RNA28SN3

Summary

RNA28SN3 (RNA, 28S ribosomal N3, HGNC:53524) is a gene on chromosome 21p11.2.

45S ribosomal DNA (rDNA) arrays, or clusters, are present on human chromosomes 13, 14, 15, 21 and 22, designated RNR1 through RNR5, respectively. Each cluster consists of multiple 45S rDNA repeat units that vary in number among individuals and chromosomes, with total diploid copy number estimates ranging from 60 to >800 repeat units in a human genome. The 45S rDNA repeat unit encodes a 45S rRNA precursor, transcribed by RNA polymerase I, which is processed to form the 18S, 5.8S and 28S rRNAs. This gene represents a copy of the 28S ribosomal RNA on chromosome 21.

Source: NCBI Gene 109910382 — RefSeq curated summary.

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:53524
Approved symbol	RNA28SN3
Name	RNA, 28S ribosomal N3
Location	21p11.2
Locus type	RNA, ribosomal
Status	Approved
Entrez	109910382
RNAcentral	URS0000ABD7E0 — rRNA, 5055 nt, 1 organism(s)

Gene structure

Transcript identifiers

Ensembl transcripts: 0

RefSeq mRNA: 0 — MANE Select: None

Canonical transcript exons

None — 0 exons

Expression profiles

Top tissues by expression

0 total, by Bgee expression score (0-100, higher = more expressed):

Regulation

Is transcription factor: no

Cross-species orthologs

0 orthologs

Protein

Protein identifiers

Canonical reviewed UniProt: None (reviewed: )

All UniProt accessions (0):

RefSeq proteins (0): (*=MANE)

Domains & families (InterPro)

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 0 (showing top):

GO Biological Process (0):

GO Molecular Function (0):

GO Cellular Component (0):

Protein interactions and networks

STRING

0 interactions, top by confidence (×1000):

IntAct

0 interactions, top by confidence:

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

0 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	0
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

0 predictions. Top by Δscore:

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1156789691 (21:8396490 CGGCCCGCCCGGCCGCGCCCGT>C), RS1156852043 (21:8396885 T>C), RS1156999190 (21:8402053 T>A), RS1157107531 (21:8402298 C>G,T), RS1158460886 (21:8396733 C>T), RS1158506473 (21:8397169 G>A), RS1158903531 (21:8402481 C>T), RS1158958052 (21:8396176 C>G,T), RS1159346696 (21:8402130 C>T), RS1160491268 (21:8402265 C>A,G,T), RS1161110099 (21:8397585 A>G), RS1161160439 (21:8396455 C>G,T), RS1161218957 (21:8401995 CGCGCGCGTGCGGGG>C), RS1161237133 (21:8396859 C>G), RS1161314573 (21:8402200 G>A,C)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 0 entries

CTD chemical–gene interactions

1 total (human), top 1 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Smoke	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.