RNA45SN2
gene geneOn this page
Summary
RNA45SN2 (RNA, 45S pre-ribosomal N2, HGNC:53518) is a gene on chromosome 21p11.2.
45S ribosomal DNA (rDNA) arrays, or clusters, are present on human chromosomes 13, 14, 15, 21 and 22, designated RNR1 through RNR5, respectively. Each cluster consists of multiple 45S rDNA repeat units that vary in number among individuals and chromosomes, with total diploid copy number estimates ranging from 60 to >800 repeat units in a human genome. The 45S rDNA repeat unit encodes a 45S rRNA precursor, transcribed by RNA polymerase I, which is processed to form the 18S, 5.8S and 28S rRNAs. This gene represents a copy of the 45S ribosomal RNA on chromosome 21.
Source: NCBI Gene 109864279 — RefSeq curated summary.
Identifiers
Gene identifiers
| Field | Value |
|---|---|
| HGNC ID | HGNC:53518 |
| Approved symbol | RNA45SN2 |
| Name | RNA, 45S pre-ribosomal N2 |
| Location | 21p11.2 |
| Locus type | RNA, ribosomal |
| Status | Approved |
| Entrez | 109864279 |
| RNAcentral | URS0000ABD8C6 — rRNA, 13315 nt, 1 organism(s) |
Gene structure
Transcript identifiers
Ensembl transcripts: 0
RefSeq mRNA: 0 — MANE Select: None
Canonical transcript exons
None — 0 exons
Expression profiles
Top tissues by expression
0 total, by Bgee expression score (0-100, higher = more expressed):
Regulation
Is transcription factor: no
Cross-species orthologs
0 orthologs
Protein
Protein identifiers
Canonical reviewed UniProt: None (reviewed: )
All UniProt accessions (0):
RefSeq proteins (0): (*=MANE)
Domains & families (InterPro)
Structure
Experimental structures (PDB)
0 structures.
Predicted structure (AlphaFold)
Function
Pathways and Gene Ontology
Reactome pathways
0 pathways
MSigDB gene sets: 0 (showing top):
GO Biological Process (0):
GO Molecular Function (0):
GO Cellular Component (0):
Protein interactions and networks
STRING
0 interactions, top by confidence (×1000):
IntAct
0 interactions, top by confidence:
SIGNOR signaling
0 interactions.
Disease & clinical
Clinical variants and AI predictions
ClinVar
0 variants total. Per-class counts are floors (≥ shown; pagination cap):
| Classification | Count (floor) |
|---|---|
| Pathogenic | 0 |
| Likely pathogenic | 0 |
| Uncertain significance | 0 |
| Likely benign | 0 |
| Benign | 0 |
Top pathogenic / likely-pathogenic (0)
SpliceAI
0 predictions. Top by Δscore:
AlphaMissense
0 scored. Top likely-pathogenic:
dbSNP variants (sampled 300 via entrez): RS1156298883 (21:8207948 T>C,G), RS1156352267 (21:8208276 C>G), RS1156547469 (21:8208934 C>G,T), RS1156681406 (21:8212862 C>T), RS1156697315 (21:8213332 T>A,C,G), RS1157092573 (21:8213745 C>T), RS1157141708 (21:8214368 G>C), RS1157256033 (21:8214734 GGGCGGCGGCGGCGGTGGCGGC>G), RS1157492178 (21:8217213 C>A,T), RS1157749118 (21:8219129 C>A,T), RS1158017343 (21:8219694 G>C), RS1158294979 (21:8209109 C>T), RS1158424328 (21:8213044 G>A,T), RS1158520071 (21:8208136 C>A,T), RS1158523126 (21:8213500 C>T)
Disease associations
OMIM: gene `` | disease phenotypes:
GenCC curated gene-disease
Mondo (0):
Orphanet (0):
HPO phenotypes
0 total (0 of 0 shown, HPO-id order):
GWAS associations
0 associations (top):
Drugs & pharmacology
Drug and pharmacology data
Is drug target: no
PharmGKB: 0 entries
CTD chemical–gene interactions
1 total (human), top 1 by PubMed support.
| Chemical | Actions (top 5) | PubMed papers |
|---|---|---|
| Smoke | decreases expression | 1 |
Clinical trials (associated diseases)
0 trials via MONDO — disease-level, not drug-specific.
Related Atlas pages
No linked Atlas pages yet — the cross-entity mesh grows as the corpus expands.