RND1

Summary

RND1 (Rho family GTPase 1, HGNC:18314) is a protein-coding gene on chromosome 12q13.12, encoding Rho-related GTP-binding protein Rho6 (Q92730). Lacks intrinsic GTPase activity.

This gene encodes a protein that belongs to the Rho GTPase family. Members of this family regulate the organization of the actin cytoskeleton in response to extracellular growth factors. A similar protein in rat interacts with a microtubule regulator to control axon extension.

Source: NCBI Gene 27289 — RefSeq curated summary.

At a glance

• GWAS associations: 1
• Clinical variants (ClinVar): 25 total
• MANE Select transcript: NM_014470

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:18314
Approved symbol	RND1
Name	Rho family GTPase 1
Location	12q13.12
Locus type	gene with protein product
Status	Approved
Aliases	Rho6, ARHS, RHOS
Ensembl gene	ENSG00000172602
Ensembl biotype	protein_coding
OMIM	609038
Entrez	27289

Gene structure

Transcript identifiers

Ensembl transcripts: 6 — 3 retained_intron, 2 protein_coding, 1 nonsense_mediated_decay

ENST00000309739, ENST00000548445, ENST00000550607, ENST00000551243, ENST00000553260, ENST00000649147

RefSeq mRNA: 1 — MANE Select: NM_014470 NM_014470

CCDS: CCDS8771

Canonical transcript exons

ENST00000309739 — 5 exons

Exon	Start	End
ENSE00001187861	48865648	48865870
ENSE00001313310	48857145	48858241
ENSE00003475841	48862009	48862118
ENSE00003521763	48864783	48864870
ENSE00003669264	48860997	48861131

Expression profiles

Bgee: expression breadth ubiquitous, 209 present calls, max score 95.83.

FANTOM5 (CAGE): breadth broad, TPM avg 3.4125 / max 633.8286, expressed in 750 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
130745	3.4125	750

Top tissues by expression

274 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
vena cava	UBERON:0004087	95.83	gold quality
right lobe of liver	UBERON:0001114	93.91	gold quality
frontal pole	UBERON:0002795	93.46	gold quality
prefrontal cortex	UBERON:0000451	93.35	gold quality
right frontal lobe	UBERON:0002810	92.30	gold quality
middle temporal gyrus	UBERON:0002771	92.13	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	92.04	gold quality
primary visual cortex	UBERON:0002436	91.78	gold quality
Brodmann (1909) area 9	UBERON:0013540	91.43	gold quality
cingulate cortex	UBERON:0003027	91.35	gold quality
anterior cingulate cortex	UBERON:0009835	91.31	gold quality
frontal cortex	UBERON:0001870	91.25	gold quality
neocortex	UBERON:0001950	91.21	gold quality
cortical plate	UBERON:0005343	91.14	gold quality
secondary oocyte	CL:0000655	90.99	gold quality
Brodmann (1909) area 10	UBERON:0013541	90.21	gold quality
occipital lobe	UBERON:0002021	90.17	gold quality
cerebral cortex	UBERON:0000956	89.00	gold quality
oocyte	CL:0000023	88.84	gold quality
islet of Langerhans	UBERON:0000006	88.80	gold quality
liver	UBERON:0002107	88.32	gold quality
ventricular zone	UBERON:0003053	87.96	gold quality
gall bladder	UBERON:0002110	87.89	gold quality
ganglionic eminence	UBERON:0004023	87.88	gold quality
telencephalon	UBERON:0001893	87.65	gold quality
Brodmann (1909) area 23	UBERON:0013554	87.51	gold quality
amygdala	UBERON:0001876	86.86	gold quality
Brodmann (1909) area 46	UBERON:0006483	86.85	gold quality
superior frontal gyrus	UBERON:0002661	86.79	gold quality
caudate nucleus	UBERON:0001873	86.48	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	26.08
E-MTAB-10137	no	8.39

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

64 targeting RND1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3667-3P	99.99	67.17	1636
HSA-MIR-6077	99.99	68.04	2299
HSA-MIR-335-3P	99.93	73.36	4958
HSA-MIR-589-3P	99.91	69.62	2088
HSA-MIR-1321	99.84	65.30	1811
HSA-MIR-4739	99.84	65.25	1832
HSA-MIR-4756-5P	99.84	64.98	1809
HSA-MIR-3121-3P	99.82	71.96	3630
HSA-MIR-6875-3P	99.82	70.26	2983
HSA-MIR-4659A-3P	99.80	72.62	4248
HSA-MIR-4659B-3P	99.80	72.62	4248
HSA-MIR-4766-5P	99.75	69.23	2662
HSA-MIR-6892-3P	99.68	66.40	1178
HSA-MIR-7-5P	99.67	70.53	1809
HSA-MIR-6887-3P	99.66	67.83	1778
HSA-MIR-7106-5P	99.53	67.47	3574
HSA-MIR-766-5P	99.47	67.91	2225
HSA-MIR-6080	99.43	69.43	373
HSA-MIR-3911	99.38	66.95	1087
HSA-MIR-4796-5P	99.34	70.06	810
HSA-MIR-329-5P	99.27	68.11	1597
HSA-MIR-6734-3P	99.15	66.27	1627
HSA-MIR-4687-5P	99.14	66.26	488
HSA-MIR-485-5P	99.10	64.78	1889
HSA-MIR-6884-5P	99.10	64.50	1987
HSA-MIR-6814-5P	99.03	66.68	1273
HSA-MIR-1257	98.97	68.02	1133
HSA-MIR-6770-5P	98.97	66.76	1853
HSA-MIR-4464	98.95	67.73	820
HSA-MIR-4748	98.95	67.53	810

Literature-anchored findings (GeneRIF, showing 17)

• Socius is a novel Rnd GTPase-interacting protein involved in disassembly of actin stress fibers (PMID:11940653)
• The RND1 mRNA expression levels increased significantly after gestation in myometria. (PMID:16311049)
• Binding of Rac1, Rnd1, and RhoD to a novel Rho GTPase interaction motif destabilizes dimerization of the plexin-B1 effector domain (PMID:17916560)
• SCG10 acts as an effector downstream of Rnd1 to regulate axon extensions by modulating microtubule organization. (PMID:18996843)
• Rnd1 does not play a role in the activation of plexin-C1 and -D1 (PMID:21610070)
• role of the N-terminal region in signaling; Rnd1 and Rnd3 have a KERRA (Lys-Glu-Arg-Arg-Ala) sequence of amino acids in their N-terminus, which functions as the lipid raft-targeting determinant; the sequence mediates lipid raft targeting of p190 RhoGAP correlated with its activation (PMID:22357615)
• Data indicate that Rnd1 efficiently displaces Rac1 from its complex with Plexin-B1 but not vice versa. (PMID:23603360)
• These results reveal a previously unappreciated mechanism through which Rnd1 restrains activation of Ras-MAPK signalling and breast tumour initiation and progression (PMID:25531777)
• RND1 plays an important role in the progression of esophageal squamous cell carcinoma (PMID:26250459)
• Reduced RND1 expression in HCC was associated with cancer progression, likely through regulation of the Ras signaling pathway. (PMID:27770342)
• Studies suggest that Rho GTPase signalling is a complicated mechanism in RhoA-driven cancer cell invasive migration. (PMID:27913679)
• Analysis of the interaction of Plexin-B1 and Plexin-B2 with Rnd family proteins shows lack of binding specificity. (PMID:29040270)
• Rnd1-suppressed epithelial mesenchymal transformation-mediated metastasis of hepatocellular carcinoma cells by reducing the activity of the RhoA/Raf/MEK/ERK signaling pathway. (PMID:29706627)
• we highlight that RND1 expression is induced by anticancer agents and modulates their response. Of note, RND1 mRNA levels in tumors could be used as a predictive marker of both patient prognosis and response to anticancer agents. (PMID:31344837)
• Endothelial Notch signaling directly regulates the small GTPase RND1 to facilitate Notch suppression of endothelial migration. (PMID:35102202)
• MiR-4652-5p Targets RND1 to Regulate Cell Adhesion and Promote Lung Squamous Cell Carcinoma Progression. (PMID:35334070)
• Essential role of Rnd1 in innate immunity during viral and bacterial infections. (PMID:35654795)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	rnd1b	ENSDARG00000004218
danio_rerio	rnd1a	ENSDARG00000030547
mus_musculus	Rnd1	ENSMUSG00000054855
rattus_norvegicus	Rnd1	ENSRNOG00000059857

Paralogs (22): RHOBTB2 (ENSG00000008853), RHOA (ENSG00000067560), CDC42 (ENSG00000070831), RHOBTB1 (ENSG00000072422), RHOV (ENSG00000104140), RND2 (ENSG00000108830), RND3 (ENSG00000115963), RHOU (ENSG00000116574), RHOQ (ENSG00000119729), RHOJ (ENSG00000126785), RHOT1 (ENSG00000126858), RAC2 (ENSG00000128340), RAC1 (ENSG00000136238), RHOF (ENSG00000139725), RHOT2 (ENSG00000140983), RHOB (ENSG00000143878), RHOC (ENSG00000155366), RHOBTB3 (ENSG00000164292), RHOH (ENSG00000168421), RAC3 (ENSG00000169750), RHOD (ENSG00000173156), RHOG (ENSG00000177105)

Protein

Protein identifiers

Rho-related GTP-binding protein Rho6 — Q92730 (reviewed: Q92730)

Alternative names: Rho family GTPase 1, Rnd1

All UniProt accessions (3): Q92730, F8VXU4, H0YHG7

UniProt curated annotations — full annotation on UniProt →

Function. Lacks intrinsic GTPase activity. Has a low affinity for GDP, and constitutively binds GTP. Controls rearrangements of the actin cytoskeleton. Induces the Rac-dependent neuritic process formation in part by disruption of the cortical actin filaments. Causes the formation of many neuritic processes from the cell body with disruption of the cortical actin filaments.

Subunit / interactions. Binds GRB7 and PLXNB1. Interacts with UBXD5. Interacts with PLXNA2.

Subcellular location. Cell membrane. Cytoplasm. Cytoskeleton.

Tissue specificity. Mostly expressed in brain and liver.

Similarity. Belongs to the small GTPase superfamily. Rho family.

RefSeq proteins (1): NP_055285* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001806	Small_GTPase	Family
IPR003578	Small_GTPase_Rho	Family
IPR005225	Small_GTP-bd	Domain
IPR027417	P-loop_NTPase	Homologous_superfamily

Pfam: PF00071

UniProt features (31 total): helix 9, strand 7, binding site 5, mutagenesis site 2, turn 2, chain 1, propeptide 1, sequence variant 1, short sequence motif 1, modified residue 1, lipid moiety-binding region 1

Structure

Experimental structures (PDB)

3 structures.

PDB	Method	Resolution (Å)
3Q3J	X-RAY DIFFRACTION	1.97
2REX	X-RAY DIFFRACTION	2.3
2CLS	X-RAY DIFFRACTION	2.31

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q92730-F1	85.01	0.72

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (5): 23–28; 38–45; 67–71; 125–128; 169–170

Post-translational modifications (2): 229, 229

Mutagenesis-validated functional residues (2):

Position	Phenotype
27	impairs interaction with ubxd5.
45	abolishes interaction with ubxd5.

Function

Pathways and Gene Ontology

Reactome pathways

13 pathways

ID	Pathway
R-HSA-399955	SEMA3A-Plexin repulsion signaling by inhibiting Integrin adhesion
R-HSA-416550	Sema4D mediated inhibition of cell attachment and migration
R-HSA-416572	Sema4D induced cell migration and growth-cone collapse
R-HSA-9696273	RND1 GTPase cycle
R-HSA-1266738	Developmental Biology
R-HSA-162582	Signal Transduction
R-HSA-194315	Signaling by Rho GTPases
R-HSA-373755	Semaphorin interactions
R-HSA-400685	Sema4D in semaphorin signaling
R-HSA-422475	Axon guidance
R-HSA-9012999	RHO GTPase cycle
R-HSA-9675108	Nervous system development
R-HSA-9716542	Signaling by Rho GTPases, Miro GTPases and RHOBTB3

MSigDB gene sets: 208 (showing top): GSE45365_NK_CELL_VS_CD11B_DC_DN, GSE45365_NK_CELL_VS_BCELL_UP, GSE18804_SPLEEN_MACROPHAGE_VS_COLON_TUMORAL_MACROPHAGE_UP, TGGTGCT_MIR29A_MIR29B_MIR29C, FARMER_BREAST_CANCER_CLUSTER_7, GOBP_NEURON_MATURATION, ACEVEDO_NORMAL_TISSUE_ADJACENT_TO_LIVER_TUMOR_DN, GOBP_NEUROGENESIS, MONNIER_POSTRADIATION_TUMOR_ESCAPE_UP, NFKB_Q6, GOBP_REGULATION_OF_ACTIN_FILAMENT_BASED_PROCESS, MODULE_66, GOBP_ANATOMICAL_STRUCTURE_MATURATION, NFKB_C, MUELLER_PLURINET

GO Biological Process (6): actin filament organization (GO:0007015), negative regulation of cell adhesion (GO:0007162), signal transduction (GO:0007165), small GTPase-mediated signal transduction (GO:0007264), neuron remodeling (GO:0016322), regulation of actin cytoskeleton organization (GO:0032956)

GO Molecular Function (6): GTPase activity (GO:0003924), signaling receptor binding (GO:0005102), GTP binding (GO:0005525), protein kinase binding (GO:0019901), nucleotide binding (GO:0000166), protein binding (GO:0005515)

GO Cellular Component (7): cytosol (GO:0005829), plasma membrane (GO:0005886), adherens junction (GO:0005912), actin cytoskeleton (GO:0015629), cytoplasm (GO:0005737), cytoskeleton (GO:0005856), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-9 pathways:

Category	Pathways
Semaphorin interactions	2
Sema4D in semaphorin signaling	2
RHO GTPase cycle	1
Signaling by Rho GTPases, Miro GTPases and RHOBTB3	1
Axon guidance	1
Nervous system development	1
Signaling by Rho GTPases	1
Developmental Biology	1
Signal Transduction	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	3
actin cytoskeleton organization	2
supramolecular fiber organization	1
cell adhesion	1
regulation of cell adhesion	1
negative regulation of cellular process	1
cell communication	1
cellular process	1
signaling	1
regulation of cellular process	1
cellular response to stimulus	1
intracellular signaling cassette	1
neuron maturation	1
regulation of actin filament-based process	1
regulation of cytoskeleton organization	1
ribonucleoside triphosphate phosphatase activity	1
protein binding	1
guanyl ribonucleotide binding	1
purine ribonucleoside triphosphate binding	1
kinase binding	1
nucleoside phosphate binding	1
heterocyclic compound binding	1
binding	1
cytoplasm	1
membrane	1
cell periphery	1
cell-cell junction	1
cytoskeleton	1
intracellular anatomical structure	1
intracellular membraneless organelle	1

Protein interactions and networks

STRING

2765 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
RND1	PLXNB1	O43157	990
RND1	SEMA4D	Q92854	920
RND1	UBXN11	Q5T124	897
RND1	RRAS	P10301	885
RND1	PLXNA1	Q9UIW2	885
RND1	ARHGAP35	Q9NRY4	879
RND1	C2CD4A	Q8NCU7	776
RND1	C2CD4B	A6NLJ0	764
RND1	GRB7	Q14451	708
RND1	RASA1	P20936	692
RND1	UNC5B	Q8IZJ1	691
RND1	FLRT3	Q9NZU0	684
RND1	ARF3	P16587	679
RND1	RAP2B	P17964	673
RND1	SEMA3A	Q14563	584

IntAct

25 interactions, top by confidence:

A	B	Type	Score
RND1	PLXNB1	psi-mi:“MI:0915”(physical association)	0.780
RND1	PLXNB1	psi-mi:“MI:0407”(direct interaction)	0.780
PLXNB1	RND1	psi-mi:“MI:0915”(physical association)	0.780
GRB7	RND1	psi-mi:“MI:0915”(physical association)	0.580
RND1	GRB7	psi-mi:“MI:0915”(physical association)	0.580
RND1	PLXNB2	psi-mi:“MI:0407”(direct interaction)	0.560
ARFIP2	RND1	psi-mi:“MI:0915”(physical association)	0.560
GPX8	RND1	psi-mi:“MI:0915”(physical association)	0.560
TSC22D1	KRT1	psi-mi:“MI:0914”(association)	0.460
RND1	PLXNB1	psi-mi:“MI:0915”(physical association)	0.400
RND1	ARHGAP35	psi-mi:“MI:0915”(physical association)	0.400
CREB3L2	RND1	psi-mi:“MI:0915”(physical association)	0.000
RND1	ID3	psi-mi:“MI:0915”(physical association)	0.000
ZNF212	RND1	psi-mi:“MI:0915”(physical association)	0.000
RND1	ARFIP2	psi-mi:“MI:0915”(physical association)	0.000
RND1	GPX8	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (257): RND1 (Two-hybrid), RND1 (Two-hybrid), ARHGAP5 (Affinity Capture-Western), ARHGAP5 (Reconstituted Complex), RND1 (Reconstituted Complex), RND1 (Affinity Capture-Western), CCNI (Two-hybrid), COPS2 (Two-hybrid), EEF1A1 (Two-hybrid), MYH7 (Two-hybrid), MYOM3 (Two-hybrid), MYZAP (Two-hybrid), NEDD1 (Two-hybrid), PAIP1 (Two-hybrid), RAI14 (Two-hybrid)

ESM2 similar proteins: A0FGR8, A1DZY4, A5D7J5, O35141, O35929, O75628, O75808, O94103, P01114, P01115, P0C0E4, P27040, P35739, P55040, P55041, P55043, P63032, P63033, P70268, Q00993, Q06AU5, Q13637, Q17QI8, Q3UFB7, Q496Y0, Q5R541, Q63433, Q67VP4, Q6IMB1, Q6P0U3, Q6T310, Q7L0Q8, Q7YS69, Q864R5, Q8HXH0, Q8IYK8, Q8J212, Q8QFP8, Q8VDU1, Q8VEL9

Diamond homologs: A0A286QZ36, C4YDI6, O00212, O42825, O76321, O77683, O88931, P01122, P06780, P08134, P0CY33, P15153, P17081, P19073, P22122, P24406, P34144, P34145, P34146, P34148, P34149, P34150, P40792, P40793, P48148, P48554, P52198, P60763, P60764, P60766, P60952, P60953, P61585, P61586, P61587, P61588, P61589, P62745, P62746, P62747

SIGNOR signaling

3 interactions.

A	Effect	B	Mechanism
RND1	up-regulates	MAPK8	binding
DVL1	up-regulates	RND1
GRB7	up-regulates	RND1	binding

Disease & clinical

Clinical variants and AI predictions

ClinVar

25 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	20
Likely benign	1
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

595 predictions. Top by Δscore:

Variant	Effect	Δscore
12:48858237:CAACC:C	acceptor_gain	1.0000
12:48858240:CC:C	acceptor_gain	1.0000
12:48858241:CC:C	acceptor_gain	1.0000
12:48860993:ACAC:A	donor_loss	1.0000
12:48860995:A:AT	donor_loss	1.0000
12:48860996:CCTG:C	donor_gain	1.0000
12:48861127:CTCCA:C	acceptor_gain	1.0000
12:48861128:TCCA:T	acceptor_gain	1.0000
12:48861129:CCA:C	acceptor_gain	1.0000
12:48861129:CCAC:C	acceptor_gain	1.0000
12:48861130:CA:C	acceptor_gain	1.0000
12:48861130:CAC:C	acceptor_gain	1.0000
12:48861131:AC:A	acceptor_loss	1.0000
12:48861132:C:CC	acceptor_gain	1.0000
12:48861139:G:C	acceptor_gain	1.0000
12:48861139:G:GC	acceptor_gain	1.0000
12:48861145:C:CT	acceptor_gain	1.0000
12:48861146:A:T	acceptor_gain	1.0000
12:48861156:G:C	acceptor_gain	1.0000
12:48861156:G:GC	acceptor_gain	1.0000
12:48862003:TCTTA:T	donor_loss	1.0000
12:48862004:CTTA:C	donor_loss	1.0000
12:48862005:TTA:T	donor_loss	1.0000
12:48862006:TA:T	donor_loss	1.0000
12:48862007:A:AC	donor_gain	1.0000
12:48862007:A:T	donor_loss	1.0000
12:48862008:C:CA	donor_loss	1.0000
12:48862008:C:CC	donor_gain	1.0000
12:48862008:CCTT:C	donor_gain	1.0000
12:48862118:CCTGG:C	acceptor_gain	1.0000

AlphaMissense

1504 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
12:48861131:A:G	W107R	1.000
12:48861131:A:T	W107R	1.000
12:48864791:T:A	D67V	1.000
12:48864791:T:G	D67A	1.000
12:48864850:G:C	F47L	1.000
12:48864850:G:T	F47L	1.000
12:48864852:A:G	F47L	1.000
12:48865688:G:A	T27I	1.000
12:48865690:C:A	K26N	1.000
12:48865690:C:G	K26N	1.000
12:48861061:C:G	R130P	0.999
12:48861064:A:G	L129P	0.999
12:48861072:C:A	K126N	0.999
12:48861072:C:G	K126N	0.999
12:48861077:A:G	C125R	0.999
12:48861079:C:T	G124D	0.999
12:48861129:C:A	W107C	0.999
12:48861129:C:G	W107C	0.999
12:48862054:A:C	C91W	0.999
12:48862056:A:G	C91R	0.999
12:48862086:A:G	C81R	0.999
12:48862095:G:C	R78G	0.999
12:48862095:G:T	R78S	0.999
12:48862097:A:T	V77D	0.999
12:48862118:C:T	G70E	0.999
12:48864790:A:C	D67E	0.999
12:48864790:A:T	D67E	0.999
12:48864791:T:C	D67G	0.999
12:48864792:C:A	D67Y	0.999
12:48864792:C:G	D67H	0.999

dbSNP variants (sampled 300 via entrez): RS1000127221 (12:48861170 A>T), RS1000633517 (12:48860403 T>A), RS1000687278 (12:48867155 G>A), RS1000732835 (12:48862848 C>T), RS1001685223 (12:48864246 C>T), RS1001748877 (12:48859956 T>G), RS1001855236 (12:48859253 T>C), RS1001925717 (12:48864007 G>A,C), RS1002328682 (12:48866417 C>T), RS1002932123 (12:48865463 G>C), RS1002994847 (12:48863310 C>T), RS1003810772 (12:48860363 G>A), RS1004055234 (12:48865227 C>T), RS1004163392 (12:48860002 T>C), RS1004715189 (12:48864404 TGTGTGTGTGTGTGCGCGCGCGCGC>T)

Disease associations

OMIM: gene MIM:609038 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST001241_1	Bipolar disorder	1.000000e-06

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

PharmGKB variants

1 variants.

Variant	Genes	Level	Score	#Clin annots	Drugs
rs2453488	RND1		0.00	0

CTD chemical–gene interactions

68 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Tetrachlorodibenzodioxin	affects expression, affects cotreatment, increases expression	5
Valproic Acid	increases expression, affects cotreatment, decreases expression	5
trichostatin A	affects cotreatment, decreases expression, affects expression	4
Estradiol	decreases expression, decreases reaction, affects cotreatment, increases expression	4
Cadmium Chloride	decreases expression, increases expression	4
Cyclosporine	affects expression, increases expression	3
afimoxifene	decreases expression, decreases reaction, increases expression, affects reaction	2
S-(1,2-dichlorovinyl)cysteine	decreases reaction, affects cotreatment, increases expression	2
Zoledronic Acid	increases expression	2
Acetaminophen	decreases expression, increases expression	2
Air Pollutants	decreases expression, increases abundance, increases expression	2
Silicon Dioxide	increases expression, decreases expression	2
aristolochic acid I	increases expression	1
bisphenol A	increases expression	1
2-methyl-4-isothiazolin-3-one	increases expression	1
beta-lapachone	increases expression	1
tris(1,3-dichloro-2-propyl)phosphate	increases expression	1
sodium arsenite	increases expression	1
potassium chromate(VI)	affects cotreatment, increases expression	1
resorcinol	decreases expression	1
epigallocatechin gallate	affects cotreatment, increases expression	1
15-acetyldeoxynivalenol	increases expression	1
tebuconazole	decreases expression	1
K 7174	increases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
clothianidin	increases expression	1
abrine	increases expression	1
ormosil	affects binding, decreases expression	1
dorsomorphin	affects cotreatment, decreases expression	1
licochalcone B	increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.