RGS9

Summary

RGS9 (regulator of G protein signaling 9, HGNC:10004) is a protein-coding gene on chromosome 17q24.1, encoding Regulator of G-protein signaling 9 (O75916). Inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits thereby driving them into their inactive GDP-bound form.

This gene encodes a member of the RGS family of GTPase activating proteins that function in various signaling pathways by accelerating the deactivation of G proteins. This protein is anchored to photoreceptor membranes in retinal cells and deactivates G proteins in the rod and cone phototransduction cascades. Mutations in this gene result in bradyopsia. Multiple transcript variants encoding different isoforms have been found for this gene.

Source: NCBI Gene 8787 — RefSeq curated summary.

At a glance

• Gene–disease (curated): prolonged electroretinal response suppression 1 (Definitive, GenCC) — +1 more curated relationship
• GWAS associations: 4
• Clinical variants (ClinVar): 583 total — 20 pathogenic, 19 likely-pathogenic
• Phenotypes (HPO): 7
• MANE Select transcript: NM_003835

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:10004
Approved symbol	RGS9
Name	regulator of G protein signaling 9
Location	17q24.1
Locus type	gene with protein product
Status	Approved
Aliases	PERRS, RGS9L, MGC26458, MGC111763
Ensembl gene	ENSG00000108370
Ensembl biotype	protein_coding
OMIM	604067
Entrez	8787

Gene structure

Transcript identifiers

Ensembl transcripts: 14 — 6 protein_coding, 4 protein_coding_CDS_not_defined, 3 retained_intron, 1 nonsense_mediated_decay

ENST00000262406, ENST00000443584, ENST00000449996, ENST00000577186, ENST00000577595, ENST00000581175, ENST00000582940, ENST00000583473, ENST00000584234, ENST00000635833, ENST00000637818, ENST00000638125, ENST00000929634, ENST00000929635

RefSeq mRNA: 3 — MANE Select: NM_003835 NM_001081955, NM_001165933, NM_003835

CCDS: CCDS42373, CCDS45764

Canonical transcript exons

ENST00000262406 — 19 exons

Exon	Start	End
ENSE00002711009	65227275	65227703
ENSE00002712625	65137370	65137597
ENSE00003498355	65168200	65168281
ENSE00003508908	65160536	65160587
ENSE00003513266	65160233	65160339
ENSE00003513810	65153422	65153518
ENSE00003516389	65225002	65225486
ENSE00003555768	65158295	65158345
ENSE00003559838	65210488	65210605
ENSE00003586605	65163013	65163089
ENSE00003589765	65207922	65208007
ENSE00003592332	65197126	65197241
ENSE00003621226	65193543	65193656
ENSE00003623350	65189286	65189315
ENSE00003639539	65204163	65204301
ENSE00003671732	65160851	65160909
ENSE00003676332	65190175	65190236
ENSE00003677753	65201993	65202080
ENSE00003691363	65177732	65177803

Expression profiles

Bgee: expression breadth ubiquitous, 178 present calls, max score 94.90.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 5.0553 / max 98.4624, expressed in 1296 samples.

FANTOM5 promoters (5 alternative TSS)

Promoter ID	TPM avg	Samples expressed
162279	2.8702	1127
162282	1.1822	389
162281	0.7627	285
162280	0.1550	56
162283	0.0853	25

Top tissues by expression

285 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
putamen	UBERON:0001874	94.90	gold quality
caudate nucleus	UBERON:0001873	94.40	gold quality
islet of Langerhans	UBERON:0000006	94.32	gold quality
nucleus accumbens	UBERON:0001882	92.94	gold quality
lower esophagus muscularis layer	UBERON:0035833	85.55	gold quality
lower esophagus	UBERON:0013473	85.48	gold quality
left uterine tube	UBERON:0001303	84.83	gold quality
granulocyte	CL:0000094	84.64	gold quality
mucosa of stomach	UBERON:0001199	84.56	gold quality
endometrium epithelium	UBERON:0004811	84.52	silver quality
esophagogastric junction muscularis propria	UBERON:0035841	84.30	gold quality
muscle layer of sigmoid colon	UBERON:0035805	82.95	gold quality
adenohypophysis	UBERON:0002196	82.94	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	82.80	gold quality
right lung	UBERON:0002167	82.65	gold quality
middle frontal gyrus	UBERON:0002702	82.52	gold quality
pituitary gland	UBERON:0000007	82.31	gold quality
calcaneal tendon	UBERON:0003701	81.43	gold quality
left adrenal gland cortex	UBERON:0035825	81.31	gold quality
right adrenal gland cortex	UBERON:0035827	80.60	gold quality
right adrenal gland	UBERON:0001233	80.50	gold quality
spinal cord	UBERON:0002240	80.50	gold quality
left adrenal gland	UBERON:0001234	80.41	gold quality
hypothalamus	UBERON:0001898	79.91	gold quality
tibial nerve	UBERON:0001323	79.75	gold quality
adrenal cortex	UBERON:0001235	79.59	gold quality
paraflocculus	UBERON:0005351	79.49	silver quality
sural nerve	UBERON:0015488	79.00	gold quality
colonic epithelium	UBERON:0000397	78.99	gold quality
frontal pole	UBERON:0002795	78.52	gold quality

Single-cell (SCXA)

Detected in 3 experiment(s), a significant marker in 3.

Experiment	Marker?	Max mean expression
E-MTAB-7316	yes	31.50
E-GEOD-137537	yes	22.39
E-ANND-3	yes	5.50

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

19 targeting RGS9, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3064-3P	100.00	70.09	1254
HSA-MIR-7152-3P	99.97	67.47	849
HSA-MIR-548AT-5P	99.96	70.83	2666
HSA-MIR-3910	99.95	71.13	2227
HSA-MIR-124-3P	99.89	73.74	3043
HSA-MIR-506-3P	99.89	73.55	3057
HSA-MIR-4728-5P	99.85	69.39	4718
HSA-MIR-6785-5P	99.82	68.68	4428
HSA-MIR-7856-5P	99.75	69.99	2901
HSA-MIR-149-3P	99.72	68.22	3963
HSA-MIR-3714	99.71	70.74	2671
HSA-MIR-6883-5P	99.69	68.05	3785
HSA-MIR-4325	99.49	72.20	1342
HSA-MIR-3182	99.40	68.15	2454
HSA-MIR-663B	97.40	62.91	664
HSA-MIR-597-3P	96.46	68.03	1035
HSA-MIR-6879-3P	93.93	64.00	759
HSA-MIR-516A-5P	93.40	64.96	90
HSA-MIR-6854-3P	90.99	65.18	155

Literature-anchored findings (GeneRIF, showing 15)

• five unrelated patients with recessive mutations in the genes encoding either RGS9 or R9AP who report difficulty adapting to sudden changes in luminance levels mediated by cones (PMID:14702087)
• under certain conditions, RGS9 and Gbeta5 may possibly function as betagamma dimer (PMID:15474482)
• homozygous mutations in RGS9 gene that encodes the photoreceptor GTPase accelerating protein and its anchor protein, respectively, have been identifird in patients with bradyopsia. (PMID:17698770)
• In the haplotype analysis, a significant association of the AGG haplotype (rs8077696-rs8070231-rs2292593) of the RGS9 gene was found (permutation P = 0.007) (PMID:18548510)
• This is the first report describing a nonsense mutation in RGS9. (PMID:19818506)
• no association with schizophrenia in an Israeli Jewish population (PMID:20016399)
• The main goal of this review is to illustrate how various functions are fulfilled through the interplay between the intrinsic molecular properties of RGS9 isoforms. (PMID:20374717)
• The expression of RGS9-2 inhibits dopamine-mediated cellular internalization of the dopamine 2 (D2) receptor. (PMID:20477943)
• Type 5 G protein beta subunit (Gbeta5) controls the interaction of regulator of G protein signaling 9 (RGS9) with membrane anchors (PMID:21511947)
• beta-Arrestin2 is required for the inhibition of D3R signaling by RGS9-2. (PMID:22006018)
• These studies with humans, rats and mice implicate RGS9-2 as a factor in regulating body weight. (PMID:22132185)
• the GAP activity of RGS9-2 showed a strong receptor preference for D2R over MOR. Finally, RGS7 displayed an four times greater GAP activity relative to RGS9-2. (PMID:23857581)
• These findings indicate a role for RGS9 gene polymorphisms in heroin dependence and may be informative for future genetic or biological studies on heroin dependence. (PMID:25591550)
• To identify single-nucleotide polymorphisms that contribute to the genetic susceptibility to schizophrenia, we examined the potential association between schizophrenia and 9 single nucleotide polymorphisms in the G-protein signaling 9 gene (PMID:26345773)
• This case series highlights the clinical presentations and features of 5 affected children (3 Arab families) who harbored the same homozygous RGS9 frameshift mutation, which seems to represent a founder effect for the Arabian Peninsula. (PMID:29107794)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	rgs9a	ENSDARG00000037925
danio_rerio	rgs9b	ENSDARG00000045156
mus_musculus	Rgs9	ENSMUSG00000020599
rattus_norvegicus	Rgs9	ENSRNOG00000003800

Paralogs (23): RGS11 (ENSG00000076344), RGS1 (ENSG00000090104), RGS17 (ENSG00000091844), AXIN1 (ENSG00000103126), RGS2 (ENSG00000116741), RGS4 (ENSG00000117152), RGSL1 (ENSG00000121446), RGS13 (ENSG00000127074), RGS22 (ENSG00000132554), RGS8 (ENSG00000135824), RGS3 (ENSG00000138835), RGS5 (ENSG00000143248), RGS16 (ENSG00000143333), RGS20 (ENSG00000147509), RGS10 (ENSG00000148908), RGS18 (ENSG00000150681), RGS12 (ENSG00000159788), AXIN2 (ENSG00000168646), RGS14 (ENSG00000169220), RGS19 (ENSG00000171700), RGS6 (ENSG00000182732), RGS7 (ENSG00000182901), RGS21 (ENSG00000253148)

Protein

Protein identifiers

Regulator of G-protein signaling 9 — O75916 (reviewed: O75916)

All UniProt accessions (4): O75916, A0A1B0GVU3, E9PD91, J3QL70

UniProt curated annotations — full annotation on UniProt →

Function. Inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits thereby driving them into their inactive GDP-bound form. Binds to GNAT1. Involved in phototransduction; key element in the recovery phase of visual transduction.

Subunit / interactions. Heterodimer with GNB5. Interacts with RGS7BP, leading to regulate the subcellular location of the heterodimer formed with GNB5. Component of the RGS9-1-Gbeta5 complex composed of RGS9 (RGS9-1), Gbeta5 (GNB5) and RGS9BP. Interacts with PDE6G and GNAT1.

Subcellular location. Membrane.

Tissue specificity. Highly expressed in the caudate and putamen, lower levels found in the hypothalamus and nucleus accumbens and very low levels in cerebellum. Not expressed in globus pallidus or cingulate cortex. Isoform 2 is expressed predominantly in pineal gland and retina. Isoform 3 is expressed in retina (abundant in photoreceptors).

Post-translational modifications. Retinal isoform 3 is light-dependent phosphorylated at ‘Ser-478’. Phosphorylation is decreased by light exposition.

Disease relevance. Prolonged electroretinal response suppression 1 (PERRS1) [MIM:608415] A form of bradyopsia, an ocular disorder characterized by prolonged electroretinal response suppression leading to difficulties adjusting to changes in luminance, normal to subnormal acuity and photophobia. PERRS1 is an autosomal recessive form with onset in childhood. The disease is caused by variants affecting the gene represented in this entry.

Domain organisation. In photoreceptor cells the DEP domain is essential for targeting RGS9 to the outer rod segments.

Isoforms (5)

UniProt ID	Names	Canonical?
O75916-1	1, RGS9L	yes
O75916-2	2, RGS9S
O75916-3	3, RGS9-1
O75916-4	4
O75916-5	5

RefSeq proteins (3): NP_001075424, NP_001159405, NP_003826* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000591	DEP_dom	Domain
IPR015898	G-protein_gamma-like_dom	Domain
IPR016137	RGS	Domain
IPR036284	GGL_sf	Homologous_superfamily
IPR036305	RGS_sf	Homologous_superfamily
IPR036388	WH-like_DNA-bd_sf	Homologous_superfamily
IPR036390	WH_DNA-bd_sf	Homologous_superfamily
IPR040759	RGS_DHEX	Domain
IPR044926	RGS_subdomain_2	Homologous_superfamily
IPR047016	RGS6/7/9/11	Family
IPR047017	RGS6/7/9/11_DHEX_sf	Homologous_superfamily
IPR047077	RGS9_RGS	Domain

Pfam: PF00610, PF00615, PF00631, PF18148

UniProt features (34 total): sequence conflict 21, splice variant 5, domain 3, sequence variant 2, chain 1, region of interest 1, compositionally biased region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O75916-F1	74.35	0.59

Function

Pathways and Gene Ontology

Reactome pathways

3 pathways

ID	Pathway
R-HSA-418594	G alpha (i) signalling events
R-HSA-6814122	Cooperation of PDCL (PhLP1) and TRiC/CCT in G-protein beta folding
R-HSA-2514859	Inactivation, recovery and regulation of the phototransduction cascade

MSigDB gene sets: 211 (showing top): GOBP_RESPONSE_TO_NITROGEN_COMPOUND, BENPORATH_ES_WITH_H3K27ME3, GOBP_RESPONSE_TO_ESTRADIOL, GOBP_RESPONSE_TO_AMINE, GOBP_CELLULAR_RESPONSE_TO_LIGHT_STIMULUS, IVANOVA_HEMATOPOIESIS_LATE_PROGENITOR, GOBP_CELLULAR_RESPONSE_TO_OXYGEN_CONTAINING_COMPOUND, PID_CONE_PATHWAY, GOBP_MONOATOMIC_CATION_TRANSPORT, MODULE_379, GOBP_REGULATION_OF_CALCIUM_ION_TRANSMEMBRANE_TRANSPORT, BLALOCK_ALZHEIMERS_DISEASE_UP, GOBP_RESPONSE_TO_AMPHETAMINE, GOBP_SENSORY_PERCEPTION_OF_LIGHT_STIMULUS, GOBP_RESPONSE_TO_OXYGEN_CONTAINING_COMPOUND

GO Biological Process (12): response to amphetamine (GO:0001975), G protein-coupled receptor signaling pathway (GO:0007186), G protein-coupled dopamine receptor signaling pathway (GO:0007212), nervous system development (GO:0007399), visual perception (GO:0007601), regulation of G protein-coupled receptor signaling pathway (GO:0008277), negative regulation of signal transduction (GO:0009968), response to estradiol (GO:0032355), intracellular signal transduction (GO:0035556), light adaption (GO:0036367), regulation of calcium ion export across plasma membrane (GO:1905912), dark adaptation (GO:1990603)

GO Molecular Function (3): GTPase activity (GO:0003924), GTPase activator activity (GO:0005096), protein binding (GO:0005515)

GO Cellular Component (7): cytoplasm (GO:0005737), plasma membrane (GO:0005886), presynaptic membrane (GO:0042734), neuron projection (GO:0043005), postsynaptic density membrane (GO:0098839), glutamatergic synapse (GO:0098978), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-3 pathways:

Category	Pathways
GPCR downstream signalling	1
Chaperonin-mediated protein folding	1
The phototransduction cascade	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
signal transduction	3
G protein-coupled receptor signaling pathway	2
regulation of signal transduction	2
intracellular anatomical structure	2
cellular anatomical structure	2
response to amine	1
G protein-coupled receptor activity	1
synaptic transmission, dopaminergic	1
cellular response to dopamine	1
system development	1
sensory perception of light stimulus	1
negative regulation of cell communication	1
negative regulation of signaling	1
negative regulation of response to stimulus	1
response to lipid	1
response to oxygen-containing compound	1
response to light intensity	1
regulation of calcium ion transmembrane transport	1
calcium ion export across plasma membrane	1
cellular response to absence of light	1
ribonucleoside triphosphate phosphatase activity	1
GTPase activity	1
enzyme activator activity	1
GTPase regulator activity	1
binding	1
membrane	1
cell periphery	1
synaptic membrane	1
presynapse	1
plasma membrane bounded cell projection	1
postsynaptic density	1
postsynaptic membrane	1
postsynaptic specialization membrane	1
synapse	1

Protein interactions and networks

STRING

764 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
RGS9	GNB5	O14775	973
RGS9	RGS9BP	Q6ZS82	967
RGS9	GGT5	P36269	712
RGS9	GLYATL1	Q969I3	685
RGS9	CACNA1B	Q00975	677
RGS9	CHRM2	P08172	648
RGS9	DRD2	P14416	645
RGS9	RGS7BP	Q6MZT1	595
RGS9	SHISAL2B	A6NKW6	506
RGS9	GUCY2F	P51841	497
RGS9	RHO	P08100	462
RGS9	SAG	P10523	462
RGS9	PLEK2	Q9NYT0	439
RGS9	GRK7	Q8WTQ7	430
RGS9	GUCY2D	Q02846	428

IntAct

8 interactions, top by confidence:

A	B	Type	Score
RGS9	GNB5	psi-mi:“MI:0914”(association)	0.500
RGS9	GNB5	psi-mi:“MI:0915”(physical association)	0.500
RGS9	Dlg4	psi-mi:“MI:0407”(direct interaction)	0.440
RGS9	SF3A3	psi-mi:“MI:0915”(physical association)	0.400
HSP90AB1	RGS9	psi-mi:“MI:0915”(physical association)	0.400
ATG16L1	ESYT2	psi-mi:“MI:0914”(association)	0.350
PRPF40B	GNB5	psi-mi:“MI:0914”(association)	0.350

BioGRID (23): RGS9 (Affinity Capture-MS), GNB5 (Affinity Capture-MS), RBM25 (Affinity Capture-MS), ACTN2 (Two-hybrid), RGS9 (Affinity Capture-Western), ACTN2 (Affinity Capture-Western), GRIN1 (Affinity Capture-Western), ACTN4 (Affinity Capture-Western), SF3A3 (Proximity Label-MS), RGS9 (Reconstituted Complex), RGS9 (Affinity Capture-MS), RBM25 (Affinity Capture-MS), GNB5 (Affinity Capture-MS), RGS9 (Affinity Capture-MS), RGS9 (Affinity Capture-Western)

ESM2 similar proteins: A0A494C086, A0A494C0Z2, A0A494C191, A0JPH4, A6NHP3, A6NIY4, A6NJR5, A6NLX3, A6NNV3, A6QLI5, B0BNE4, O08918, O60543, O70302, O75916, P0CI01, P0DTA3, P0DUD1, P0DUD2, P0DUD3, P0DUD4, P0DUX0, P0DUX1, P0DV79, P24864, P39949, P49805, Q12967, Q495Y7, Q495Y8, Q4VXA5, Q4ZIN3, Q5IBH6, Q5IBH7, Q5MJ70, Q5SYB0, Q5XIQ2, Q5ZJR9, Q61457, Q6AYG1

Diamond homologs: A1A643, F1S668, O08773, O08774, O08849, O08850, O08899, O14921, O14924, O15169, O15492, O15539, O35625, O42400, O43566, O43665, O46469, O46470, O46471, O54828, O54829, O70239, O70240, O70521, O75916, O76081, O88566, O94810, P34295, P41220, P49758, P49795, P49796, P49797, P49798, P49799, P49800, P49802, P49803, P49804

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

583 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	20
Likely pathogenic	19
Uncertain significance	259
Likely benign	240
Benign	17

Top pathogenic / likely-pathogenic (30)

Variant ID	HGVS	Classification
1021744	NM_003835.4(RGS9):c.1546C>T (p.Arg516Ter)	Pathogenic
1345944	NM_003835.4(RGS9):c.407del (p.Leu136fs)	Pathogenic
1357210	NM_003835.4(RGS9):c.1681del (p.Leu561fs)	Pathogenic
1417337	NM_003835.4(RGS9):c.619C>T (p.Arg207Ter)	Pathogenic
1464938	NM_003835.4(RGS9):c.327G>A (p.Trp109Ter)	Pathogenic
1487790	NM_003835.4(RGS9):c.239del (p.Tyr80fs)	Pathogenic
1490395	NM_003835.4(RGS9):c.310C>T (p.Gln104Ter)	Pathogenic
2032028	NM_003835.4(RGS9):c.342G>A (p.Trp114Ter)	Pathogenic
2073786	NM_003835.4(RGS9):c.382C>T (p.Arg128Ter)	Pathogenic
2779487	NM_003835.4(RGS9):c.681del (p.Glu228fs)	Pathogenic
2955669	NM_003835.4(RGS9):c.1375C>T (p.Arg459Ter)	Pathogenic
4806093	NM_003835.4(RGS9):c.756del (p.Lys252fs)	Pathogenic
5862	NM_003835.4(RGS9):c.895T>C (p.Trp299Arg)	Pathogenic
848587	NM_003835.4(RGS9):c.574C>T (p.Arg192Ter)	Pathogenic
851116	NM_003835.4(RGS9):c.727del (p.Ser243fs)	Pathogenic
949915	NM_003835.4(RGS9):c.937C>T (p.Arg313Ter)	Pathogenic
958084	NM_003835.4(RGS9):c.660_663del (p.Thr221fs)	Pathogenic
959975	NM_003835.4(RGS9):c.103C>T (p.Arg35Ter)	Pathogenic
962370	NM_003835.4(RGS9):c.82C>T (p.Gln28Ter)	Pathogenic
965963	NM_003835.4(RGS9):c.1762C>T (p.Arg588Ter)	Pathogenic
1009429	NM_003835.4(RGS9):c.58-1G>T	Likely pathogenic
1059883	NM_003835.4(RGS9):c.145_154+18del	Likely pathogenic
1360244	NC_000017.10:g.(?63187690)(63189718_?)del	Likely pathogenic
1395390	NM_003835.4(RGS9):c.654+2T>C	Likely pathogenic
1498480	NM_003835.4(RGS9):c.746+1G>A	Likely pathogenic
1517046	NM_003835.4(RGS9):c.861-2A>C	Likely pathogenic
1930191	NM_003835.4(RGS9):c.1289+2C>A	Likely pathogenic
1997078	NM_003835.4(RGS9):c.155-1G>T	Likely pathogenic
2021041	NM_003835.4(RGS9):c.365-2A>G	Likely pathogenic
2097540	NM_003835.4(RGS9):c.206-1G>A	Likely pathogenic

SpliceAI

3720 predictions. Top by Δscore:

Variant	Effect	Δscore
17:65137594:AAAGG:A	donor_loss	1.0000
17:65137597:GGTA:G	donor_loss	1.0000
17:65137599:T:A	donor_loss	1.0000
17:65158346:G:GA	donor_loss	1.0000
17:65160531:TGCA:T	acceptor_loss	1.0000
17:65160532:GCAG:G	acceptor_loss	1.0000
17:65160533:CA:C	acceptor_loss	1.0000
17:65160534:A:AG	acceptor_gain	1.0000
17:65160534:A:T	acceptor_loss	1.0000
17:65160535:G:GC	acceptor_gain	1.0000
17:65160535:GA:G	acceptor_gain	1.0000
17:65160535:GAC:G	acceptor_gain	1.0000
17:65160535:GACA:G	acceptor_gain	1.0000
17:65160535:GACAC:G	acceptor_gain	1.0000
17:65160584:TACG:T	donor_loss	1.0000
17:65160586:CGGTA:C	donor_loss	1.0000
17:65160849:A:AG	acceptor_gain	1.0000
17:65160850:G:GG	acceptor_gain	1.0000
17:65160850:GCC:G	acceptor_gain	1.0000
17:65160905:AAAAG:A	donor_loss	1.0000
17:65160906:AAAG:A	donor_loss	1.0000
17:65160907:AAGGT:A	donor_loss	1.0000
17:65160908:AGGTA:A	donor_loss	1.0000
17:65160909:GGTA:G	donor_loss	1.0000
17:65160910:G:C	donor_loss	1.0000
17:65160911:T:A	donor_loss	1.0000
17:65177726:A:AG	acceptor_gain	1.0000
17:65177727:TTTAG:T	acceptor_loss	1.0000
17:65177728:TTAGC:T	acceptor_loss	1.0000
17:65177729:TA:T	acceptor_loss	1.0000

AlphaMissense

4438 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
17:65193613:T:A	W273R	1.000
17:65193613:T:C	W273R	1.000
17:65193637:T:A	W281R	1.000
17:65193637:T:C	W281R	1.000
17:65197160:T:A	W299R	1.000
17:65197160:T:C	W299R	1.000
17:65197162:G:C	W299C	1.000
17:65197162:G:T	W299C	1.000
17:65197199:G:C	G312R	1.000
17:65197200:G:A	G312D	1.000
17:65197203:G:C	R313P	1.000
17:65197212:T:C	F316S	1.000
17:65197220:T:C	F319L	1.000
17:65197222:C:A	F319L	1.000
17:65197222:C:G	F319L	1.000
17:65197224:T:A	L320H	1.000
17:65197224:T:C	L320P	1.000
17:65197235:T:C	F324L	1.000
17:65197237:C:A	F324L	1.000
17:65197237:C:G	F324L	1.000
17:65201996:A:T	E327V	1.000
17:65201998:A:G	N328D	1.000
17:65202000:T:A	N328K	1.000
17:65202000:T:G	N328K	1.000
17:65202007:T:C	F331L	1.000
17:65202008:T:C	F331S	1.000
17:65202009:C:A	F331L	1.000
17:65202009:C:G	F331L	1.000
17:65202010:T:A	W332R	1.000
17:65202010:T:C	W332R	1.000

dbSNP variants (sampled 300 via entrez): RS1000023593 (17:65139533 C>A), RS1000054110 (17:65177164 A>C,G,T), RS1000057797 (17:65183091 TCTATCTATCTATCTATCTAC>T), RS1000064941 (17:65214925 C>A,T), RS1000133425 (17:65220771 C>T), RS1000166441 (17:65216804 C>T), RS1000228131 (17:65220931 T>G), RS1000259016 (17:65162449 CATTT>C,CATTTATTT), RS1000270886 (17:65183277 C>A), RS1000271227 (17:65151038 A>G), RS1000398069 (17:65145679 G>A,C), RS1000423176 (17:65151245 C>T), RS1000515965 (17:65173456 G>A), RS1000536760 (17:65211270 C>T), RS1000561006 (17:65162349 T>C)

Disease associations

OMIM: gene MIM:604067 | disease phenotypes: MIM:608415, MIM:204000

GenCC curated gene-disease

Disease	Classification	Inheritance
prolonged electroretinal response suppression 1	Definitive	Autosomal recessive
bradyopsia	Strong	Autosomal recessive

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
bradyopsia	Moderate	AR

Mondo (5): prolonged electroretinal response suppression 1 (MONDO:0958180), inherited retinal dystrophy (MONDO:0019118), bradyopsia (MONDO:0012033), optic atrophy (MONDO:0003608), Leber congenital amaurosis (MONDO:0018998)

Orphanet (3): OBSOLETE: Inherited retinal disorder (Orphanet:71862), Bradyopsia (Orphanet:75374), Leber congenital amaurosis (Orphanet:65)

HPO phenotypes

7 total (8 of 7 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000505	Visual impairment
HP:0000613	Photophobia
HP:0007663	Reduced visual acuity
HP:0011463	Childhood onset
HP:0030511	Bradyopsia
HP:0030512	Difficulty adjusting to changes in luminance
HP:0000556	Retinal dystrophy

GWAS associations

4 associations (top):

Study	Trait	p-value
GCST006278_2	Adverse response to antithyroid drugs in Graves disease	4.000000e-08
GCST006288_294	Heel bone mineral density	2.000000e-12
GCST006288_61	Heel bone mineral density	2.000000e-09
GCST006979_517	Heel bone mineral density	3.000000e-34

EFO canonical traits (2, from GWAS)

EFO ID	Trait name
EFO:0007838	response to anti-thyroid drug
EFO:0009270	heel bone mineral density

MeSH disease descriptors (4)

Descriptor	Name	Tree numbers
D057130	Leber Congenital Amaurosis	C11.270.516; C11.768.364
D009896	Optic Atrophy	C10.292.700.225; C11.640.451
D058499	Retinal Dystrophies	C11.768.585.658
C564243	Prolonged Electroretinal Response Suppression (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: other protein — R7 family

CTD chemical–gene interactions

37 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects cotreatment, increases expression	3
Benzo(a)pyrene	decreases expression, decreases methylation	2
Phenylmercuric Acetate	affects cotreatment, increases expression	2
aristolochic acid I	increases expression	1
triphenyl phosphate	affects expression	1
propionaldehyde	increases expression	1
pirinixic acid	decreases expression, increases activity, affects binding	1
butyraldehyde	increases expression	1
benzo(e)pyrene	decreases methylation	1
aflatoxin B2	increases methylation	1
nickel sulfate	increases expression	1
S-(1,2-dichlorovinyl)cysteine	affects response to substance, increases expression	1
pentanal	increases expression	1
cordycepin	decreases expression	1
CGP 52608	increases reaction, affects binding	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	increases expression, affects cotreatment	1
abrine	increases expression	1
dorsomorphin	increases expression, affects cotreatment	1
jinfukang	decreases expression, affects cotreatment	1
(+)-JQ1 compound	decreases expression	1
2,6-dichloro-(1,4)benzoquinone	increases expression	1
Aldehydes	increases expression	1
Arsenic	increases methylation	1
Atrazine	increases expression	1
Cisplatin	affects cotreatment, decreases expression	1
Hydralazine	affects cotreatment, increases expression	1
Lipopolysaccharides	affects response to substance, increases expression	1
Methapyrilene	decreases methylation	1
Oxygen	increases expression	1
Phenobarbital	affects expression	1

Clinical trials (associated diseases)

70 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT04224207	PHASE3	COMPLETED	Management of Retinitis Pigmentosa by Mesenchymal Stem Cells by Wharton’s Jelly Derived Mesenchymal Stem Cells
NCT07082855	PHASE3	NOT_YET_RECRUITING	A Multicenter, Randomized, Double-Blind, Controlled Clinical Study of Minocycline for the Treatment of Retinitis Pigmentosa
NCT00999609	PHASE3	ACTIVE_NOT_RECRUITING	Safety and Efficacy Study in Subjects With Leber Congenital Amaurosis
NCT06891443	PHASE3	RECRUITING	Study to Evaluate Sepofarsen in Subjects With Leber Congenital Amaurosis (LCA) Type 10 (HYPERION)
NCT03763227	PHASE2	COMPLETED	Intravitreal Ranibizumab (Lucentis®) in the Treatment of Non-leaking Macular Cysts in Retinal Dystrophy
NCT04068207	PHASE2	COMPLETED	Minocycline Treatment in Retinitis Pigmentosa
NCT04945772	PHASE2	COMPLETED	Efficacy and Safety of MCO-010 Optogenetic Therapy in Adults With Retinitis Pigmentosa [RESTORE]
NCT05902962	PHASE1	COMPLETED	SAD of IVT VP-001 in PRPF31 Mutation-Associated Retinal Dystrophy Subjects
NCT06319872	PHASE1	RECRUITING	The Effects of Disulfiram (Antabuse®) on Visual Acuity in Patients With Retinal Degeneration
NCT06455826	PHASE1	COMPLETED	MAD of IVT VP-001 in PRPF31 Mutation-Associated Retinal Dystrophy Subjects (Wallaby)
NCT01064505	PHASE1	COMPLETED	Safety Study of a Single IVT Injection of QPI-1007 in Chronic Optic Nerve Atrophy and Recent Onset NAION Patients
NCT05147701	PHASE1	RECRUITING	Safety of Cultured Allogeneic Adult Umbilical Cord Derived Mesenchymal Stem Cells for NAION
NCT00516477	PHASE1	COMPLETED	Safety Study in Subjects With Leber Congenital Amaurosis
NCT00821340	PHASE1	COMPLETED	Clinical Trial of Gene Therapy for Leber Congenital Amaurosis Caused by RPE65 Mutations
NCT04855045	PHASE2/PHASE3	UNKNOWN	An Open-label, Dose Escalation and Double-masked, Randomized, Controlled Trial Evaluating Safety and Tolerability of Sepofarsen in Children (<8 Years of Age) With LCA10 Caused by Mutations in the CEP290 Gene.
NCT03872479	PHASE1/PHASE2	UNKNOWN	Single Ascending Dose Study in Participants With LCA10
NCT04123626	PHASE1/PHASE2	ACTIVE_NOT_RECRUITING	A Study to Evaluate the Safety and Tolerability of QR-1123 in Subjects With Autosomal Dominant Retinitis Pigmentosa Due to the P23H Mutation in the RHO Gene
NCT04545736	PHASE1/PHASE2	RECRUITING	Oral Metformin for Treatment of ABCA4 Retinopathy
NCT06212297	PHASE1/PHASE2	ACTIVE_NOT_RECRUITING	Fellow-eye Study (FE) of LX101 in Subjects With Inherited Retinal Dystrophy
NCT06852963	PHASE1/PHASE2	ACTIVE_NOT_RECRUITING	A Repeat-Dose, Open-Label, Two Arm Safety and Efficacy Study of Two Doses of VP-001 Administered Intravitreally in Participants With Confirmed PRPF31 Mutation-Associated Retinal Dystrophy, Including Participants Previously Treated With VP001
NCT07177196	PHASE1/PHASE2	ACTIVE_NOT_RECRUITING	Personalized Antisense Oligonucleotide Therapy for a Single Participant With PRPH2 Mutation Associated With Retinal Dystrophy
NCT07063030	EARLY_PHASE1	RECRUITING	A Study of LX107 Gene Therapy in AIPL1-IRD Patients
NCT01546181	Not specified	COMPLETED	Retinal Imaging by Adaptive Optics in Healthy Eyes and During Retinal and General Diseases
NCT01876147	Not specified	COMPLETED	Visual and Functional Assessment in Low Vision Patients
NCT01920867	Not specified	UNKNOWN	Stem Cell Ophthalmology Treatment Study
NCT02014389	Not specified	RECRUITING	Evaluation of Objective Perimetry Using Chromatic Multifocal Pupillometer
NCT02983305	Not specified	COMPLETED	Optical Head-Mounted Display Technology for Low Vision Rehabilitation
NCT03592017	Not specified	COMPLETED	Performance of Long-wavelength Autofluorescence Imaging
NCT03662386	Not specified	TERMINATED	Prospective Analysis of Genotype-phenotype Correlations Observed in a Large Cohort of Patients With Hereditary Retinal Dystrophies - GEPHIRD
NCT03691168	Not specified	UNKNOWN	Multi-center Observation of the Natural Course of Inherited Retinal Dystrophies
NCT03843840	Not specified	COMPLETED	Dual Wavelength OCT
NCT03853252	Not specified	COMPLETED	iPS Cells of Patients for Models of Retinal Dystrophies
NCT05130385	Not specified	UNKNOWN	High Resolution Optical Coherence Tomography
NCT05294978	Not specified	RECRUITING	EyeConic: Qualification for Cone-Optogenetics
NCT05573984	Not specified	ACTIVE_NOT_RECRUITING	Natural History of PRPF31 Mutation-Associated Retinal Dystrophy
NCT05793515	Not specified	COMPLETED	Mechanisms of Inherited Retinal Dystrophies Using Whole Genome Sequencing and in Vitro and in Vivo Models
NCT05820100	Not specified	COMPLETED	Observational Study to Assess the Reliability and Validity of the MLYMT and MLSDT
NCT05976139	Not specified	RECRUITING	Micropulsed Laser in Patients With Macular Oedema in Retinal Dystrophies
NCT06162585	Not specified	ACTIVE_NOT_RECRUITING	Non-Interventional Long Term Follow-up Study of Participants Previously Enrolled in the RESTORE Study
NCT06177977	Not specified	RECRUITING	SS-HH-OCT as a Novel Diagnostic Modality for Early-Onset Retinal Dystrophies (EORDs)