RNF113B

Summary

RNF113B (ring finger protein 113B, HGNC:17267) is a protein-coding gene on chromosome 13q32.2, encoding RING finger protein 113B (Q8IZP6).

Predicted to enable zinc ion binding activity. Predicted to be involved in snoRNA splicing. Predicted to be part of U2-type spliceosomal complex.

Source: NCBI Gene 140432 — RefSeq curated summary.

At a glance

• GWAS associations: 2
• MANE Select transcript: NM_178861

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:17267
Approved symbol	RNF113B
Name	ring finger protein 113B
Location	13q32.2
Locus type	gene with protein product
Status	Approved
Aliases	RNF161
Ensembl gene	ENSG00000139797
Ensembl biotype	protein_coding
Entrez	140432

Gene structure

Transcript identifiers

Ensembl transcripts: 1 — 1 protein_coding

ENST00000267291

RefSeq mRNA: 1 — MANE Select: NM_178861 NM_178861

CCDS: CCDS9486

Canonical transcript exons

ENST00000267291 — 2 exons

Exon	Start	End
ENSE00000940222	98176282	98177269
ENSE00001373481	98175785	98176176

Expression profiles

Bgee: expression breadth broad, 29 present calls, max score 90.50.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 0.1374 / max 121.3419, expressed in 6 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
137914	0.1120	4
137913	0.0254	4

Top tissues by expression

108 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
left testis	UBERON:0004533	90.50	gold quality
testis	UBERON:0000473	90.09	gold quality
right testis	UBERON:0004534	89.59	gold quality
quadriceps femoris	UBERON:0001377	84.52	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	83.73	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	81.71	gold quality
cerebellar vermis	UBERON:0004720	75.34	gold quality
adrenal tissue	UBERON:0018303	59.31	gold quality
thymus	UBERON:0002370	58.79	silver quality
calcaneal tendon	UBERON:0003701	49.51	silver quality
colonic epithelium	UBERON:0000397	48.18	silver quality
liver	UBERON:0002107	45.20	silver quality
kidney	UBERON:0002113	42.82	silver quality
tonsil	UBERON:0002372	42.66	gold quality
blood	UBERON:0000178	42.28	silver quality
right lobe of liver	UBERON:0001114	42.27	silver quality
prostate gland	UBERON:0002367	42.11	gold quality
bone marrow cell	CL:0002092	40.56	gold quality
adult mammalian kidney	UBERON:0000082	40.52	gold quality
monocyte	CL:0000576	40.20	silver quality
skeletal muscle tissue	UBERON:0001134	39.98	gold quality
lower esophagus mucosa	UBERON:0035834	39.77	gold quality
leukocyte	CL:0000738	39.60	gold quality
bone marrow	UBERON:0002371	39.05	gold quality
cortex of kidney	UBERON:0001225	38.40	silver quality
adrenal gland	UBERON:0002369	37.43	gold quality
ganglionic eminence	UBERON:0004023	37.34	gold quality
muscle tissue	UBERON:0002385	37.10	gold quality
hindlimb stylopod muscle	UBERON:0004252	37.05	silver quality
cortical plate	UBERON:0005343	36.47	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	1.78

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

11 targeting RNF113B, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6867-5P	100.00	82.21	3464
HSA-MIR-7110-3P	100.00	73.18	2486
HSA-MIR-450B-5P	99.92	71.48	3175
HSA-MIR-3119	99.92	71.34	2390
HSA-MIR-12130	99.75	65.47	452
HSA-MIR-6734-3P	99.15	66.27	1627
HSA-MIR-758-3P	98.42	68.60	1122
HSA-MIR-876-5P	97.99	68.49	1345
HSA-MIR-510-5P	97.66	65.82	916
HSA-MIR-3167	96.81	67.09	1236
HSA-MIR-550B-3P	95.43	67.73	599

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	rnf113a	ENSDARG00000037930
drosophila_melanogaster	mdlc	FBGN0038772
caenorhabditis_elegans		WBGENE00010476

Paralogs (1): RNF113A (ENSG00000125352)

Protein

Protein identifiers

RING finger protein 113B — Q8IZP6 (reviewed: Q8IZP6)

Alternative names: Zinc finger protein 183-like 1

All UniProt accessions (1): Q8IZP6

RefSeq proteins (1): NP_849192* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000571	Znf_CCCH	Domain
IPR001841	Znf_RING	Domain
IPR013083	Znf_RING/FYVE/PHD	Homologous_superfamily
IPR017907	Znf_RING_CS	Conserved_site
IPR036855	Znf_CCCH_sf	Homologous_superfamily
IPR039971	CWC24-like	Family

Pfam: PF00642, PF13920

UniProt features (13 total): strand 4, zinc finger region 2, helix 2, chain 1, region of interest 1, compositionally biased region 1, sequence variant 1, sequence conflict 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
2CSY	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q8IZP6-F1	72.66	0.31

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 16 (showing top): GOBP_RNA_SPLICING, chr13q32, GOCC_U2_TYPE_SPLICEOSOMAL_COMPLEX, GOCC_SPLICEOSOMAL_COMPLEX, GOCC_RIBONUCLEOPROTEIN_COMPLEX, GOMF_ACYLTRANSFERASE_ACTIVITY, GOMF_AMINOACYLTRANSFERASE_ACTIVITY, GOBP_MRNA_PROCESSING, MIR6867_5P, MIR450B_5P, MIR758_3P, GOCC_NUCLEAR_PROTEIN_CONTAINING_COMPLEX, GOBP_MRNA_METABOLIC_PROCESS, GSE4984_LPS_VS_VEHICLE_CTRL_TREATED_DC_UP, GOBP_RNA_SPLICING_VIA_TRANSESTERIFICATION_REACTIONS

GO Biological Process (1): snoRNA splicing (GO:0034247)

GO Molecular Function (2): zinc ion binding (GO:0008270), metal ion binding (GO:0046872)

GO Cellular Component (1): U2-type spliceosomal complex (GO:0005684)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
RNA splicing	1
sno(s)RNA processing	1
transition metal ion binding	1
cation binding	1
spliceosomal complex	1

Protein interactions and networks

STRING

1475 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
RNF113B	FARP1	Q9Y4F1	571
RNF113B	DCAF12	Q5T6F0	542
RNF113B	DCAF12L2	Q5VW00	475
RNF113B	ZIC5	Q96T25	447
RNF113B	DOCK9	Q9BZ29	447
RNF113B	TRIM74	Q86UV6	432
RNF113B	POM121L2	Q96KW2	418
RNF113B	TRIM73	Q86UV7	417
RNF113B	UBAC2	Q8NBM4	414
RNF113B	TMEM278	A6NKF7	400
RNF113B	UGGT2	Q9NYU1	390
RNF113B	CYB5D1	Q6P9G0	382
RNF113B	RFPL4A	A6NLU0	376
RNF113B	RNF141	Q8WVD5	372
RNF113B	TRIML1	Q8N9V2	370

IntAct

5 interactions, top by confidence:

A	B	Type	Score
RNF113B	H1-4	psi-mi:“MI:0915”(physical association)	0.400
RNF113B	UBE2L3	psi-mi:“MI:0915”(physical association)	0.370
UBE2R2	RNF113B	psi-mi:“MI:0915”(physical association)	0.370
RNF113B	UBE2H	psi-mi:“MI:0915”(physical association)	0.370

BioGRID (9): RNF113B (Co-fractionation), RNF113B (Proximity Label-MS), GIT1 (Affinity Capture-MS), RNF113A (Affinity Capture-MS), RNF113B (Proximity Label-MS), RNF113B (Two-hybrid), RNF113B (Two-hybrid), RNF113B (Two-hybrid), RNF113B (Two-hybrid)

ESM2 similar proteins: A2XIP9, A5GFW7, B1WB17, B4FGS2, E1C760, E7EXT2, F7AEX0, O15541, O59800, P0CR50, P0CR51, P28518, P35251, P35600, P35601, P35728, P52012, Q0VCR1, Q10154, Q21755, Q28E45, Q2R2B4, Q3LSS0, Q3T1J8, Q4P400, Q4R594, Q5AX35, Q5AXT6, Q5EAW4, Q5FVF1, Q5R9P9, Q5ZJN1, Q640E9, Q67ER4, Q6C3L4, Q70Z53, Q75LU5, Q810J8, Q8BP78, Q8IZP6

Diamond homologs: O15541, O17917, P0CQ64, P0CQ65, P53769, Q02398, Q1JPS1, Q4P400, Q4WUA0, Q55G16, Q5ACW2, Q5AVC5, Q67ER4, Q6BYU0, Q6CB23, Q6CSS6, Q6FXX1, Q6K4V3, Q752S4, Q7SDY3, Q8GX84, Q8IZP6, Q9FNG6, Q9P6R8, Q03605, O74747, G2Q0E2, P33288, Q1XHU0, Q6FPI4, Q6MFZ5, Q75EN0, Q7ZWF4, Q9ESN2, Q9HCM9, A0A3B3IT33, A4QPC6, A6NCK2, A6NDI0, A6NGJ6

SIGNOR signaling

1 interactions.

A	Effect	B	Mechanism
Ub:E2	“up-regulates activity”	RNF113B	ubiquitination

Disease & clinical

Clinical variants and AI predictions

ClinVar

0 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	0
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

87 predictions. Top by Δscore:

Variant	Effect	Δscore
13:98176274:G:A	donor_gain	0.9300
13:98176278:CCACC:C	donor_loss	0.9300
13:98176279:CACC:C	donor_loss	0.9300
13:98176280:ACC:A	donor_loss	0.9300
13:98176276:CCCCA:C	donor_loss	0.9200
13:98176277:CCCAC:C	donor_loss	0.9200
13:98176491:T:TA	donor_gain	0.9200
13:98176485:T:TA	donor_gain	0.9000
13:98176281:CCTT:C	donor_gain	0.8800
13:98176282:C:G	donor_loss	0.8700
13:98176178:T:A	acceptor_loss	0.7600
13:98176290:G:GA	donor_gain	0.7600
13:98176177:C:CC	acceptor_gain	0.6900
13:98176289:AG:A	donor_gain	0.6600
13:98176172:TTTTC:T	acceptor_gain	0.6200
13:98176175:TC:T	acceptor_gain	0.6200
13:98176176:CC:C	acceptor_gain	0.6200
13:98176174:TTC:T	acceptor_gain	0.6100
13:98176506:T:TA	donor_gain	0.6000
13:98176186:C:CT	acceptor_gain	0.5700
13:98176667:A:AG	donor_gain	0.5700
13:98176499:T:TA	donor_gain	0.5600
13:98176500:C:A	donor_gain	0.5600
13:98176274:GCCC:G	donor_loss	0.5300
13:98176275:CCCC:C	donor_loss	0.5300
13:98176277:C:T	donor_gain	0.5300
13:98176283:T:C	donor_loss	0.5300
13:98176173:TTTC:T	acceptor_gain	0.5200
13:98176273:TGCCC:T	donor_loss	0.5100
13:98176177:C:T	acceptor_gain	0.4900

AlphaMissense

2135 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
13:98176598:G:C	F213L	0.988
13:98176598:G:T	F213L	0.988
13:98176600:A:G	F213L	0.988
13:98176412:G:C	F275L	0.986
13:98176412:G:T	F275L	0.986
13:98176414:A:G	F275L	0.986
13:98176437:A:T	V267D	0.985
13:98176616:G:C	F207L	0.985
13:98176616:G:T	F207L	0.985
13:98176618:A:G	F207L	0.985
13:98176646:C:A	K197N	0.968
13:98176646:C:G	K197N	0.968
13:98176368:C:G	C290S	0.964
13:98176369:A:T	C290S	0.964
13:98176448:G:C	F263L	0.964
13:98176448:G:T	F263L	0.964
13:98176450:A:G	F263L	0.964
13:98176625:G:C	F204L	0.964
13:98176625:G:T	F204L	0.964
13:98176627:A:G	F204L	0.964
13:98176335:A:G	F301S	0.963
13:98176413:A:C	F275C	0.962
13:98176413:A:G	F275S	0.962
13:98176334:A:C	F301L	0.960
13:98176334:A:T	F301L	0.960
13:98176336:A:G	F301L	0.960
13:98176425:C:G	C271S	0.956
13:98176426:A:T	C271S	0.956
13:98176418:A:C	H273Q	0.955
13:98176418:A:T	H273Q	0.955

dbSNP variants (sampled 300 via entrez): RS1000721301 (13:98177587 T>C), RS1002496351 (13:98175821 G>A,C), RS1003170212 (13:98178884 A>G,T), RS1003229314 (13:98179080 T>C), RS1006035214 (13:98177889 A>G), RS1006443207 (13:98176961 C>A,T), RS1007297013 (13:98176684 C>T), RS1009588146 (13:98175702 C>T), RS1009704630 (13:98175347 A>C), RS1014348290 (13:98175885 G>T), RS1017220859 (13:98179131 A>G), RS1018161527 (13:98177113 C>A,G,T), RS1018784426 (13:98178091 A>T), RS1020678119 (13:98175415 TATCCTTTATTTGCTGTTTTGGTAACTCTTGAACCCC>T), RS1022394689 (13:98175369 G>A)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST002595_23	Clozapine-induced agranulocytosis	8.000000e-06
GCST009391_2024	Metabolite levels	3.000000e-06

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0010371	lysophosphatidylethanolamine 22:6 measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

8 total (human), top 8 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
tris(1,3-dichloro-2-propyl)phosphate	increases expression	1
CGP 52608	affects binding, increases reaction	1
Resveratrol	affects cotreatment, decreases expression	1
Sunitinib	decreases expression	1
Benzo(a)pyrene	increases methylation	1
Paraoxon	increases expression	1
Plant Extracts	affects cotreatment, decreases expression	1
Valproic Acid	increases methylation	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.