RPL3L

Summary

RPL3L (ribosomal protein L3 like, HGNC:10351) is a protein-coding gene on chromosome 16p13.3, encoding Ribosomal protein uL3-like (Q92901). Heart- and skeletal muscle-specific component of the ribosome, which regulates muscle function.

This gene encodes a protein that shares sequence similarity with ribosomal protein L3. The protein belongs to the L3P family of ribosomal proteins. Unlike the ubiquitous expression of ribosomal protein genes, this gene has a tissue-specific pattern of expression, with the highest levels of expression in skeletal muscle and heart. It is not currently known whether the encoded protein is a functional ribosomal protein or whether it has evolved a function that is independent of the ribosome.

Source: NCBI Gene 6123 — RefSeq curated summary.

At a glance

• Gene–disease (curated): cardiomyopathy, dilated, 2D (Strong, GenCC) — +1 more curated relationship
• GWAS associations: 9
• Clinical variants (ClinVar): 139 total — 5 pathogenic, 2 likely-pathogenic
• Phenotypes (HPO): 27
• MANE Select transcript: NM_005061

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:10351
Approved symbol	RPL3L
Name	ribosomal protein L3 like
Location	16p13.3
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000140986
Ensembl biotype	protein_coding
OMIM	617416
Entrez	6123

Gene structure

Transcript identifiers

Ensembl transcripts: 15 — 14 protein_coding, 1 protein_coding_CDS_not_defined

ENST00000268661, ENST00000565426, ENST00000566484, ENST00000902258, ENST00000902259, ENST00000968103, ENST00000968104, ENST00000968105, ENST00000968106, ENST00000968107, ENST00000968108, ENST00000968109, ENST00000968110, ENST00000968111, ENST00000968112

RefSeq mRNA: 1 — MANE Select: NM_005061 NM_005061

CCDS: CCDS10450

Canonical transcript exons

ENST00000268661 — 10 exons

Exon	Start	End
ENSE00000945934	1952874	1953042
ENSE00000945935	1950844	1950979
ENSE00000945936	1947194	1947380
ENSE00000945938	1946625	1946726
ENSE00000945940	1945499	1945618
ENSE00001267074	1943974	1944893
ENSE00001363300	1954629	1954689
ENSE00001663704	1945835	1945930
ENSE00001780983	1946938	1947098
ENSE00003657249	1953956	1954148

Expression profiles

Bgee: expression breadth ubiquitous, 156 present calls, max score 99.34.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 1.9111 / max 525.8126, expressed in 99 samples.

FANTOM5 promoters (3 alternative TSS)

Promoter ID	TPM avg	Samples expressed
155885	1.7956	51
155887	0.0667	32
155886	0.0488	19

Top tissues by expression

281 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	99.34	gold quality
hindlimb stylopod muscle	UBERON:0004252	99.16	gold quality
vastus lateralis	UBERON:0001379	99.05	gold quality
triceps brachii	UBERON:0001509	98.95	gold quality
diaphragm	UBERON:0001103	98.94	gold quality
quadriceps femoris	UBERON:0001377	98.75	gold quality
gastrocnemius	UBERON:0001388	98.72	gold quality
apex of heart	UBERON:0002098	98.58	gold quality
gluteal muscle	UBERON:0002000	98.31	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	98.27	gold quality
biceps brachii	UBERON:0001507	98.12	gold quality
skeletal muscle tissue	UBERON:0001134	97.45	gold quality
heart right ventricle	UBERON:0002080	97.44	gold quality
muscle organ	UBERON:0001630	97.14	gold quality
skeletal muscle organ	UBERON:0014892	97.14	gold quality
heart left ventricle	UBERON:0002084	97.03	gold quality
cardiac ventricle	UBERON:0002082	96.87	gold quality
muscle of leg	UBERON:0001383	96.71	gold quality
deltoid	UBERON:0001476	94.79	gold quality
tibialis anterior	UBERON:0001385	91.48	silver quality
muscle tissue	UBERON:0002385	91.46	gold quality
heart	UBERON:0000948	87.29	gold quality
right atrium auricular region	UBERON:0006631	86.41	gold quality
cardiac atrium	UBERON:0002081	85.16	gold quality
left ventricle myocardium	UBERON:0006566	82.95	gold quality
myocardium	UBERON:0002349	82.88	gold quality
body of tongue	UBERON:0011876	82.88	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	77.21	silver quality
right testis	UBERON:0004534	76.99	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	76.95	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	7.87

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

6 targeting RPL3L, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4267	99.96	66.53	2368
HSA-MIR-4690-5P	99.65	66.24	813
HSA-MIR-486-3P	99.51	66.82	1901
HSA-MIR-6529-5P	97.85	66.47	673
HSA-MIR-4329	97.68	66.26	1003
HSA-MIR-6869-5P	97.17	67.06	634

Literature-anchored findings (GeneRIF, showing 1)

• Exploring the Regulation and Function of Rpl3l in the Development of Early-Onset Dilated Cardiomyopathy and Congestive Heart Failure Using Systems Genetics Approach. (PMID:38254943)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
mus_musculus	Rpl3l	ENSMUSG00000002500
rattus_norvegicus	Rpl3l	ENSRNOG00000014641
drosophila_melanogaster	RpL3	FBGN0020910
caenorhabditis_elegans		WBGENE00004414

Paralogs (1): RPL3 (ENSG00000100316)

Protein

Protein identifiers

Ribosomal protein uL3-like — Q92901 (reviewed: Q92901)

Alternative names: 60S ribosomal protein L3-like, Large ribosomal subunit protein uL3-like

All UniProt accessions (2): Q92901, H3BQN3

UniProt curated annotations — full annotation on UniProt →

Function. Heart- and skeletal muscle-specific component of the ribosome, which regulates muscle function. Component of the large ribosomal subunit in striated muscle cells: replaces the RPL3 paralog in the ribosome in these cells. The ribosome is a large ribonucleoprotein complex responsible for the synthesis of proteins in the cell. Inhibits myotube growth and muscle function.

Subunit / interactions. Component of the large ribosomal subunit in striated muscle cells.

Disease relevance. Cardiomyopathy, dilated, 2D (CMD2D) [MIM:619371] A form of dilated cardiomyopathy, a disorder characterized by ventricular dilation and impaired systolic function, resulting in congestive heart failure and arrhythmia. Patients are at risk of premature death. CMD2D is an autosomal recessive, severe form with neonatal onset. The disease may be caused by variants affecting the gene represented in this entry.

Similarity. Belongs to the universal ribosomal protein uL3 family.

RefSeq proteins (1): NP_005052* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000597	Ribosomal_uL3	Family
IPR009000	Transl_B-barrel_sf	Homologous_superfamily
IPR019926	Ribosomal_uL3_CS	Conserved_site
IPR044892	Ribosomal_L3_dom_3_arc_sf	Homologous_superfamily
IPR045077	L3_arc_euk	Family

Pfam: PF00297

UniProt features (14 total): sequence variant 10, region of interest 2, chain 1, compositionally biased region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q92901-F1	94.79	0.93

Function

Pathways and Gene Ontology

Reactome pathways

16 pathways

ID	Pathway
R-HSA-156827	L13a-mediated translational silencing of Ceruloplasmin expression
R-HSA-156902	Peptide chain elongation
R-HSA-1799339	SRP-dependent cotranslational protein targeting to membrane
R-HSA-192823	Viral mRNA Translation
R-HSA-2408557	Selenocysteine synthesis
R-HSA-6791226	Major pathway of rRNA processing in the nucleolus and cytosol
R-HSA-72689	Formation of a pool of free 40S subunits
R-HSA-72706	GTP hydrolysis and joining of the 60S ribosomal subunit
R-HSA-72764	Eukaryotic Translation Termination
R-HSA-9010553	Regulation of expression of SLITs and ROBOs
R-HSA-9633012	Response of EIF2AK4 (GCN2) to amino acid deficiency
R-HSA-975956	Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC)
R-HSA-975957	Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC)
R-HSA-9954709	Ribosome Quality Control (RQC) complex extracts and degrades nascent peptide
R-HSA-9954714	PELO:HBS1L and ABCE1 dissociate a ribosome on a non-stop mRNA
R-HSA-9954716	ZNF598 and the Ribosome-associated Quality Trigger (RQT) complex dissociate a ribosome stalled on a no-go mRNA

MSigDB gene sets: 162 (showing top): GOBP_CYTOPLASMIC_TRANSLATION, GOBP_MUSCLE_TISSUE_DEVELOPMENT, GOBP_NEGATIVE_REGULATION_OF_STRIATED_MUSCLE_CELL_DIFFERENTIATION, GOBP_NEGATIVE_REGULATION_OF_MUSCLE_CELL_DIFFERENTIATION, GOBP_STRIATED_MUSCLE_CELL_DIFFERENTIATION, GOBP_REGULATION_OF_STRIATED_MUSCLE_CELL_DIFFERENTIATION, GOBP_NEGATIVE_REGULATION_OF_MYOTUBE_DIFFERENTIATION, GOBP_NEGATIVE_REGULATION_OF_CELLULAR_COMPONENT_ORGANIZATION, GOBP_TRANSLATION, MARTINEZ_RB1_TARGETS_UP, GOBP_MUSCLE_STRUCTURE_DEVELOPMENT, GOBP_MUSCLE_CONTRACTION, GOBP_REGULATION_OF_MUSCLE_CELL_DIFFERENTIATION, GOBP_REGULATION_OF_SYNCYTIUM_FORMATION_BY_PLASMA_MEMBRANE_FUSION, GOMF_STRUCTURAL_CONSTITUENT_OF_RIBOSOME

GO Biological Process (3): translation (GO:0006412), negative regulation of myotube differentiation (GO:0010832), regulation of striated muscle tissue development (GO:0016202)

GO Molecular Function (2): RNA binding (GO:0003723), structural constituent of ribosome (GO:0003735)

GO Cellular Component (4): ribosome (GO:0005840), membrane (GO:0016020), cytosolic large ribosomal subunit (GO:0022625), ribonucleoprotein complex (GO:1990904)

Reactome top-level categories

Rollup of top-11 pathways:

Category	Pathways
Ribosome-associated quality control	3
Translation	2
Cap-dependent Translation Initiation	2
Nonsense-Mediated Decay (NMD)	2
Eukaryotic Translation Initiation	1
Eukaryotic Translation Elongation	1
Influenza Viral RNA Transcription and Replication	1
Selenoamino acid metabolism	1
rRNA processing in the nucleus and cytosol	1
Signaling by ROBO receptors	1
Cellular response to starvation	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
peptidyltransferase activity	1
translational initiation	1
translational elongation	1
translational termination	1
macromolecule biosynthetic process	1
protein metabolic process	1
protein biosynthetic process	1
regulation of myotube differentiation	1
myotube differentiation	1
negative regulation of striated muscle cell differentiation	1
striated muscle tissue development	1
regulation of muscle organ development	1
regulation of muscle tissue development	1
nucleic acid binding	1
structural molecule activity	1
ribosome	1
intracellular membraneless organelle	1
cellular anatomical structure	1
large ribosomal subunit	1
cytosolic ribosome	1
protein-containing complex	1

Protein interactions and networks

STRING

4464 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
RPL3L	RPL10L	Q96L21	703
RPL3L	RPS24	P16632	668
RPL3L	RPL19	P14118	651
RPL3L	RPL39L	Q96EH5	628
RPL3L	RPL22L1	Q6P5R6	575
RPL3L	RPL36AL	Q969Q0	570
RPL3L	RPL23A	P29316	510
RPL3L	RPL38	P23411	509
RPL3L	RPS26	P02383	491
RPL3L	RPS17	P08708	491
RPL3L	RPL8	P25120	489
RPL3L	MPHOSPH6	Q99547	483
RPL3L	EIF3G	O75821	476
RPL3L	RPL5	P46777	475
RPL3L	RPL15	P39030	471

IntAct

6 interactions, top by confidence:

A	B	Type	Score
INAVA	CYTH3	psi-mi:“MI:0914”(association)	0.640
vIRF	GPC4	psi-mi:“MI:0914”(association)	0.350
G3BP2	FARS2	psi-mi:“MI:0914”(association)	0.350
ESR2		psi-mi:“MI:0914”(association)	0.350
CSNK2A2	CNOT1	psi-mi:“MI:0914”(association)	0.350

BioGRID (89): RPL13 (Co-fractionation), RPL14 (Co-fractionation), RPL15 (Co-fractionation), RPL18 (Co-fractionation), RPL23A (Co-fractionation), RPL27A (Co-fractionation), RPL30 (Co-fractionation), RPL37A (Co-fractionation), RPL39 (Co-fractionation), RPL3L (Co-fractionation), RPL3L (Co-fractionation), RPL3L (Co-fractionation), RPL3L (Co-fractionation), RPL3L (Co-fractionation), RPL3L (Co-fractionation)

ESM2 similar proteins: A5JSW9, B2CAZ2, B7XMD2, E9PWZ3, G1TL06, O01727, O14049, O16797, O96774, P0CX39, P0CX40, P14126, P17094, P21531, P22738, P27659, P29327, P34113, P35684, P36584, P39023, P39872, P40372, P49149, P50880, P59671, P62247, Q29293, Q3SZ10, Q4N3P0, Q4R5Q0, Q4UFS9, Q54E24, Q59LS1, Q5DAA3, Q64FN2, Q6BXM5, Q6CJR7, Q6FTJ2, Q759R7

Diamond homologs: A0B9X0, A0LIJ0, A1RVG3, A2SPK3, A3CSZ7, A3DNA4, A3MWI4, A4FVY2, A4WMH5, A4YCW6, A5UL89, A6UQJ0, A6UV68, A6VHD2, A7I5N9, A7Z0N8, A8M529, A8MB75, A9A9B8, B0R656, B1YD88, B2GIL4, B6YSL3, B8GKD3, C3MQ59, C3MVH8, C3N5S7, C3NEE3, C3NHA9, C4KHF6, C5A286, C6A159, E9PWZ3, G1TL06, G7WMS7, O16797, O26110, O28354, O59418, O96774

SIGNOR signaling

1 interactions.

A	Effect	B	Mechanism
RPL3L	“form complex”	“60S cytosolic large ribosomal subunit”	binding

Disease & clinical

Clinical variants and AI predictions

ClinVar

139 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	5
Likely pathogenic	2
Uncertain significance	117
Likely benign	8
Benign	1

Top pathogenic / likely-pathogenic (7)

Variant ID	HGVS	Classification
1162248	NM_005061.3(RPL3L):c.923A>T (p.Asp308Val)	Pathogenic
1162249	NM_005061.3(RPL3L):c.1027C>T (p.Arg343Trp)	Pathogenic
1162250	NM_005061.3(RPL3L):c.566C>T (p.Thr189Met)	Pathogenic
1162253	NM_005061.3(RPL3L):c.481C>T (p.Arg161Trp)	Pathogenic
1162254	NM_005061.3(RPL3L):c.347G>A (p.Arg116His)	Pathogenic
3337524	NM_005061.3(RPL3L):c.1150G>A (p.Glu384Lys)	Likely pathogenic
4845737	NM_005061.3(RPL3L):c.523C>T (p.Gln175Ter)	Likely pathogenic

SpliceAI

1966 predictions. Top by Δscore:

Variant	Effect	Δscore
16:1945615:GGGA:G	acceptor_gain	1.0000
16:1945616:GGA:G	acceptor_gain	1.0000
16:1945617:GA:G	acceptor_gain	1.0000
16:1945619:C:CC	acceptor_gain	1.0000
16:1945628:CCA:C	acceptor_gain	1.0000
16:1945629:C:T	acceptor_gain	1.0000
16:1945629:CA:C	acceptor_gain	1.0000
16:1945630:A:C	acceptor_gain	1.0000
16:1945843:G:C	donor_gain	1.0000
16:1945926:CCACC:C	acceptor_gain	1.0000
16:1945927:CACC:C	acceptor_gain	1.0000
16:1945927:CACCC:C	acceptor_gain	1.0000
16:1945928:ACCC:A	acceptor_loss	1.0000
16:1945929:CC:C	acceptor_gain	1.0000
16:1945930:CC:C	acceptor_gain	1.0000
16:1945932:T:A	acceptor_loss	1.0000
16:1946731:C:CT	acceptor_gain	1.0000
16:1946744:A:C	acceptor_gain	1.0000
16:1946934:GCA:G	donor_loss	1.0000
16:1946937:C:CT	donor_loss	1.0000
16:1946937:CCTT:C	donor_gain	1.0000
16:1947094:GACCC:G	acceptor_gain	1.0000
16:1947096:CCC:C	acceptor_gain	1.0000
16:1947097:CC:C	acceptor_gain	1.0000
16:1947097:CCC:C	acceptor_gain	1.0000
16:1947098:CC:C	acceptor_gain	1.0000
16:1947098:CCTG:C	acceptor_loss	1.0000
16:1947099:C:CC	acceptor_gain	1.0000
16:1947099:CTGTG:C	acceptor_loss	1.0000
16:1947188:CCCTA:C	donor_loss	1.0000

AlphaMissense

2676 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
16:1947058:C:A	K243N	0.992
16:1947058:C:G	K243N	0.992
16:1954134:A:C	F6L	0.992
16:1954134:A:T	F6L	0.992
16:1954136:A:G	F6L	0.992
16:1945529:G:C	F379L	0.991
16:1945529:G:T	F379L	0.991
16:1945531:A:G	F379L	0.991
16:1947042:G:T	R249S	0.991
16:1953009:G:T	T77K	0.991
16:1954002:C:A	K50N	0.990
16:1954002:C:G	K50N	0.990
16:1950863:C:G	R161P	0.989
16:1954104:G:C	F16L	0.989
16:1954104:G:T	F16L	0.989
16:1954106:A:G	F16L	0.989
16:1946957:C:G	R277P	0.987
16:1953009:G:A	T77I	0.987
16:1945838:T:A	R348S	0.986
16:1945838:T:G	R348S	0.986
16:1945922:G:C	F320L	0.986
16:1945922:G:T	F320L	0.986
16:1945924:A:G	F320L	0.986
16:1945892:G:C	F330L	0.985
16:1945892:G:T	F330L	0.985
16:1945894:A:G	F330L	0.985
16:1953009:G:C	T77R	0.985
16:1954019:C:G	A45P	0.985
16:1945923:A:G	F320S	0.984
16:1947087:G:T	R234S	0.984

dbSNP variants (sampled 300 via entrez): RS1000011132 (16:1952833 C>G), RS1000252205 (16:1944802 G>T), RS1000694775 (16:1953443 C>G,T), RS1000807983 (16:1948161 T>A), RS1000821280 (16:1950417 T>C), RS1001244135 (16:1943521 G>C), RS1001298634 (16:1947655 A>G), RS1001796701 (16:1956630 C>A,T), RS1001903474 (16:1953775 G>A), RS1001920992 (16:1955138 G>A), RS1002045275 (16:1945123 A>C), RS1002095269 (16:1951392 T>G), RS1002857884 (16:1954607 C>T), RS1002872371 (16:1944386 GAGCTGACTCAGCGCAAGAAGAC>G), RS1002909973 (16:1954435 T>G)

Disease associations

OMIM: gene MIM:617416 | disease phenotypes: MIM:619371

GenCC curated gene-disease

Disease	Classification	Inheritance
cardiomyopathy, dilated, 2D	Strong	Autosomal recessive
dilated cardiomyopathy	Limited	Autosomal recessive

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
cardiomyopathy, dilated, 2D	Moderate	AR

Mondo (3): cardiomyopathy, dilated, 2D (MONDO:0030300), cardiomyopathy (MONDO:0004994), dilated cardiomyopathy (MONDO:0005021)

Orphanet (1): Rare cardiomyopathy (Orphanet:167848)

HPO phenotypes

27 total (27 of 27 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000407	Sensorineural hearing impairment
HP:0000969	Edema
HP:0001522	Death in infancy
HP:0001635	Congestive heart failure
HP:0001644	Dilated cardiomyopathy
HP:0001653	Mitral regurgitation
HP:0001655	Patent foramen ovale
HP:0001727	Thromboembolic stroke
HP:0002092	Pulmonary arterial hypertension
HP:0002875	Exertional dyspnea
HP:0003198	Myopathy
HP:0003457	EMG abnormality
HP:0003593	Infantile onset
HP:0003623	Neonatal onset
HP:0005180	Tricuspid regurgitation
HP:0011623	Muscular ventricular septal defect
HP:0011675	Arrhythmia
HP:0012378	Fatigue
HP:0012664	Reduced left ventricular ejection fraction
HP:0012764	Orthopnea
HP:0025169	Left ventricular systolic dysfunction
HP:0030149	Cardiogenic shock
HP:0030718	Right atrial enlargement
HP:0031329	Interstitial cardiac fibrosis
HP:0033997	Perinuclear cardiomyocyte vacuolization
HP:0100578	Lipoatrophy

GWAS associations

9 associations (top):

Study	Trait	p-value
GCST006061_132	Atrial fibrillation	6.000000e-14
GCST006061_3	Atrial fibrillation	4.000000e-14
GCST006414_116	Atrial fibrillation	2.000000e-08
GCST006414_30	Atrial fibrillation	2.000000e-14
GCST006414_94	Atrial fibrillation	2.000000e-08
GCST008058_214	Estimated glomerular filtration rate	1.000000e-12
GCST008059_6	Estimated glomerular filtration rate	2.000000e-16
GCST010796_5218	Electrocardiogram morphology (amplitude at temporal datapoints)	2.000000e-08
GCST90002397_229	Mean spheric corpuscular volume	3.000000e-09

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0004327	electrocardiography

MeSH disease descriptors (2)

Descriptor	Name	Tree numbers
D009202	Cardiomyopathies	C14.280.238
D002311	Cardiomyopathy, Dilated	C14.280.195.160; C14.280.238.070; C16.320.488.750

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

8 total (human), top 8 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
tris(2-butoxyethyl) phosphate	decreases expression	1
abrine	increases expression	1
(+)-JQ1 compound	increases expression	1
Asbestos	increases expression	1
Lead	decreases expression	1
Urethane	increases expression	1
Valproic Acid	increases methylation	1
Okadaic Acid	increases expression	1

Clinical trials (associated diseases)

450 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00374465	PHASE4	UNKNOWN	Therapy With Verapamil or Carvedilol in Chronic Heart Failure
NCT01293903	PHASE4	COMPLETED	Study of Qiliqiangxin Capsule to Treat Dilated Cardiomyopathy
NCT01557140	PHASE4	COMPLETED	A Randomized Trial of Carvedilol in Chronic Chagas Cardiomyopathy
NCT01917149	PHASE4	COMPLETED	Supramaximal Titrated Inhibition of RAAS in Dilated Cardiomyopathy
NCT02115581	PHASE4	COMPLETED	Coenzyme Q10 Supplementation in Children With Idiopathic Dilated Cardiomyopathy
NCT06236022	PHASE4	RECRUITING	The Effects of Sirolimus in Patients With Dilated Cardiomyopathy Infected With Kaposi Sarcoma-associated Virus
NCT00348530	PHASE4	UNKNOWN	Carvedilol Versus Verapamil in Chronic Heart Failure Secondary to Non-Ischemic Cardiomyopathy
NCT00371891	PHASE4	COMPLETED	Ontario Multidetector Computed Tomographic (MDCT) Coronary Angiography Study (OMCAS)
NCT00401856	PHASE4	COMPLETED	CMR to Assess Fibrosis in Cardiomyopathy Using Eplerenone
NCT00559338	PHASE4	COMPLETED	Impact of Nesiritide Infusion for Decompensated Heart Failure in the Emergency Department
NCT00606775	PHASE4	UNKNOWN	The Preventive Efficacy of Carvedilol on Cardiac Dysfunction in Duchenne Muscular Dystrophy
NCT00658203	PHASE4	COMPLETED	Clinical Evaluation on Advanced Resynchronization
NCT00701220	PHASE4	COMPLETED	Statin Therapy for Ischemic and Nonischemic Cardiomyopathy
NCT00800761	PHASE4	COMPLETED	Intensive Combined Chelation Therapy for Iron-Induced Cardiac Disease in Patients With Thalassemia Major
NCT00806390	PHASE4	TERMINATED	Prevention of Anthracycline or Trastuzumab Induced Cardiomyopathy by Metoprolol
NCT01006473	PHASE4	COMPLETED	Exercise Training in Chagas Cardiomyopathy
NCT01261065	PHASE4	COMPLETED	Mechanisms of Improvement With Beta-Blocker Treatment in Heart Failure
NCT01345188	PHASE4	COMPLETED	Ranolazine in Ischemic Cardiomyopathy
NCT01868841	PHASE4	COMPLETED	123-I mIBG (AdreView) Heart-to-Mediastinal (H/M) Ratio and SPECT Imaging on a Small Field of View-High Efficiency Cardiac SPECT System
NCT02640846	PHASE4	UNKNOWN	Effects of Levosimendan, Milrinone and Norepinephrine on Left and Right Ventricular Function in Septic Shock
NCT03228823	PHASE4	UNKNOWN	Prospective Assessment of Premature Ventricular Contractions Suppression in Cardiomyopathy(PAPS)
NCT04323852	PHASE4	COMPLETED	Can Vitamin D Reduce Heart Muscle Damage After Bypass Surgery?
NCT05034432	PHASE4	RECRUITING	The PIVATAL Study -Study of Ventricular Arrhythmia (VTA) Ablation in Left Ventricular Assist Device (LVAD) Patients
NCT05718128	PHASE4	RECRUITING	Clinical Study of Endocardial Myocardial Biopsy
NCT06964464	PHASE4	RECRUITING	Comparative Effectiveness of Carvedilol Versus Metoprolol Succinate in Heart Failure Patients With an Implantable Cardioverter Defibrillator
NCT00333827	PHASE3	COMPLETED	Cell Therapy In Dilated Cardiomyopathy
NCT00505154	PHASE3	COMPLETED	Effect of Rosuvastatin on Left Ventricular Remodeling
NCT01223703	PHASE3	COMPLETED	PUFAs and Left Ventricular Function in Heart Failure
NCT01583114	PHASE3	TERMINATED	PREclinical Mutation CARriers From Families With DIlated Cardiomyopathy and ACE Inhibitors
NCT01914081	PHASE3	UNKNOWN	Resveratrol: A Potential Anti- Remodeling Agent in Heart Failure, From Bench to Bedside
NCT02989181	PHASE3	UNKNOWN	Continues Positive Airway Pressure Treatment for Patients With Dilated Cardiomyopathy and Obstructive Sleep Apnea
NCT03439514	PHASE3	TERMINATED	A Study of ARRY-371797 (PF-07265803) in Patients With Symptomatic Dilated Cardiomyopathy Due to a Lamin A/C Gene Mutation
NCT05237323	PHASE3	COMPLETED	Micophenolate Mofetil Versus Azathioprine in Myocarditis
NCT05849766	PHASE3	COMPLETED	Effect of Dapagliflozin on Cardiac Structure, Function and Secondary Mitral Regurgitation in Patients with Left Ventricle Dysfunction
NCT06250257	PHASE3	RECRUITING	Bromocriptine in Dilated Cardiomyopathy Among Women of Reproductive Age
NCT00170183	PHASE3	COMPLETED	Brain Natriuretic Peptide (BNP) to Preserve Renal Function in Hospitalized Patients With Heart Failure
NCT00270387	PHASE3	COMPLETED	A Study of Short-Term Outcomes and Economic Impact For Patients With Worsening Congestive Heart Failure When Natrecor (Nesiritide) is Added to Standard-Care Therapy, Compared to Administration of Placebo With Standard-Care Therapy
NCT00321295	PHASE3	COMPLETED	Biventricular Pacing In Patients With Left Ventricular Dysfunction After Cardiovascular Surgery
NCT00483197	PHASE3	UNKNOWN	VentrAssistTM LVAD as a Bridge to Cardiac Transplantation - Pivotal Trial
NCT00490321	PHASE3	UNKNOWN	VentrAssistTM LVAD for the Treatment of Advanced Heart Failure - Destination Therapy