RNF214

Summary

RNF214 (ring finger protein 214, HGNC:25335) is a protein-coding gene on chromosome 11q23.3, encoding RING finger protein 214 (Q8ND24).

Predicted to enable ubiquitin-protein transferase activity.

Source: NCBI Gene 257160 — RefSeq curated summary.

At a glance

• GWAS associations: 3
• Clinical variants (ClinVar): 76 total
• MANE Select transcript: NM_207343

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:25335
Approved symbol	RNF214
Name	ring finger protein 214
Location	11q23.3
Locus type	gene with protein product
Status	Approved
Aliases	DKFZp547C195
Ensembl gene	ENSG00000167257
Ensembl biotype	protein_coding
Entrez	257160

Gene structure

Transcript identifiers

Ensembl transcripts: 15 — 12 protein_coding, 2 retained_intron, 1 protein_coding_CDS_not_defined

ENST00000300650, ENST00000524917, ENST00000529869, ENST00000530849, ENST00000531287, ENST00000531452, ENST00000534428, ENST00000534709, ENST00000852074, ENST00000852075, ENST00000935424, ENST00000966475, ENST00000966476, ENST00000966477, ENST00000966478

RefSeq mRNA: 3 — MANE Select: NM_207343 NM_001077239, NM_001278249, NM_207343

CCDS: CCDS41720, CCDS60976

Canonical transcript exons

ENST00000300650 — 15 exons

Exon	Start	End
ENSE00001232392	117285086	117286454
ENSE00003465769	117234267	117234379
ENSE00003470067	117282746	117282850
ENSE00003517630	117244445	117244585
ENSE00003538339	117281600	117281698
ENSE00003545071	117282404	117282536
ENSE00003650410	117283115	117283210
ENSE00003850576	117232671	117232726
ENSE00003889756	117238601	117239111
ENSE00003891113	117239801	117239860
ENSE00003891207	117281314	117281404
ENSE00003891762	117280171	117280259
ENSE00003893622	117246809	117246948
ENSE00003894785	117281894	117282270
ENSE00003895975	117279908	117280004

Expression profiles

Bgee: expression breadth ubiquitous, 190 present calls, max score 93.00.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 6.6079 / max 114.8289, expressed in 1712 samples.

FANTOM5 promoters (9 alternative TSS)

Promoter ID	TPM avg	Samples expressed
116910	6.0943	1700
116911	0.1673	56
116918	0.1580	45
116916	0.0627	27
116922	0.0504	11
116917	0.0381	9
116920	0.0230	7
116919	0.0111	4
116921	0.0029	2

Top tissues by expression

244 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	93.00	gold quality
body of pancreas	UBERON:0001150	89.30	gold quality
sural nerve	UBERON:0015488	89.02	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	88.92	gold quality
right testis	UBERON:0004534	87.85	gold quality
left testis	UBERON:0004533	87.80	gold quality
pancreas	UBERON:0001264	87.11	gold quality
testis	UBERON:0000473	86.93	gold quality
cortical plate	UBERON:0005343	86.51	gold quality
ganglionic eminence	UBERON:0004023	86.37	gold quality
stromal cell of endometrium	CL:0002255	86.10	gold quality
gastrocnemius	UBERON:0001388	86.09	gold quality
cardiac muscle of right atrium	UBERON:0003379	85.97	gold quality
muscle of leg	UBERON:0001383	85.87	gold quality
right adrenal gland	UBERON:0001233	85.76	gold quality
ventricular zone	UBERON:0003053	85.60	gold quality
right adrenal gland cortex	UBERON:0035827	85.57	gold quality
granulocyte	CL:0000094	85.25	gold quality
colonic epithelium	UBERON:0000397	85.09	gold quality
right lobe of thyroid gland	UBERON:0001119	85.03	gold quality
islet of Langerhans	UBERON:0000006	84.98	gold quality
left ventricle myocardium	UBERON:0006566	84.56	gold quality
hindlimb stylopod muscle	UBERON:0004252	84.38	gold quality
body of stomach	UBERON:0001161	84.28	gold quality
left adrenal gland	UBERON:0001234	84.10	gold quality
left lobe of thyroid gland	UBERON:0001120	84.02	gold quality
right uterine tube	UBERON:0001302	83.82	gold quality
left adrenal gland cortex	UBERON:0035825	83.59	gold quality
popliteal artery	UBERON:0002250	83.58	gold quality
adrenal gland	UBERON:0002369	83.57	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	4.49

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

43 targeting RNF214, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-5692B	100.00	71.32	2622
HSA-MIR-5692C	100.00	71.32	2622
HSA-MIR-8485	100.00	77.57	4731
HSA-MIR-568	99.98	69.86	2084
HSA-MIR-4789-5P	99.98	70.76	2721
HSA-MIR-651-3P	99.94	73.48	5177
HSA-MIR-4778-3P	99.93	70.40	1818
HSA-MIR-329-3P	99.91	66.56	1234
HSA-MIR-362-3P	99.91	66.38	1267
HSA-MIR-374A-5P	99.90	71.34	2923
HSA-MIR-374B-5P	99.90	69.98	2734
HSA-MIR-3941	99.86	70.54	2735
HSA-MIR-369-3P	99.85	70.52	2264
HSA-MIR-544A	99.84	68.66	1965
HSA-MIR-3663-3P	99.84	70.39	798
HSA-MIR-4802-3P	99.72	70.13	1273
HSA-MIR-1208	99.70	68.28	1533
HSA-MIR-1284	99.67	73.56	1353
HSA-MIR-4708-3P	99.51	67.99	870
HSA-MIR-5689	99.50	71.26	1154
HSA-MIR-1207-5P	99.49	69.11	2983
HSA-MIR-20A-3P	99.44	69.10	1575
HSA-MIR-410-3P	99.27	69.98	2457
HSA-MIR-4763-3P	99.10	67.83	2649
HSA-MIR-670-3P	99.03	68.88	2404
HSA-MIR-6749-3P	99.00	65.73	1443
HSA-MIR-3619-5P	99.00	68.87	2308
HSA-MIR-942-3P	98.81	69.04	876
HSA-MIR-3922-5P	98.77	66.53	1059
HSA-MIR-4520-3P	98.75	66.55	963

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	si:ch211-139a5.1	ENSDARG00000092018
danio_rerio	rnf214	ENSDARG00000094018
mus_musculus	Rnf214	ENSMUSG00000042790
rattus_norvegicus	Rnf214	ENSRNOG00000017151

Protein

Protein identifiers

RING finger protein 214 — Q8ND24 (reviewed: Q8ND24)

All UniProt accessions (3): E9PN76, E9PRE9, Q8ND24

Isoforms (2)

UniProt ID	Names	Canonical?
Q8ND24-1	1	yes
Q8ND24-2	2

RefSeq proteins (3): NP_001070707, NP_001265178, NP_997226* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001841	Znf_RING	Domain
IPR013083	Znf_RING/FYVE/PHD	Homologous_superfamily
IPR056870	TTC3/DZIP3/RBM44-like_helical	Domain
IPR056872	TTC3/DZIP3-like_helical	Domain

Pfam: PF24525, PF24905

UniProt features (22 total): modified residue 10, region of interest 4, compositionally biased region 3, initiator methionine 1, chain 1, zinc finger region 1, splice variant 1, coiled-coil region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q8ND24-F1	65.92	0.30

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (10): 2, 15, 40, 47, 54, 176, 196, 497, 511, 516

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 89 (showing top): AGGAAGC_MIR5163P, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, GRAESSMANN_RESPONSE_TO_MC_AND_DOXORUBICIN_DN, TATTATA_MIR374, LYF1_01, LASTOWSKA_NEUROBLASTOMA_COPY_NUMBER_DN, TAATGTG_MIR323, GINESTIER_BREAST_CANCER_ZNF217_AMPLIFIED_DN, GOMF_ACYLTRANSFERASE_ACTIVITY, GOMF_AMINOACYLTRANSFERASE_ACTIVITY, KMT2D_TARGET_GENES, LHX9_TARGET_GENES, SKIL_TARGET_GENES, ZNF184_TARGET_GENES, GSE10240_CTRL_VS_IL17_AND_IL22_STIM_PRIMARY_BRONCHIAL_EPITHELIAL_CELLS_UP

GO Biological Process (0):

GO Molecular Function (3): ubiquitin-protein transferase activity (GO:0004842), zinc ion binding (GO:0008270), metal ion binding (GO:0046872)

GO Cellular Component (0):

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
ubiquitin-like protein transferase activity	1
transition metal ion binding	1
cation binding	1

Protein interactions and networks

STRING

470 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
RNF214	OR2F2	O95006	625
RNF214	UBE2L5	A0A1B0GUS4	525
RNF214	ZNF585A	Q6P3V2	476
RNF214	VPS26B	Q4G0F5	438
RNF214	THYN1	Q9P016	436
RNF214	MTARC1	Q5VT66	434
RNF214	KCNH4	Q9UQ05	404
RNF214	TRMT13	Q9NUP7	396
RNF214	SLC50A1	Q9BRV3	389
RNF214	ZNF397	Q8NF99	369
RNF214	TGDS	O95455	360
RNF214	MROH1	Q8NDA8	359
RNF214	CCDC57	Q2TAC2	348
RNF214	TBC1D22A	Q8WUA7	341
RNF214	LRRC8C	Q8TDW0	333

IntAct

33 interactions, top by confidence:

A	B	Type	Score
DYNLL1	BLTP3B	psi-mi:“MI:0914”(association)	0.730
CFTR	ESYT2	psi-mi:“MI:2364”(proximity)	0.710
DYNLL2	BLTP3B	psi-mi:“MI:0914”(association)	0.640
TKT	POTEF	psi-mi:“MI:0914”(association)	0.530
BAG2	HGS	psi-mi:“MI:0914”(association)	0.530
PLPPR2	METAP2	psi-mi:“MI:0914”(association)	0.530
DYNLL1	SHMT2	psi-mi:“MI:0914”(association)	0.510
DYNLL2	SHMT2	psi-mi:“MI:0914”(association)	0.510
RNF214	HMGA1	psi-mi:“MI:0915”(physical association)	0.400
DNAJC11		psi-mi:“MI:0914”(association)	0.350
SUPT5H	POLR2B	psi-mi:“MI:0914”(association)	0.350
DNAJC11	PDE6D	psi-mi:“MI:0914”(association)	0.350
PLPPR2	SEC24D	psi-mi:“MI:0914”(association)	0.350
TLK2	IGKV1D-13	psi-mi:“MI:0914”(association)	0.350
SPANXN2	ZNF320	psi-mi:“MI:0914”(association)	0.350
EEFSEC	HSPA8	psi-mi:“MI:0914”(association)	0.350
RNF214	TTC3	psi-mi:“MI:0914”(association)	0.350
DES	SYNM	psi-mi:“MI:0914”(association)	0.350
DHDH	ZNF185	psi-mi:“MI:0914”(association)	0.350
AQP12B	TIPRL	psi-mi:“MI:0914”(association)	0.350
CPEB1	CNOT1	psi-mi:“MI:2364”(proximity)	0.270
CFTR	UBA6	psi-mi:“MI:2364”(proximity)	0.270
BUD13	RPSA2	psi-mi:“MI:2364”(proximity)	0.270
EXOSC5	CNOT1	psi-mi:“MI:2364”(proximity)	0.270
RBM15	ILVBL	psi-mi:“MI:2364”(proximity)	0.270
NPM1	SBNO1	psi-mi:“MI:2364”(proximity)	0.270
DYNLL1	RNF214	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (125): RNF214 (Two-hybrid), RNF214 (Two-hybrid), RNF214 (Affinity Capture-MS), RNF214 (Affinity Capture-MS), RNF214 (Affinity Capture-MS), RNF214 (Affinity Capture-MS), RNF214 (Affinity Capture-MS), RNF214 (Affinity Capture-MS), RNF214 (Affinity Capture-MS), RNF214 (Affinity Capture-MS), RNF214 (Affinity Capture-MS), RNF214 (Affinity Capture-MS), RNF214 (Proximity Label-MS), RNF214 (Proximity Label-MS), RNF214 (Two-hybrid)

ESM2 similar proteins: A0A1L8GR68, A2CG63, E9Q9M8, F7AQ22, G3V8T1, O75152, O75376, P49140, P51826, P97432, Q13625, Q14596, Q17R98, Q1LY51, Q3TYA6, Q4KKX4, Q4LE39, Q4R6F6, Q501R9, Q505G8, Q5F3Z9, Q5HYC2, Q5RC94, Q5XJV7, Q60974, Q68FE8, Q69Z61, Q6A098, Q6NXK2, Q6NZF1, Q6PJT7, Q6ZNC4, Q86YI8, Q8BFU3, Q8BJ05, Q8CCH7, Q8CG79, Q8CHY6, Q8K2W6, Q8ND24

Diamond homologs: Q8BFU3, Q8ND24

SIGNOR signaling

1 interactions.

A	Effect	B	Mechanism
Ub:E2	“up-regulates activity”	RNF214	ubiquitination

Disease & clinical

Clinical variants and AI predictions

ClinVar

76 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	55
Likely benign	2
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

2389 predictions. Top by Δscore:

Variant	Effect	Δscore
11:117239797:ATAG:A	acceptor_loss	1.0000
11:117239798:T:G	acceptor_gain	1.0000
11:117239798:TA:T	acceptor_loss	1.0000
11:117239799:A:AG	acceptor_gain	1.0000
11:117239799:AG:A	acceptor_loss	1.0000
11:117239799:AGACT:A	acceptor_gain	1.0000
11:117239800:G:GG	acceptor_gain	1.0000
11:117239800:GA:G	acceptor_gain	1.0000
11:117239800:GAC:G	acceptor_gain	1.0000
11:117239800:GACT:G	acceptor_gain	1.0000
11:117239800:GACTG:G	acceptor_gain	1.0000
11:117239856:ATTTG:A	donor_gain	1.0000
11:117239857:TTTG:T	donor_gain	1.0000
11:117239860:GGTA:G	donor_loss	1.0000
11:117239861:G:C	donor_loss	1.0000
11:117239861:G:GG	donor_gain	1.0000
11:117239862:T:G	donor_loss	1.0000
11:117242165:T:G	donor_gain	1.0000
11:117244440:A:AG	acceptor_gain	1.0000
11:117244440:AATAG:A	acceptor_gain	1.0000
11:117244443:A:AG	acceptor_gain	1.0000
11:117244443:AG:A	acceptor_gain	1.0000
11:117244444:G:GC	acceptor_gain	1.0000
11:117244444:GG:G	acceptor_gain	1.0000
11:117244444:GGA:G	acceptor_gain	1.0000
11:117244444:GGAT:G	acceptor_gain	1.0000
11:117244444:GGATA:G	acceptor_gain	1.0000
11:117244583:CAG:C	donor_loss	1.0000
11:117244584:AG:A	donor_loss	1.0000
11:117244586:G:GA	donor_loss	1.0000

AlphaMissense

4613 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
11:117244548:T:C	L261P	1.000
11:117246909:T:C	L307P	1.000
11:117279988:G:C	R347P	1.000
11:117279990:G:C	A348P	1.000
11:117279999:G:C	A351P	1.000
11:117280004:G:C	E352D	1.000
11:117280004:G:T	E352D	1.000
11:117280177:T:C	S355P	1.000
11:117280181:T:A	L356Q	1.000
11:117280181:T:C	L356P	1.000
11:117280190:G:C	R359P	1.000
11:117280202:T:C	L363P	1.000
11:117280208:T:C	L365P	1.000
11:117280214:T:C	L367P	1.000
11:117280222:G:C	A370P	1.000
11:117280234:G:C	A374P	1.000
11:117280247:T:C	L378P	1.000
11:117281357:T:A	W397R	1.000
11:117281357:T:C	W397R	1.000
11:117281359:G:C	W397C	1.000
11:117281359:G:T	W397C	1.000
11:117281370:T:C	L401P	1.000
11:117281606:T:C	F415L	1.000
11:117281607:T:C	F415S	1.000
11:117281608:T:A	F415L	1.000
11:117281608:T:G	F415L	1.000
11:117281637:G:A	G425E	1.000
11:117281637:G:T	G425V	1.000
11:117281646:T:A	L428Q	1.000
11:117281646:T:C	L428P	1.000

dbSNP variants (sampled 300 via entrez): RS1000008887 (11:117266023 G>A), RS1000014913 (11:117257816 A>G), RS1000065414 (11:117259190 CAAGTGAGCTGCCTGCCTCGGCCTCCCA>C), RS1000083717 (11:117266386 G>T), RS1000192582 (11:117275635 C>A,G,T), RS1000240595 (11:117263201 G>C), RS1000304049 (11:117261173 G>A,T), RS1000307777 (11:117235348 C>A,T), RS1000344447 (11:117240190 A>C,G,T), RS1000348462 (11:117230936 A>C), RS1000400902 (11:117231271 A>G), RS1000429346 (11:117278517 T>C), RS1000442707 (11:117268822 G>C,T), RS1000553486 (11:117261792 C>T), RS1000643333 (11:117234298 T>G)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

3 associations (top):

Study	Trait	p-value
GCST009310_15	Sensorimotor dexterity	5.000000e-06
GCST010241_179	Apolipoprotein A1 levels	6.000000e-30
GCST010242_298	HDL cholesterol levels	2.000000e-24

EFO canonical traits (3, from GWAS)

EFO ID	Trait name
EFO:0008354	cognitive function measurement
EFO:0004614	apolipoprotein A 1 measurement
EFO:0004612	high density lipoprotein cholesterol measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

28 total (human), top 28 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	decreases expression, affects cotreatment, increases abundance, increases expression	3
Valproic Acid	affects expression, increases methylation	2
aristolochic acid I	decreases expression	1
FR900359	affects phosphorylation	1
tris(1,3-dichloro-2-propyl)phosphate	increases expression	1
manganese chloride	affects cotreatment, decreases expression, increases abundance	1
aflatoxin B2	increases methylation	1
coumarin	decreases phosphorylation	1
perfluorooctane sulfonic acid	increases expression	1
abrine	increases expression	1
2-methyl-2H-pyrazole-3-carboxylic acid (2-methyl-4-o-tolylazophenyl)amide	decreases reaction, increases expression	1
4-(4-((5-(4,5-dimethyl-2-nitrophenyl)-2-furanyl)methylene)-4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)benzoic acid	decreases expression	1
Air Pollutants	increases abundance, affects expression	1
Arsenic	affects cotreatment, decreases expression, increases abundance	1
Atrazine	increases expression	1
Vehicle Emissions	decreases reaction, increases expression	1
Caffeine	affects phosphorylation	1
Doxorubicin	decreases expression	1
Enzyme Inhibitors	decreases activity, increases O-linked glycosylation	1
Ivermectin	decreases expression	1
Manganese	affects cotreatment, decreases expression, increases abundance	1
Ozone	increases abundance, affects expression	1
Tobacco Smoke Pollution	decreases expression	1
Tretinoin	decreases expression	1
Cyclosporine	increases expression	1
Aflatoxin B1	decreases methylation	1
Cadmium Chloride	decreases expression	1
Particulate Matter	decreases reaction, increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.