RNF149

Summary

RNF149 (ring finger protein 149, HGNC:23137) is a protein-coding gene on chromosome 2q11.2, encoding E3 ubiquitin-protein ligase RNF149 (Q8NC42). E3 ubiquitin-protein ligase.

Predicted to enable ubiquitin protein ligase activity. Predicted to be involved in ubiquitin-dependent protein catabolic process. Predicted to act upstream of or within cellular response to xenobiotic stimulus; negative regulation of MAPK cascade; and regulation of protein stability. Located in membrane.

Source: NCBI Gene 284996 — RefSeq curated summary.

At a glance

• GWAS associations: 2
• Clinical variants (ClinVar): 37 total
• Druggable target: yes
• MANE Select transcript: NM_173647

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:23137
Approved symbol	RNF149
Name	ring finger protein 149
Location	2q11.2
Locus type	gene with protein product
Status	Approved
Aliases	FLJ90504
Ensembl gene	ENSG00000163162
Ensembl biotype	protein_coding
Entrez	284996

Gene structure

Transcript identifiers

Ensembl transcripts: 14 — 9 protein_coding, 3 retained_intron, 1 nonsense_mediated_decay, 1 protein_coding_CDS_not_defined

ENST00000295317, ENST00000424632, ENST00000463726, ENST00000478404, ENST00000485752, ENST00000490553, ENST00000878916, ENST00000878917, ENST00000878918, ENST00000878919, ENST00000878920, ENST00000878921, ENST00000878922, ENST00000963872

RefSeq mRNA: 1 — MANE Select: NM_173647 NM_173647

CCDS: CCDS2051

Canonical transcript exons

ENST00000295317 — 7 exons

Exon	Start	End
ENSE00001072165	101294014	101294082
ENSE00001072167	101294931	101295181
ENSE00001072168	101288973	101289055
ENSE00001130251	101286081	101286177
ENSE00001164142	101275601	101277281
ENSE00001783996	101308129	101308701
ENSE00003577829	101281859	101282057

Expression profiles

Bgee: expression breadth ubiquitous, 262 present calls, max score 99.16.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 52.1482 / max 3238.0759, expressed in 1821 samples.

FANTOM5 promoters (3 alternative TSS)

Promoter ID	TPM avg	Samples expressed
29937	51.0007	1821
29938	1.0168	778
29939	0.1307	55

Top tissues by expression

262 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
blood	UBERON:0000178	99.16	gold quality
monocyte	CL:0000576	98.52	gold quality
leukocyte	CL:0000738	98.48	gold quality
spleen	UBERON:0002106	98.01	gold quality
granulocyte	CL:0000094	97.99	gold quality
right lung	UBERON:0002167	97.69	gold quality
bone marrow cell	CL:0002092	97.56	gold quality
oviduct epithelium	UBERON:0004804	97.24	gold quality
buccal mucosa cell	CL:0002336	97.11	gold quality
upper arm skin	UBERON:0004263	96.96	gold quality
vermiform appendix	UBERON:0001154	96.80	gold quality
upper lobe of left lung	UBERON:0008952	96.80	gold quality
bone marrow	UBERON:0002371	96.79	gold quality
upper lobe of lung	UBERON:0008948	96.59	gold quality
nasal cavity epithelium	UBERON:0005384	96.32	gold quality
pericardium	UBERON:0002407	96.31	gold quality
pharyngeal mucosa	UBERON:0000355	96.26	gold quality
penis	UBERON:0000989	96.07	gold quality
cartilage tissue	UBERON:0002418	96.06	gold quality
skin of abdomen	UBERON:0001416	96.03	gold quality
lower esophagus mucosa	UBERON:0035834	96.00	gold quality
esophagus mucosa	UBERON:0002469	95.85	gold quality
skin of leg	UBERON:0001511	95.77	gold quality
lower lobe of lung	UBERON:0008949	95.74	gold quality
zone of skin	UBERON:0000014	95.70	gold quality
esophagus squamous epithelium	UBERON:0006920	95.61	gold quality
vagina	UBERON:0000996	95.58	gold quality
body of pancreas	UBERON:0001150	95.47	gold quality
omental fat pad	UBERON:0010414	95.40	gold quality
peritoneum	UBERON:0002358	95.39	gold quality

Single-cell (SCXA)

Detected in 7 experiment(s), a significant marker in 7.

Experiment	Marker?	Max mean expression
E-HCAD-15	yes	1100.04
E-MTAB-7052	yes	464.15
E-CURD-46	yes	16.06
E-MTAB-9801	yes	8.57
E-CURD-88	yes	4.34
E-CURD-119	yes	4.31
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): STAT3

miRNA regulators (miRDB)

108 targeting RNF149, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-LET-7A-3P	100.00	74.03	3932
HSA-LET-7B-3P	100.00	74.08	3913
HSA-LET-7F-1-3P	100.00	74.02	3928
HSA-MIR-98-3P	100.00	74.08	3907
HSA-MIR-3120-5P	100.00	65.56	965
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-196A-1-3P	99.99	72.15	2772
HSA-MIR-4775	99.98	75.00	6394
HSA-LET-7F-2-3P	99.98	70.98	2588
HSA-MIR-1185-1-3P	99.98	71.04	2593
HSA-MIR-1185-2-3P	99.98	71.04	2593
HSA-MIR-607	99.97	73.62	5593
HSA-MIR-3065-5P	99.97	71.56	3281
HSA-MIR-3148	99.97	75.06	6478
HSA-MIR-590-3P	99.96	74.34	6478
HSA-MIR-4666A-3P	99.96	71.71	3434
HSA-MIR-1250-3P	99.96	70.04	4038
HSA-MIR-302E	99.96	70.74	2669
HSA-MIR-548AA	99.96	70.64	3753
HSA-MIR-548AP-3P	99.96	70.64	3753
HSA-MIR-548T-3P	99.96	70.64	3753
HSA-MIR-548AB	99.95	71.31	3488
HSA-MIR-559	99.95	72.28	3609
HSA-MIR-548A-5P	99.94	71.27	3482
HSA-MIR-548AD-5P	99.94	71.23	3502
HSA-MIR-548AE-5P	99.94	71.23	3502
HSA-MIR-548AK	99.94	71.24	3488
HSA-MIR-548AM-5P	99.94	71.24	3488
HSA-MIR-548AP-5P	99.94	71.14	3489
HSA-MIR-548AQ-5P	99.94	71.34	3426

Literature-anchored findings (GeneRIF, showing 1)

• Data show that RNF149 (RING finger protein 149) interacts with wild-type BRAF. (PMID:22628551)

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Rnf149	ENSMUSG00000048234
rattus_norvegicus	Rnf149	ENSRNOG00000013946

Paralogs (9): RNF13 (ENSG00000082996), RNF215 (ENSG00000099999), ZNRF4 (ENSG00000105428), RNF167 (ENSG00000108523), RNF130 (ENSG00000113269), RNF128 (ENSG00000133135), RNF150 (ENSG00000170153), RNF133 (ENSG00000188050), RNF148 (ENSG00000235631)

Protein

Protein identifiers

E3 ubiquitin-protein ligase RNF149 — Q8NC42 (reviewed: Q8NC42)

Alternative names: DNA polymerase-transactivated protein 2, RING finger protein 149, RING-type E3 ubiquitin transferase RNF149

All UniProt accessions (2): Q8NC42, F8WCD0

UniProt curated annotations — full annotation on UniProt →

Function. E3 ubiquitin-protein ligase. Ubiquitinates BRAF, inducing its proteasomal degradation.

Subcellular location. Membrane.

Domain organisation. The RING-type zinc finger domain mediates binding to an E2 ubiquitin-conjugating enzyme.

Pathway. Protein modification; protein ubiquitination.

RefSeq proteins (1): NP_775918* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001841	Znf_RING	Domain
IPR003137	PA_domain	Domain
IPR013083	Znf_RING/FYVE/PHD	Homologous_superfamily
IPR042712	RNF149_RING-H2	Domain
IPR046450	PA_dom_sf	Homologous_superfamily

Pfam: PF02225, PF13639

UniProt features (15 total): sequence variant 4, glycosylation site 2, compositionally biased region 2, signal peptide 1, chain 1, transmembrane region 1, domain 1, zinc finger region 1, region of interest 1, modified residue 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q8NC42-F1	75.15	0.37

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (1): 345

Glycosylation sites (2): 145, 52

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 245 (showing top): GSE45365_NK_CELL_VS_CD11B_DC_DN, GOBP_MACROMOLECULE_CATABOLIC_PROCESS, MCBRYAN_TERMINAL_END_BUD_UP, GOBP_NEGATIVE_REGULATION_OF_MAPK_CASCADE, BRUECKNER_TARGETS_OF_MIRLET7A3_DN, GOBP_NEGATIVE_REGULATION_OF_INTRACELLULAR_SIGNAL_TRANSDUCTION, FOSTER_TOLERANT_MACROPHAGE_DN, MARTINEZ_RB1_TARGETS_DN, MCBRYAN_PUBERTAL_BREAST_3_4WK_UP, MCBRYAN_PUBERTAL_BREAST_5_6WK_UP, GOBP_POST_TRANSLATIONAL_PROTEIN_MODIFICATION, GOBP_REGULATION_OF_PROTEIN_STABILITY, GUO_HEX_TARGETS_DN, GRYDER_PAX3FOXO1_ENHANCERS_IN_TADS, CHANDRAN_METASTASIS_UP

GO Biological Process (5): ubiquitin-dependent protein catabolic process (GO:0006511), protein ubiquitination (GO:0016567), regulation of protein stability (GO:0031647), negative regulation of MAPK cascade (GO:0043409), cellular response to xenobiotic stimulus (GO:0071466)

GO Molecular Function (4): zinc ion binding (GO:0008270), ubiquitin protein ligase activity (GO:0061630), transferase activity (GO:0016740), metal ion binding (GO:0046872)

GO Cellular Component (5): cytoplasm (GO:0005737), late endosome (GO:0005770), endoplasmic reticulum (GO:0005783), Golgi apparatus (GO:0005794), membrane (GO:0016020)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	2
cytoplasm	2
endomembrane system	2
intracellular membrane-bounded organelle	2
protein ubiquitination	1
modification-dependent protein catabolic process	1
protein modification by small protein conjugation	1
regulation of biological quality	1
MAPK cascade	1
regulation of MAPK cascade	1
negative regulation of intracellular signal transduction	1
response to xenobiotic stimulus	1
cellular response to chemical stimulus	1
transition metal ion binding	1
ubiquitin-protein transferase activity	1
ubiquitin-like protein ligase activity	1
catalytic activity	1
cation binding	1
intracellular anatomical structure	1
endosome	1

Protein interactions and networks

STRING

824 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
RNF149	ZNF319	Q9P2F9	517
RNF149	KAAG1	Q9UBP8	433
RNF149	TBC1D8	O95759	409
RNF149	ZNF805	Q5CZA5	400
RNF149	ZNF207	O43670	383
RNF149	FAM151B	Q6UXP7	378
RNF149	JOSD1	Q15040	365
RNF149	SETDB2	Q96T68	362
RNF149	RNFT1	Q5M7Z0	358
RNF149	RNF25	Q96BH1	347
RNF149	LRRC57	Q8N9N7	346
RNF149	ANO10	Q9NW15	338
RNF149	LONRF3	Q496Y0	336
RNF149	UBA2	Q9UBT2	334
RNF149	B3GNT4	Q9C0J1	325

IntAct

101 interactions, top by confidence:

A	B	Type	Score
LSMEM2	STX7	psi-mi:“MI:0914”(association)	0.740
SLC20A1	LIN7A	psi-mi:“MI:0914”(association)	0.640
PDGFRB	PIK3R2	psi-mi:“MI:0914”(association)	0.610
MANSC1	KLRG2	psi-mi:“MI:0914”(association)	0.530
TSPAN3	MAP1LC3B2	psi-mi:“MI:0914”(association)	0.530
TSPAN17	UPK3BL1	psi-mi:“MI:0914”(association)	0.530
PCDHB7	C2CD2L	psi-mi:“MI:0914”(association)	0.530
ACVR1	BMPR1A	psi-mi:“MI:0914”(association)	0.530
MRAP2	GOLIM4	psi-mi:“MI:0914”(association)	0.530
MRAP2	PODXL	psi-mi:“MI:0914”(association)	0.530
DLK1	SCAMP3	psi-mi:“MI:0914”(association)	0.530
HFE	ADAM10	psi-mi:“MI:0914”(association)	0.530
KCNE3	RIOK3	psi-mi:“MI:0914”(association)	0.530
	SNAP23	psi-mi:“MI:0914”(association)	0.350
LAMP1	HAX1	psi-mi:“MI:0914”(association)	0.350
BTNL8	TMEM131L	psi-mi:“MI:0914”(association)	0.350
TNFRSF10A	MAP1LC3B2	psi-mi:“MI:0914”(association)	0.350
RUSF1	MAP1LC3B2	psi-mi:“MI:0914”(association)	0.350
TPCN2	DDX11L8	psi-mi:“MI:0914”(association)	0.350
PCDHGB4	FAM171A2	psi-mi:“MI:0914”(association)	0.350
TMEM30A	UPK3BL1	psi-mi:“MI:0914”(association)	0.350
SLC20A1	MPP2	psi-mi:“MI:0914”(association)	0.350
MRAP2	GOSR1	psi-mi:“MI:0914”(association)	0.350
LITAF	SDCBP	psi-mi:“MI:0914”(association)	0.350
ARRDC3	ZNF593	psi-mi:“MI:0914”(association)	0.350
HEPACAM2	TNFRSF10B	psi-mi:“MI:0914”(association)	0.350
TMEM231	TNFRSF10B	psi-mi:“MI:0914”(association)	0.350

BioGRID (640): RNF149 (Affinity Capture-MS), RNF149 (Affinity Capture-MS), RNF149 (Affinity Capture-MS), RNF149 (Affinity Capture-MS), RNF149 (Affinity Capture-MS), RNF149 (Affinity Capture-MS), RNF149 (Affinity Capture-MS), RNF149 (Affinity Capture-MS), RNF149 (Affinity Capture-MS), RNF149 (Affinity Capture-MS), RNF149 (Affinity Capture-MS), RNF149 (Affinity Capture-MS), RNF149 (Affinity Capture-MS), RNF149 (Affinity Capture-MS), RNF149 (Affinity Capture-MS)

ESM2 similar proteins: A1L3I3, A2A699, A2AWH2, A4IHZ3, A6NKQ9, A6QNY1, A8MVW0, B4R1D8, B6VH76, B6VH77, B6VH79, D3YY23, O00220, O43278, O55034, O75074, O88204, O95502, P08751, P21563, P22618, P48778, Q04756, Q3U2C5, Q3U4N7, Q496H8, Q4R6Y5, Q4TUC0, Q5HZW5, Q6QNF4, Q7TPG6, Q7TQH7, Q7Z4F1, Q86T13, Q86VZ4, Q8BY98, Q8C2B3, Q8C4W3, Q8CB67, Q8IXA5

Diamond homologs: A5WWA0, E9QAU8, G3X9R7, O22197, O22755, O43567, O54965, O64763, P0C034, P0CH30, P0DPR2, Q06003, Q07G42, Q08D68, Q0II22, Q0VD51, Q10R93, Q14B02, Q29RU0, Q2TA44, Q3U2C5, Q4KLR8, Q4R6Y5, Q5NCP0, Q5RCV8, Q5RF74, Q5SPX3, Q5SSZ7, Q5XF85, Q641J8, Q66HG0, Q68DV7, Q69U49, Q6AY01, Q6DIP3, Q6IRP0, Q6NML0, Q6NQG7, Q6NRX0, Q6Y290

SIGNOR signaling

2 interactions.

A	Effect	B	Mechanism
Ub:E2	“up-regulates activity”	RNF149	ubiquitination
RNF149	“down-regulates quantity by destabilization”	BRAF	polyubiquitination

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 123 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Interferon gamma signaling	6	10.8×	2e-03

GO biological processes:

GO term	Partners	Fold	FDR
T cell receptor signaling pathway	8	12.2×	3e-04

Disease & clinical

Clinical variants and AI predictions

ClinVar

37 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	26
Likely benign	2
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

1362 predictions. Top by Δscore:

Variant	Effect	Δscore
2:101281853:GCTCA:G	donor_loss	1.0000
2:101281854:CTCA:C	donor_loss	1.0000
2:101281855:TCA:T	donor_loss	1.0000
2:101281856:CACCT:C	donor_loss	1.0000
2:101281857:A:AC	donor_gain	1.0000
2:101281858:C:CC	donor_gain	1.0000
2:101281858:C:CG	donor_loss	1.0000
2:101282054:CTCC:C	acceptor_gain	1.0000
2:101282059:T:TC	acceptor_gain	1.0000
2:101282066:T:C	acceptor_gain	1.0000
2:101282066:T:TC	acceptor_gain	1.0000
2:101282072:C:CT	acceptor_gain	1.0000
2:101288971:A:AC	donor_gain	1.0000
2:101288972:C:CC	donor_gain	1.0000
2:101294084:T:C	acceptor_gain	1.0000
2:101295177:TGTTC:T	acceptor_gain	1.0000
2:101295180:TC:T	acceptor_gain	1.0000
2:101295181:CC:C	acceptor_gain	1.0000
2:101295181:CCTG:C	acceptor_loss	1.0000
2:101295182:C:CC	acceptor_gain	1.0000
2:101281858:CCTAG:C	donor_gain	0.9900
2:101281862:G:C	donor_gain	0.9900
2:101282053:TCTCC:T	acceptor_gain	0.9900
2:101282054:CTCCC:C	acceptor_gain	0.9900
2:101282055:TCC:T	acceptor_gain	0.9900
2:101282055:TCCC:T	acceptor_gain	0.9900
2:101282056:CC:C	acceptor_gain	0.9900
2:101282056:CCC:C	acceptor_gain	0.9900
2:101282057:CC:C	acceptor_gain	0.9900
2:101282058:C:CC	acceptor_gain	0.9900

AlphaMissense

2597 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
2:101286115:C:G	C309S	1.000
2:101286116:A:T	C309S	1.000
2:101286125:A:G	C306R	1.000
2:101286144:C:A	W299C	1.000
2:101286144:C:G	W299C	1.000
2:101286146:A:G	W299R	1.000
2:101286146:A:T	W299R	1.000
2:101286156:G:C	C295W	1.000
2:101286157:C:T	C295Y	1.000
2:101286158:A:G	C295R	1.000
2:101286168:A:C	F291L	1.000
2:101286168:A:T	F291L	1.000
2:101286170:A:G	F291L	1.000
2:101289029:A:C	C269W	1.000
2:101289031:A:G	C269R	1.000
2:101286112:T:A	K310I	0.999
2:101286114:A:C	C309W	0.999
2:101286115:C:A	C309F	0.999
2:101286115:C:T	C309Y	0.999
2:101286116:A:G	C309R	0.999
2:101286121:G:T	P307Q	0.999
2:101286122:G:A	P307S	0.999
2:101286123:A:C	C306W	0.999
2:101286124:C:G	C306S	0.999
2:101286124:C:T	C306Y	0.999
2:101286125:A:C	C306G	0.999
2:101286125:A:T	C306S	0.999
2:101286142:A:G	L300P	0.999
2:101286157:C:A	C295F	0.999
2:101286157:C:G	C295S	0.999

dbSNP variants (sampled 300 via entrez): RS1000017454 (2:101287388 T>C), RS1000051823 (2:101303370 A>C), RS1000112217 (2:101286001 TTGTTTCTAGTCAATAATGAAACTGAA>T), RS1000146863 (2:101294170 G>A), RS1000215349 (2:101296851 T>A), RS1000272204 (2:101302870 C>G,T), RS1000302319 (2:101272201 G>A,T), RS1000388412 (2:101291059 T>A), RS1000413495 (2:101308865 C>T), RS1000414478 (2:101310504 A>G), RS1000489782 (2:101310263 C>T), RS1000669921 (2:101298586 A>C,T), RS1000722437 (2:101304721 T>C), RS1000725474 (2:101277491 C>A,T), RS1000818170 (2:101297165 C>A,T)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST000745_14	Pancreatic cancer	4.000000e-06
GCST009391_1106	Metabolite levels	9.000000e-06

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0010447	3-hydroxyanthranilic acid measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL6195769 (PROTEIN-PROTEIN INTERACTION)

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

33 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Cyclosporine	decreases expression, increases expression	2
aristolochic acid I	increases expression	1
GSK-J4	increases expression	1
ethylbenzene	increases expression	1
triphenyl phosphate	affects expression	1
arsenite	increases reaction, affects binding	1
methylparaben	increases expression	1
ochratoxin A	decreases expression	1
2-xylene	increases expression	1
beta-methylcholine	affects expression	1
di-n-butylphosphoric acid	affects expression	1
perfluorooctane sulfonic acid	increases expression	1
corosolic acid	increases expression	1
abrine	decreases expression	1
Resveratrol	affects cotreatment, increases expression	1
Temozolomide	increases expression	1
Sunitinib	increases expression	1
Gemcitabine	increases expression	1
Arsenic	increases expression	1
Benzene	increases expression	1
Benzo(a)pyrene	affects methylation	1
Calcitriol	increases expression	1
Gold	decreases expression	1
Methylene Chloride	increases expression	1
Phenobarbital	affects expression	1
Plant Extracts	increases expression, affects cotreatment	1
Smoke	decreases expression	1
Tobacco Smoke Pollution	increases expression	1
Toluene	increases expression	1
Trichloroethylene	increases expression	1

ChEMBL screening assays

11 unique, capped per target: 11 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL6076617	Binding	SiHyT-mediated degrader activity at RNF149/EGFR mutant in human HCC827 cels assessed as induction of EGFR degradation at 0.1 uM cells incubated in serum-free media for 8 hrs followed by incubation with compound for 24 hrs by western blot an	Development of Novel Silicon-Based Hydrophobic Tags (SiHyT) for Targeted Proteins Degradation. — J Med Chem

Cellosaurus cell lines

2 cell lines: 1 cancer cell line, 1 transformed cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B2DX	Abcam HeLa RNF149 KO	Cancer cell line	Female
CVCL_D9QS	Ubigene HEK293 RNF149 KO	Transformed cell line	Female

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.