR001025	BAH_dom	Domain
IPR002951	Atrophin-like	Family
IPR009057	Homeodomain-like_sf	Homologous_superfamily
IPR017884	SANT_dom	Domain
IPR043151	BAH_sf	Homologous_superfamily

Pfam: PF00320, PF01426, PF01448, PF03154

UniProt features (77 total): compositionally biased region 22, modified residue 19, sequence conflict 16, region of interest 4, sequence variant 4, domain 3, helix 3, cross-link 2, chain 1, zinc finger region 1, splice variant 1, coiled-coil region 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
2YQK	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9P2R6-F1	54.51	0.11

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (21): 53, 56, 120, 142, 304, 594, 600, 613, 642, 656, 675, 679, 1106, 1113, 1115, 1119, 1158, 1259, 1266, 560 …

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 819 (showing top): GOBP_DENDRITE_DEVELOPMENT, RNGTGGGC_UNKNOWN, GOBP_HINDBRAIN_DEVELOPMENT, RRAGTTGT_UNKNOWN, GOBP_METENCEPHALON_DEVELOPMENT, YAGI_AML_WITH_INV_16_TRANSLOCATION, MODULE_255, MORF_ATRX, MAZ_Q6, MODULE_317, THEILGAARD_NEUTROPHIL_AT_SKIN_WOUND_DN, GOBP_NEUROGENESIS, SRF_Q5_01, GOBP_NEURAL_PRECURSOR_CELL_PROLIFERATION, GOBP_ANATOMICAL_STRUCTURE_MATURATION

GO Biological Process (10): chromatin remodeling (GO:0006338), cerebellar Purkinje cell layer maturation (GO:0021691), cerebellar granule cell precursor proliferation (GO:0021930), radial glia guided migration of Purkinje cell (GO:0021942), branching morphogenesis of a nerve (GO:0048755), dendrite morphogenesis (GO:0048813), regulation of DNA-templated transcription (GO:0006355), cerebellum development (GO:0021549), negative regulation of DNA-templated transcription (GO:0045892), positive regulation of DNA-templated transcription (GO:0045893)

GO Molecular Function (7): chromatin binding (GO:0003682), transcription coactivator activity (GO:0003713), transcription corepressor activity (GO:0003714), zinc ion binding (GO:0008270), sequence-specific DNA binding (GO:0043565), protein binding (GO:0005515), metal ion binding (GO:0046872)

GO Cellular Component (4): histone deacetylase complex (GO:0000118), nucleus (GO:0005634), nucleoplasm (GO:0005654), nuclear body (GO:0016604)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
DNA-templated transcription	3
regulation of DNA-templated transcription	2
binding	2
transcription coregulator activity	2
nucleoplasm	2
chromatin organization	1
cerebellar Purkinje cell layer development	1
cerebellar cortex maturation	1
anatomical structure maturation	1
cell proliferation in external granule layer	1
hindbrain radial glia guided cell migration	1
morphogenesis of a branching structure	1
nervous system development	1
dendrite development	1
cell morphogenesis involved in neuron differentiation	1
neuron projection morphogenesis	1
regulation of gene expression	1
regulation of RNA biosynthetic process	1
metencephalon development	1
anatomical structure development	1
negative regulation of RNA biosynthetic process	1
positive regulation of RNA biosynthetic process	1
positive regulation of DNA-templated transcription	1
negative regulation of DNA-templated transcription	1
transition metal ion binding	1
DNA binding	1
cation binding	1
nuclear protein-containing complex	1
catalytic complex	1
intracellular membrane-bounded organelle	1
nuclear lumen	1
cellular anatomical structure	1
intracellular membraneless organelle	1

Protein interactions and networks

STRING

1448 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
RERE	HDAC2	Q92769	933
RERE	HDAC1	Q13547	903
RERE	NR2F2	P24468	881
RERE	EP300	Q09472	798
RERE	RARB	P10826	715
RERE	EHMT2	Q96KQ7	639
RERE	AUTS2	Q8WXX7	573
RERE	SLC45A1	Q9Y2W3	557
RERE	BCL11B	Q9C0K0	518
RERE	CFAP77	Q6ZQR2	497
RERE	ZNF608	Q9ULD9	490
RERE	WDR64	B1ANS9	476
RERE	BCL11A	Q9H165	476
RERE	NAGPA	Q9UK23	474
RERE	ANAPC5	Q9UJX4	423
RERE	TCEA1	P23193	423

IntAct

75 interactions, top by confidence:

A	B	Type	Score
WDR5	KMT2D	psi-mi:“MI:0914”(association)	0.910
HDAC2	KDM1A	psi-mi:“MI:0914”(association)	0.890
WDR5	SETD1A	psi-mi:“MI:0914”(association)	0.880
HDAC1	CDK2AP1	psi-mi:“MI:0914”(association)	0.840
RBBP5	KMT2D	psi-mi:“MI:0914”(association)	0.840
HDAC1	TNRC18	psi-mi:“MI:0914”(association)	0.790
DYNLL1	BLTP3B	psi-mi:“MI:0914”(association)	0.730
HDAC1	ZNF609	psi-mi:“MI:0914”(association)	0.730
WDR5	MEN1	psi-mi:“MI:0914”(association)	0.710
DYNLL2	BLTP3B	psi-mi:“MI:0914”(association)	0.640
KRTAP12-4	RERE	psi-mi:“MI:0915”(physical association)	0.560
CCDC120	RERE	psi-mi:“MI:0915”(physical association)	0.560
KRTAP6-2	RERE	psi-mi:“MI:0915”(physical association)	0.560
SNRPC	RERE	psi-mi:“MI:0915”(physical association)	0.560
RERE	EHMT2	psi-mi:“MI:0915”(physical association)	0.560
RERE	EHMT2	psi-mi:“MI:0403”(colocalization)	0.560
EHMT2	RERE	psi-mi:“MI:0915”(physical association)	0.560
CDO1	DBT	psi-mi:“MI:0914”(association)	0.530
	GNAT3	psi-mi:“MI:0915”(physical association)	0.400
RERE	LZTR1	psi-mi:“MI:0915”(physical association)	0.370
RERE	TFAP2A	psi-mi:“MI:0915”(physical association)	0.370
Wdr5	MGA	psi-mi:“MI:0914”(association)	0.350
HDAC1	TRAK1	psi-mi:“MI:0914”(association)	0.350
AUTS2	ZNF609	psi-mi:“MI:0914”(association)	0.350

BioGRID (118): RERE (Affinity Capture-MS), HDAC1 (Affinity Capture-Western), EP300 (Affinity Capture-Western), RERE (Affinity Capture-MS), RERE (Affinity Capture-MS), RERE (Affinity Capture-MS), RERE (Synthetic Lethality), RERE (Affinity Capture-MS), RERE (Affinity Capture-MS), RERE (Affinity Capture-MS), RERE (Affinity Capture-RNA), RERE (Affinity Capture-RNA), RERE (Affinity Capture-MS), RERE (Affinity Capture-MS), RERE (Affinity Capture-MS)

ESM2 similar proteins: A0A2R6X6S3, A2AM29, A2BIL7, A6QP06, B5DE93, D2H526, E1BB50, F1QW93, O60293, O60563, O60583, O93383, P25992, P42568, Q03111, Q0VBM2, Q10728, Q14693, Q14AX6, Q1L8U8, Q1LVC2, Q24595, Q3MJK5, Q5ZK36, Q62901, Q640I9, Q69ZW3, Q6DD45, Q6P1G2, Q6P2L6, Q7YZA2, Q7ZX31, Q7ZXG4, Q80TZ9, Q8BRB7, Q8HXN7, Q8NDI1, Q8WYB5, Q90YL3, Q91ZP3

Diamond homologs: O35126, P54258, P54259, Q5IS70, Q62901, Q80TZ9, Q9P2R6, A6QL72, O94776, Q13330, Q59E36, Q62599, Q6NRZ0, Q8K4B0, Q924K8, Q9BTC8, Q9R190, Q09228, Q5REE1, Q5UAK0, Q5ZKT9, Q8N108, A5PJX4, Q0GGX2, Q3U3N0, Q3UHF3, Q4R2Z8, Q4R3R9, Q7T105, Q7Z3K6, Q8N344, Q9H0D2

SIGNOR signaling

2 interactions.

A	Effect	B	Mechanism
RERE	“up-regulates activity”	BAX	relocalization
RERE	“up-regulates activity”	NOTCH1	binding

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 65 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Formation of WDR5-containing histone-modifying complexes	7	35.8×	3e-07
Deactivation of the beta-catenin transactivating complex	7	31.4×	4e-07
Epigenetic regulation of gene expression by MLL3 and MLL4 complexes	5	18.9×	3e-04
Formation of the beta-catenin:TCF transactivating complex	7	16.2×	3e-05
PKMTs methylate histone lysines	5	15.5×	6e-04
Epigenetic regulation by WDR5-containing histone modifying complexes	5	14.8×	7e-04
Differentiation of naive CD4+ T cells to T helper 2 cells (Th2 cells)	5	14.1×	8e-04
RUNX1 regulates genes involved in megakaryocyte differentiation and platelet function	5	11.6×	2e-03

GO biological processes:

GO term	Partners	Fold	FDR
transcription initiation-coupled chromatin remodeling	5	30.4×	1e-04

Disease & clinical

Clinical variants and AI predictions

ClinVar

1119 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	25
Likely pathogenic	35
Uncertain significance	605
Likely benign	276
Benign	56

Top pathogenic / likely-pathogenic (30)

Variant ID	HGVS	Classification
1686125	NM_001042681.2(RERE):c.4427C>T (p.Pro1476Leu)	Pathogenic
1686749	NM_001042681.2(RERE):c.4297C>T (p.His1433Tyr)	Pathogenic
236219	NM_001042681.2(RERE):c.2249_2270dup (p.Thr758fs)	Pathogenic
2429919	NM_001042681.2(RERE):c.2638_2644del (p.Gln880fs)	Pathogenic
2504331	NM_001042681.2(RERE):c.4456G>T (p.Glu1486Ter)	Pathogenic
2580782	NM_001042681.2(RERE):c.4307TCCACC[1] (p.1436LH[1])	Pathogenic
2663297	NM_001042681.2(RERE):c.4246C>T (p.Arg1416Ter)	Pathogenic
2802772	NM_001042681.2(RERE):c.848del (p.Gln283fs)	Pathogenic
3255047	NM_001042681.2(RERE):c.3684dup (p.Arg1229fs)	Pathogenic
3432130	NM_001042681.2(RERE):c.2752dup (p.Leu918fs)	Pathogenic
4073711	GRCh37/hg19 1p36.23(chr1:8555122-8716257)x1	Pathogenic
4075323	NM_001042681.2(RERE):c.1740G>A (p.Ser580=)	Pathogenic
4152671	NM_001042681.2(RERE):c.4092del (p.Phe1364fs)	Pathogenic
4528933	NM_001042681.2:c.-144-39763_522+14373del	Pathogenic
4629041	NM_001042681.2(RERE):c.3091C>T (p.Gln1031Ter)	Pathogenic
520976	NM_001042681.2(RERE):c.1920del (p.Ser641fs)	Pathogenic
545041	NM_001042681.2(RERE):c.4305C>G (p.His1435Gln)	Pathogenic
562002	Single allele	Pathogenic
562003	NM_001042681.2(RERE):c.248dup (p.Ser84fs)	Pathogenic
562004	NM_001042681.2(RERE):c.4300T>C (p.Ser1434Pro)	Pathogenic
562005	NM_001042681.2(RERE):c.4303C>T (p.His1435Tyr)	Pathogenic
562007	NM_001042681.2(RERE):c.4319A>G (p.Gln1440Arg)	Pathogenic
562387	NM_001042681.2(RERE):c.3039dup (p.Pro1014fs)	Pathogenic
856683	NM_001042681.2(RERE):c.72_73dup (p.Lys25fs)	Pathogenic
985303	NM_001042681.2(RERE):c.3586C>T (p.Arg1196Ter)	Pathogenic
1325005	NM_001042681.2(RERE):c.4023_4024insT (p.Asn1342Ter)	Likely pathogenic
1343634	NM_001042681.2(RERE):c.1541-1G>T	Likely pathogenic
1676519	NM_001042681.2(RERE):c.70_73dup (p.Lys25fs)	Likely pathogenic
1705338	NM_001042681.2(RERE):c.3493_3504del (p.Glu1165_Glu1168del)	Likely pathogenic
1709710	NM_001042681.2(RERE):c.2721_2722delinsAT (p.Gln908Ter)	Likely pathogenic

SpliceAI

7913 predictions. Top by Δscore:

Variant	Effect	Δscore
1:8356094:TCTTA:T	donor_loss	1.0000
1:8356095:CTTAC:C	donor_loss	1.0000
1:8356096:TTA:T	donor_loss	1.0000
1:8356097:TA:T	donor_loss	1.0000
1:8356098:A:AC	donor_gain	1.0000
1:8356099:C:CC	donor_gain	1.0000
1:8356099:C:CT	donor_loss	1.0000
1:8358912:GCCTT:G	acceptor_gain	1.0000
1:8358913:CCTTC:C	acceptor_gain	1.0000
1:8358914:CTT:C	acceptor_gain	1.0000
1:8358915:TT:T	acceptor_gain	1.0000
1:8358916:TC:T	acceptor_loss	1.0000
1:8358917:C:CC	acceptor_gain	1.0000
1:8358918:T:G	acceptor_loss	1.0000
1:8359762:A:AC	donor_gain	1.0000
1:8359763:C:CC	donor_gain	1.0000
1:8359763:CAG:C	donor_gain	1.0000
1:8360111:CCTAG:C	donor_gain	1.0000
1:8360115:G:C	donor_gain	1.0000
1:8361758:CTCAC:C	donor_loss	1.0000
1:8361759:TCA:T	donor_loss	1.0000
1:8361761:A:AC	donor_gain	1.0000
1:8361761:A:T	donor_loss	1.0000
1:8361762:C:CC	donor_gain	1.0000
1:8361872:ACCTT:A	acceptor_gain	1.0000
1:8361873:CCTTC:C	acceptor_gain	1.0000
1:8361874:CTT:C	acceptor_gain	1.0000
1:8361875:TT:T	acceptor_gain	1.0000
1:8361877:C:CC	acceptor_gain	1.0000
1:8361881:A:T	acceptor_gain	1.0000

AlphaMissense

10216 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
1:8358756:G:T	A1260D	1.000
1:8358777:A:G	L1253P	1.000
1:8358777:A:T	L1253H	1.000
1:8358780:G:T	A1252D	1.000
1:8359983:G:C	F1133L	1.000
1:8359983:G:T	F1133L	1.000
1:8359984:A:G	F1133S	1.000
1:8359985:A:G	F1133L	1.000
1:8360115:G:T	A1131D	1.000
1:8360123:G:C	S1128R	1.000
1:8360123:G:T	S1128R	1.000
1:8360125:T:G	S1128R	1.000
1:8364128:G:C	F556L	1.000
1:8364128:G:T	F556L	1.000
1:8364129:A:C	F556C	1.000
1:8364129:A:G	F556S	1.000
1:8364130:A:C	F556V	1.000
1:8364130:A:G	F556L	1.000
1:8364134:A:C	F554L	1.000
1:8364134:A:T	F554L	1.000
1:8364135:A:G	F554S	1.000
1:8364136:A:G	F554L	1.000
1:8364198:C:G	R533P	1.000
1:8364199:G:T	R533S	1.000
1:8364200:A:C	C532W	1.000
1:8364201:C:A	C532F	1.000
1:8364201:C:G	C532S	1.000
1:8364201:C:T	C532Y	1.000
1:8364202:A:G	C532R	1.000
1:8364202:A:T	C532S	1.000

dbSNP variants (sampled 300 via entrez): RS1000001200 (1:8468783 G>A), RS1000002720 (1:8779563 TGAGACAGGAGAATTGCTTGAACCTGGGAGGCG>T), RS1000014301 (1:8703602 C>A), RS1000015821 (1:8641726 C>T), RS1000021430 (1:8378430 T>C), RS1000021947 (1:8490741 T>A), RS1000023159 (1:8450145 G>A), RS1000028063 (1:8368536 A>G), RS1000028769 (1:8407582 C>T), RS1000046328 (1:8492735 A>G), RS1000052471 (1:8620268 T>C), RS1000066669 (1:8404211 C>T), RS1000066695 (1:8465791 T>C), RS1000067927 (1:8641337 A>G), RS1000077372 (1:8731904 G>A)

Disease associations

OMIM: gene MIM:605226 | disease phenotypes: MIM:616975

GenCC curated gene-disease

Disease	Classification	Inheritance
neurodevelopmental disorder with or without anomalies of the brain, eye, or heart	Definitive	Autosomal dominant

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
complex neurodevelopmental disorder with or without congenital anomalies	Definitive	AD

Mondo (6): neurodevelopmental disorder with or without anomalies of the brain, eye, or heart (MONDO:0014857), intellectual disability (MONDO:0001071), neurodevelopmental disorder (MONDO:0700092), cleft palate (MONDO:0016064), CHARGE syndrome (MONDO:0008965), autism spectrum disorder (MONDO:0005258)

Orphanet (5): RERE-related neurodevelopmental syndrome (Orphanet:494344), Cleft palate (Orphanet:2014), CHARGE syndrome (Orphanet:138), NON RARE IN EUROPE: Unexplained intellectual disability (Orphanet:319658), NON RARE IN EUROPE: Autism (Orphanet:106)

HPO phenotypes

182 total (30 of 182 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000028	Cryptorchidism
HP:0000041	Chordee
HP:0000047	Hypospadias
HP:0000055	Abnormal female external genitalia morphology
HP:0000076	Vesicoureteral reflux
HP:0000077	Abnormality of the kidney
HP:0000089	Renal hypoplasia
HP:0000098	Tall stature
HP:0000107	Renal cyst
HP:0000119	Abnormality of the genitourinary system
HP:0000126	Hydronephrosis
HP:0000135	Hypogonadism
HP:0000160	Narrow mouth
HP:0000187	Broad alveolar ridges
HP:0000218	High palate
HP:0000221	Furrowed tongue
HP:0000248	Brachycephaly
HP:0000252	Microcephaly
HP:0000256	Macrocephaly
HP:0000270	Delayed cranial suture closure
HP:0000286	Epicanthus
HP:0000307	Pointed chin
HP:0000316	Hypertelorism
HP:0000319	Smooth philtrum
HP:0000325	Triangular face
HP:0000343	Long philtrum
HP:0000347	Micrognathia
HP:0000349	Widow’s peak
HP:0000358	Posteriorly rotated ears

GWAS associations

77 associations (top):

Study	Trait	p-value
GCST000662_2	Vitiligo	7.000000e-15
GCST000700_7	Vertical cup-disc ratio	6.000000e-08
GCST001877_69	Autism spectrum disorder, attention deficit-hyperactivity disorder, bipolar disorder, major depressive disorder, and schizophrenia (combined)	5.000000e-07
GCST002626_16	Vertical cup-disc ratio	2.000000e-08
GCST002762_22	Optic cup area	3.000000e-08
GCST002762_7	Optic cup area	5.000000e-09
GCST003990_8	Allergy	2.000000e-12
GCST003995_27	Tonsillectomy	6.000000e-09
GCST004137_46	Optic cup area	6.000000e-08
GCST004137_6	Optic cup area	1.000000e-09
GCST004521_274	Autism spectrum disorder or schizophrenia	7.000000e-09
GCST004600_54	Eosinophil percentage of white cells	2.000000e-19
GCST004606_182	Eosinophil count	2.000000e-12
GCST004610_76	White blood cell count	8.000000e-10
GCST004617_48	Eosinophil percentage of granulocytes	1.000000e-16
GCST004623_142	Neutrophil percentage of granulocytes	4.000000e-16
GCST004624_168	Sum eosinophil basophil counts	3.000000e-11
GCST004627_119	Lymphocyte count	1.000000e-11
GCST004785_43	Vitiligo	4.000000e-15
GCST004946_126	Schizophrenia	5.000000e-11
GCST005014_33	Tonsillectomy	6.000000e-09
GCST005038_2	Allergic disease (asthma, hay fever or eczema)	2.000000e-20
GCST005348_24	Total body bone mineral density	5.000000e-08
GCST005839_23	Depression	3.000000e-08
GCST006041_6	Major depressive disorder	2.000000e-09
GCST006107_14	Upper eyelid morphology	7.000000e-07
GCST006107_3	Upper eyelid morphology	2.000000e-06
GCST006288_593	Heel bone mineral density	1.000000e-18
GCST006288_700	Heel bone mineral density	2.000000e-14
GCST006288_96	Heel bone mineral density	3.000000e-06

EFO canonical traits (25, from GWAS)

EFO ID	Trait name
EFO:0007924	tonsillectomy risk measurement
EFO:0007991	eosinophil percentage of leukocytes
EFO:0004842	eosinophil count
EFO:0007996	eosinophil percentage of granulocytes
EFO:0007994	neutrophil percentage of granulocytes
EFO:0005090	basophil count
EFO:0004587	lymphocyte count
EFO:0009270	heel bone mineral density
EFO:0009598	feeling miserable measurement
EFO:0005035	hippocampal volume
EFO:0006336	diastolic blood pressure
EFO:0006335	systolic blood pressure
EFO:0004318	smoking behavior
EFO:0005670	smoking initiation
EFO:0007785	femoral neck bone mineral density
EFO:1002011	adult onset asthma
EFO:0009941	Inhalant adrenergic use measurement
EFO:0007865	loneliness measurement
EFO:0006939	cup-to-disc ratio measurement
EFO:0008111	diet measurement
EFO:0009819	comparative body size at age 10, self-reported
EFO:0006501	carotid plaque build
EFO:0007828	daytime rest measurement
EFO:0004980	appendicular lean mass
EFO:0004833	neutrophil count

MeSH disease descriptors (4)

Descriptor	Name	Tree numbers
D058747	CHARGE Syndrome	C09.218.458.341.186.500.250; C10.597.751.418.341.186.500.250; C10.597.751.941.162.625.250; C11.270.147.500; C11.966.075.375.250; C16.131.077.299.250; C16.320.165; C23.888.592.763.393.341.186.500.500; C23.888.592.763.941.162.625.500
D002972	Cleft Palate	C05.500.460.185; C05.660.207.540.460.185; C07.320.440.185; C07.465.525.185; C07.650.500.460.185; C07.650.525.185; C16.131.621.207.540.460.185; C16.131.850.500.460.185; C16.131.850.525.185
D008607	Intellectual Disability	C10.597.606.360; C23.888.592.604.646; F01.700.687; F03.625.539
D065886	Neurodevelopmental Disorders	F03.625

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

49 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects cotreatment, decreases expression, affects expression, decreases methylation	5
Air Pollutants	affects cotreatment, increases abundance, increases expression, affects expression	3
Ozone	affects cotreatment, increases expression, increases abundance, affects expression	3
bisphenol F	increases methylation, affects cotreatment, decreases expression	2
bisphenol A	affects methylation, affects cotreatment, increases methylation, decreases expression	2
sodium arsenite	decreases expression, increases expression	2
methacrylaldehyde	increases abundance, affects cotreatment, increases expression	2
Arsenic Trioxide	increases expression, increases sumoylation	2
Acetaminophen	increases expression, decreases expression	2
Acrolein	affects cotreatment, increases expression, increases abundance	2
Arsenic	decreases methylation, increases abundance, affects methylation	2
Benzo(a)pyrene	affects methylation, decreases expression	2
Aflatoxin B1	decreases methylation, increases methylation	2
Cadmium Chloride	increases expression	2
Particulate Matter	affects cotreatment, increases abundance, increases expression	2
6,7-dimethoxy-2-(pyrrolidin-1-yl)-N-(5-(pyrrolidin-1-yl)pentyl)quinazolin-4-amine	decreases expression	1
FR900359	affects phosphorylation	1
dicrotophos	increases expression	1
triphenyl phosphate	affects expression	1
alpha-pinene	affects cotreatment, increases expression, increases abundance	1
pirinixic acid	increases expression, affects binding, increases activity	1
trichostatin A	decreases expression	1
arsenite	affects binding, decreases reaction	1
mono-(2-ethylhexyl)phthalate	decreases methylation, increases abundance	1
sulindac sulfide	decreases expression	1
coumarin	increases phosphorylation	1
di-n-butylphosphoric acid	affects expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
dorsomorphin	affects cotreatment, decreases expression	1
Sunitinib	increases expression	1

Cellosaurus cell lines

3 cell lines: 3 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_F1UR	HyCyte U-251MG KO-hRERE	Cancer cell line	Male
CVCL_TI82	HAP1 RERE (-) 1	Cancer cell line	Male
CVCL_XS23	HAP1 RERE (-) 2	Cancer cell line	Male

Clinical trials (associated diseases)

298 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT05657860	PHASE4	COMPLETED	Guanfacine Extended Release for the Reduction of Aggression and Self-injurious Behavior Associated With Prader-Willi Syndrome
NCT05744479	PHASE4	RECRUITING	Metformin for Antipsychotic-induced Weight Gain in Adults With Intellectual Disability
NCT06107829	PHASE4	WITHDRAWN	Valbenazine Treatment of Tardive Dyskinesia in Adults With Intellectual/Developmental Disabilities
NCT06997198	PHASE4	NOT_YET_RECRUITING	Deutetrabenazine Treatment for Tardive Dyskinesia in Intellectual/Developmental Disabilities
NCT04586348	PHASE4	UNKNOWN	Prenatal Iodine Supplementation and Early Childhood Neurodevelopment
NCT04873115	PHASE4	UNKNOWN	Double-blind, Placebo-controlled, Randomized Clinical Trial Comparing the Efficacy and Safety of Sialanar Plus orAl rehabiLitation Against Placebo Plus Oral Rehabilitation for chIldren and Adolescents With seVere Sialorrhoea and Neurodisabilties,
NCT02270736	PHASE3	COMPLETED	Clinical Study to Investigate the Efficacy and Safety of NT 201 Compared to Placebo in the Treatment of Chronic Troublesome Drooling Associated With Neurological Disorders and/or Intellectual Disability
NCT02559102	PHASE3	COMPLETED	Dexmedetomidine Sedation Versus General Anaesthesia for Inguinal Hernia Surgery in Infants
NCT02757079	PHASE3	COMPLETED	Study of the Efficacy and Safety of NPC-15 for Sleep Disorders of Children With Neurodevelopmental Disorders
NCT06915480	PHASE3	RECRUITING	Reducing Missed Appointments
NCT07377032	PHASE3	RECRUITING	TAP-GRIN: Interventional Study on Patients With GRIN-related Neurodevelopmental Disorders
NCT02304302	PHASE2	COMPLETED	Down Syndrome Memantine Follow-up Study
NCT03862950	PHASE2	COMPLETED	A Trial of Metformin in Individuals With Fragile X Syndrome (Met)
NCT04529226	PHASE2	UNKNOWN	Study to Compare Clozapine vs Treatment as Usual in People With Intellectual Disability & Treatment-resistant Psychosis
NCT04821856	PHASE2	COMPLETED	Evaluation of the Effectiveness of Cannabidiol in Treating Severe Behavioural Problems in Children and Adolescents With Intellectual Disability
NCT02909959	PHASE2	COMPLETED	Sulforaphane for the Treatment of Young Men With Autism Spectrum Disorder
NCT06081348	PHASE2	RECRUITING	Sertraline vs. Placebo in the Treatment of Anxiety in Children and AdoLescents With NeurodevelopMental Disorders
NCT06352372	PHASE2	COMPLETED	Safety and Efficacy of tPBM for Epileptiform Activity in Autism
NCT05273320	PHASE1	COMPLETED	Clinical Trial of Nabilone for Aggression in Adults With Intellectual and Developmental Disabilities
NCT05301361	PHASE1	ENROLLING_BY_INVITATION	Sensitivity of the NIH Toolbox to Stimulant Treatment in Intellectual Disabilities
NCT06016764	PHASE1	COMPLETED	Use of MRI and cTBS for Catatonia in Autism
NCT06586827	PHASE1	COMPLETED	Impact of Competency-Based Training and Technical Assistance Employment Outcomes of Individuals With ID/DD
NCT07531940	PHASE1	NOT_YET_RECRUITING	Escalating Doses of Memantine in Down Syndrome (MEDS-123)
NCT00503191	PHASE1	COMPLETED	NeuroModulation Technique Treatment of Autism
NCT04475848	PHASE1	COMPLETED	A Study to Investigate the Safety, Tolerability, Pharmacokinetics, Pharmacodynamics and Food Effect of RO6953958 in Healthy Participants
NCT06300398	PHASE1	COMPLETED	IAMA-6 Oral Dose Study in Healthy Adults
NCT03479476	PHASE2/PHASE3	COMPLETED	A Trial of Metformin in Individuals With Fragile X Syndrome
NCT02616796	PHASE1/PHASE2	COMPLETED	Effects of Social Gaze Training on Brain and Behavior in Fragile X Syndrome
NCT06860672	EARLY_PHASE1	RECRUITING	Clinical Trial of the Dual Vector Base Editor for the Treatment of the CHD3-R1025W Mutation
NCT00597948	Not specified	COMPLETED	Healthy Lifestyles for People With Intellectual Disabilities
NCT01087320	Not specified	RECRUITING	Genome Medical Sequencing for Gene Discovery
NCT01652963	Not specified	UNKNOWN	Picture-based Computerised Assessment and Training of Cognitive Behaviour Therapy Skills
NCT01695395	Not specified	COMPLETED	Mental Health Care Provision for Adults With Intellectual Disability and a Mental Disorder
NCT01867554	Not specified	COMPLETED	Research and Characterization of New Genes Involved in Intellectual Disability
NCT01915381	Not specified	COMPLETED	Improving Adherence Healthy Lifestyle With a Smartphone Application Based on Adults With Intellectual Disabilities
NCT01988623	Not specified	COMPLETED	Pivotal Response Treatment for Individuals With Intellectual Disabilities
NCT02099773	Not specified	COMPLETED	Support Staff-client Interactions With Augmentative and Alternative Communication
NCT02136849	Not specified	COMPLETED	Inter-regional Project of the Great Western Exploration Approach for Exome Molecular Causes Severe Intellectual Disability Isolated or Syndromic
NCT02225041	Not specified	COMPLETED	Sedation Strategy and Cognitive Outcome After Critical Illness in Early Childhood
NCT02414438	Not specified	COMPLETED	Establishing the Clinical Utility of First StepDx PLUS and NextStepDx PLUS Study