RNA18SN1

gene
On this page

Summary

RNA18SN1 (RNA, 18S ribosomal N1, HGNC:53515) is a gene on chromosome 21p11.2.

45S ribosomal DNA (rDNA) arrays, or clusters, are present on human chromosomes 13, 14, 15, 21 and 22, designated RNR1 through RNR5, respectively. Each cluster consists of multiple 45S rDNA repeat units that vary in number among individuals and chromosomes, with total diploid copy number estimates ranging from 60 to >800 repeat units in a human genome. The 45S rDNA repeat unit encodes a 45S rRNA precursor, transcribed by RNA polymerase I, which is processed to form the 18S, 5.8S and 28S rRNAs. Gene and RefSeq, in collaboration with HGNC, currently describe one 45S rDNA cluster, and one set of 45S precursor and product rRNAs, for each of the five human chromosomes to which these loci are localized. This gene is a representative copy of the 18S ribosomal RNA on chromosome 21.

Source: NCBI Gene 106631781 — RefSeq curated summary.

Identifiers

Gene identifiers

FieldValue
HGNC IDHGNC:53515
Approved symbolRNA18SN1
NameRNA, 18S ribosomal N1
Location21p11.2
Locus typeRNA, ribosomal
StatusApproved
Entrez106631781
RNAcentralURS0000726FAB — rRNA, 1869 nt, 2 organism(s)

Gene structure

Transcript identifiers

Ensembl transcripts: 0

RefSeq mRNA: 0 — MANE Select: None

Canonical transcript exons

None — 0 exons

Expression profiles

Top tissues by expression

0 total, by Bgee expression score (0-100, higher = more expressed):

Regulation

Is transcription factor: no

Cross-species orthologs

0 orthologs

Protein

Protein identifiers

Canonical reviewed UniProt: None (reviewed: )

All UniProt accessions (0):

RefSeq proteins (0): (*=MANE)

Domains & families (InterPro)

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 0 (showing top):

GO Biological Process (0):

GO Molecular Function (0):

GO Cellular Component (0):

Protein interactions and networks

STRING

0 interactions, top by confidence (×1000):

IntAct

0 interactions, top by confidence:

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

0 variants total. Per-class counts are floors (≥ shown; pagination cap):

ClassificationCount (floor)
Pathogenic0
Likely pathogenic0
Uncertain significance0
Likely benign0
Benign0

Top pathogenic / likely-pathogenic (0)

SpliceAI

0 predictions. Top by Δscore:

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 29 via entrez): RS1555879187 (21:8435095 T>C), RS1555879191 (21:8435733 C>G), RS1555879192 (21:8436112 G>C), RS1555879194 (21:8436176 T>C), RS1555879196 (21:8436761 CGGCCCGTCCGTCCGT>C), RS1555879198 (21:8436935 G>A), RS1555879201 (21:8438955 A>G), RS1555879203 (21:8439092 TG>T), RS1980374830 (21:8435165 C>G), RS1980374918 (21:8435166 G>T), RS1980374997 (21:8435195 TCCGGGGCCCCCGGTGGCGGGGCC>T), RS1980375090 (21:8435441 CCCGCCCG>C), RS1980375202 (21:8435559 A>G), RS1980375301 (21:8435609 TCGGTGGCGCCCCGCGTGGGGCC>T), RS1980375423 (21:8435665 C>G)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 0 entries

CTD chemical–gene interactions

1 total (human), top 1 by PubMed support.

ChemicalActions (top 5)PubMed papers
Smokedecreases expression1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.

No linked Atlas pages yet — the cross-entity mesh grows as the corpus expands.