RRM2

Summary

RRM2 (ribonucleotide reductase regulatory subunit M2, HGNC:10452) is a protein-coding gene on chromosome 2p25.1, encoding Ribonucleoside-diphosphate reductase subunit M2 (P31350). Provides the precursors necessary for DNA synthesis. In precision oncology, RRM2 OVEREXPRESSION is associated with resistance to Gemcitabine in Pancreatic Cancer (CIViC Level D). It is a common-essential gene (DepMap: required in 99.8% of cancer cell lines).

This gene encodes one of two non-identical subunits for ribonucleotide reductase. This reductase catalyzes the formation of deoxyribonucleotides from ribonucleotides. Synthesis of the encoded protein (M2) is regulated in a cell-cycle dependent fashion. Transcription from this gene can initiate from alternative promoters, which results in two isoforms that differ in the lengths of their N-termini. Related pseudogenes have been identified on chromosomes 1 and X.

Source: NCBI Gene 6241 — RefSeq curated summary.

At a glance

• GWAS associations: 3
• Clinical variants (ClinVar): 38 total
• GTEx eGene: eQTL in 6 tissues, sQTL in 2 (q < 0.05)
• Drug target: yes — 7 via a complex or family; 1 molecules with ChEMBL bioactivity
• Approved drugs acting on a complex or family including it: 5 — Clofarabine, Fludarabine Phosphate, Gallium Nitrate, +2 more (Ribonucleoside-diphosphate reductase RR1)
• Precision-oncology evidence (CIViC): 1 curated variant–drug association
• Cancer dependency (DepMap): dependent in 99.8% of screened cell lines (common-essential)
• Constraint (gnomAD): pLI 1.00 (loss-of-function intolerant), LOEUF 0.29 (highly constrained)
• MANE Select transcript: NM_001034
• Interaction hub: 2,622 STRING partners (top 4% of genes corpus-wide)

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:10452
Approved symbol	RRM2
Name	ribonucleotide reductase regulatory subunit M2
Location	2p25.1
Locus type	gene with protein product
Status	Approved
Aliases	FLJ25102
Ensembl gene	ENSG00000171848
Ensembl biotype	protein_coding
OMIM	180390
Entrez	6241

Gene structure

Transcript identifiers

Ensembl transcripts: 29 — 11 protein_coding, 8 retained_intron, 7 nonsense_mediated_decay, 3 protein_coding_CDS_not_defined

MANE Select: ENST00000304567

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 4, TSL 2: 7

ENST00000304567, ENST00000360566, ENST00000381786, ENST00000459969, ENST00000461327, ENST00000462343, ENST00000485717, ENST00000487591, ENST00000491447, ENST00000498343, ENST00000607140, ENST00000615152, ENST00000641198, ENST00000641498, ENST00000642996, ENST00000646978, ENST00000652660, ENST00000869144, ENST00000931747, ENST00000931748, ENST00000931749, ENST00000931750, ENST00000931751, ENST00001021594, ENST00001072753, ENST00001072754, ENST00001072757, ENST00001072762, ENST00001072763

RefSeq mRNA: 2 — MANE Select: NM_001034 NM_001034, NM_001165931

CCDS: CCDS1669, CCDS54334

Canonical transcript exons

ENST00000304567 — 10 exons

Exon	Start	End
ENSE00001168551	10126875	10126969
ENSE00003086028	10124717	10124850
ENSE00003814275	10122739	10122897
ENSE00003841901	10123387	10123530
ENSE00003843841	10127087	10127220
ENSE00003844776	10128848	10128952
ENSE00003845664	10129041	10129154
ENSE00003846042	10122983	10123057
ENSE00003848919	10129234	10131414
ENSE00003850689	10123736	10123852

Expression profiles

Bgee: expression breadth ubiquitous, 233 present calls, max score 99.70.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 135.6397 / max 2017.8616, expressed in 1645 samples.

Highest expression (Bgee): secondary oocyte, oocyte, ventricular zone, ganglionic eminence, embryo.

Genetic regulation across tissues (GTEx eQTL / sQTL)

RRM2 is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 6 tissues and its splicing (sQTL) in 2 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

8 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Cells Cultured fibroblasts	eqtl	5.3e-12	+0.09	2:10123930:T:C
Colon Transverse	eqtl	3.4e-10	-0.13	2:10122793:T:G
Small Intestine Terminal Ileum	eqtl	1.4e-02	+0.12	2:10412801:T:C
Colon Transverse	sqtl	2.4e-02	-1.22	2:10523676:G:A
Stomach	eqtl	3.3e-02	-0.38	2:9951172:G:A
Adrenal Gland	eqtl	4.0e-02	+0.26	2:9521840:T:TCTTCCCTGCCTGCCTGCCTGCCTGCCTGCCTGC
Adrenal Gland	sqtl	4.1e-02	-1.61	2:10202598:G:A
Adipose Visceral Omentum	eqtl	4.4e-02	+0.73	2:10832500:A:T

FANTOM5 promoters

9 alternative TSS:

Promoter ID	TPM avg	Samples expressed
18812	131.9746	1636
18810	1.5474	729
18809	0.6118	356
18814	0.4031	176
18811	0.2969	169
18813	0.2859	151
18815	0.2587	136
18816	0.1417	61
18817	0.1195	38

Top tissues by expression

showing 100 of 283 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
secondary oocyte	CL:0000655	99.70	gold quality
oocyte	CL:0000023	99.20	gold quality
ventricular zone	UBERON:0003053	97.65	gold quality
ganglionic eminence	UBERON:0004023	97.32	gold quality
embryo	UBERON:0000922	97.29	gold quality
esophagus squamous epithelium	UBERON:0006920	97.07	gold quality
trabecular bone tissue	UBERON:0002483	96.59	gold quality
thymus	UBERON:0002370	96.21	gold quality
bone marrow	UBERON:0002371	96.14	gold quality
squamous epithelium	UBERON:0006914	95.83	gold quality
cervix squamous epithelium	UBERON:0006922	95.73	gold quality
bone marrow cell	CL:0002092	95.01	gold quality
epithelium of esophagus	UBERON:0001976	94.73	gold quality
tongue squamous epithelium	UBERON:0006919	93.87	gold quality
amniotic fluid	UBERON:0000173	93.57	gold quality
gingival epithelium	UBERON:0001949	93.38	gold quality
vermiform appendix	UBERON:0001154	93.34	gold quality
mucosa of transverse colon	UBERON:0004991	91.98	gold quality
rectum	UBERON:0001052	91.75	gold quality
stromal cell of endometrium	CL:0002255	91.31	gold quality
gingiva	UBERON:0001828	91.31	gold quality
tibia	UBERON:0000979	91.27	gold quality
ileal mucosa	UBERON:0000331	91.26	gold quality
oral cavity	UBERON:0000167	91.16	gold quality
caecum	UBERON:0001153	90.61	gold quality
epithelium of nasopharynx	UBERON:0001951	89.22	gold quality
mucosa of sigmoid colon	UBERON:0004993	88.83	gold quality
colonic mucosa	UBERON:0000317	88.64	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	88.56	gold quality
esophagus mucosa	UBERON:0002469	88.47	gold quality
pharyngeal mucosa	UBERON:0000355	87.43	gold quality
duodenum	UBERON:0002114	87.26	gold quality
lymph node	UBERON:0000029	86.08	gold quality
colonic epithelium	UBERON:0000397	85.17	gold quality
hair follicle	UBERON:0002073	84.89	gold quality
tonsil	UBERON:0002372	84.37	gold quality
jejunal mucosa	UBERON:0000399	84.22	gold quality
sperm	CL:0000019	84.10	gold quality
adrenal tissue	UBERON:0018303	83.61	gold quality
penis	UBERON:0000989	83.60	gold quality
cervix epithelium	UBERON:0004801	83.58	gold quality
lower esophagus mucosa	UBERON:0035834	83.49	gold quality
cartilage tissue	UBERON:0002418	83.02	gold quality
endometrium	UBERON:0001295	82.57	gold quality
male germ cell	CL:0000015	82.20	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	81.89	gold quality
smooth muscle tissue	UBERON:0001135	80.61	gold quality
spleen	UBERON:0002106	80.60	gold quality
visceral pleura	UBERON:0002401	80.04	gold quality
mammalian vulva	UBERON:0000997	79.65	gold quality
oviduct epithelium	UBERON:0004804	79.31	gold quality
placenta	UBERON:0001987	79.14	gold quality
upper leg skin	UBERON:0004262	78.98	gold quality
pleura	UBERON:0000977	78.19	gold quality
small intestine	UBERON:0002108	77.79	gold quality
pylorus	UBERON:0001166	77.61	gold quality
parietal pleura	UBERON:0002400	77.11	gold quality
small intestine Peyer’s patch	UBERON:0003454	76.89	gold quality
palpebral conjunctiva	UBERON:0001812	76.44	gold quality
germinal epithelium of ovary	UBERON:0001304	76.38	gold quality
transverse colon	UBERON:0001157	75.82	gold quality
skin of hip	UBERON:0001554	75.73	gold quality
right testis	UBERON:0004534	75.70	gold quality
epithelial cell of pancreas	CL:0000083	75.69	silver quality
testis	UBERON:0000473	75.47	gold quality
left testis	UBERON:0004533	74.44	gold quality
blood	UBERON:0000178	74.23	gold quality
eye	UBERON:0000970	74.22	gold quality
intestine	UBERON:0000160	74.18	gold quality
esophagus	UBERON:0001043	73.58	gold quality
leukocyte	CL:0000738	73.47	gold quality
mononuclear cell	CL:0000842	73.29	gold quality
vagina	UBERON:0000996	73.24	gold quality
monocyte	CL:0000576	73.21	gold quality
granulocyte	CL:0000094	73.02	gold quality
cortical plate	UBERON:0005343	72.90	gold quality
periodontal ligament	UBERON:0008266	72.63	gold quality
large intestine	UBERON:0000059	72.58	gold quality
islet of Langerhans	UBERON:0000006	72.44	gold quality
uterus	UBERON:0000995	72.16	gold quality
colon	UBERON:0001155	71.86	gold quality
pancreatic ductal cell	CL:0002079	71.80	gold quality
jejunum	UBERON:0002115	71.67	gold quality
superior surface of tongue	UBERON:0007371	71.25	gold quality
nasal cavity mucosa	UBERON:0001826	71.21	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	71.08	gold quality
tongue	UBERON:0001723	71.07	gold quality
gall bladder	UBERON:0002110	70.50	gold quality
body of tongue	UBERON:0011876	70.39	gold quality
stomach	UBERON:0000945	70.35	gold quality
zone of skin	UBERON:0000014	70.21	gold quality
female reproductive system	UBERON:0000474	70.18	gold quality
fallopian tube	UBERON:0003889	70.01	gold quality
skin of abdomen	UBERON:0001416	70.00	gold quality
upper lobe of lung	UBERON:0008948	69.96	gold quality
buccal mucosa cell	CL:0002336	69.95	silver quality
right lobe of liver	UBERON:0001114	69.51	gold quality
mouth mucosa	UBERON:0003729	69.50	gold quality
right adrenal gland	UBERON:0001233	69.44	gold quality
body of stomach	UBERON:0001161	69.23	gold quality

Single-cell (SCXA)

Detected in 30 experiment(s), a significant marker in 26.

Experiment	Marker?	Max mean expression
E-GEOD-81383	yes	1535.87
E-GEOD-99795	yes	1109.40
E-MTAB-7052	yes	691.69
E-CURD-120	yes	651.82
E-MTAB-8894	yes	585.64
E-HCAD-5	yes	582.81
E-MTAB-10042	yes	481.90
E-CURD-77	yes	467.73
E-MTAB-6678	yes	453.61
E-MTAB-9467	yes	429.10
E-HCAD-32	yes	405.72
E-MTAB-10485	yes	389.16
E-HCAD-1	yes	354.90
E-MTAB-10290	yes	320.68
E-MTAB-11121	yes	278.14

HPA expression

RNA tissue specificity: Tissue enhanced

showing 60 of 76 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Thymus	tissue	54.1
Bone marrow	tissue	41.5	not detected
Tonsil	tissue	35.3	low
Lymph node	tissue	33.1	low
Rectum	tissue	18.5	medium
Colon	tissue	13.3	medium
Appendix	tissue	11.7	medium
Esophagus	tissue	10.0	low
Duodenum	tissue	8.9	medium
Small intestine	tissue	6.1	medium
Caudate putamen	tissue	5.8
Smooth muscle	tissue	5.7	not detected
Stomach 1	tissue	5.6	not detected
Urinary bladder	tissue	5.6	low
Choroid plexus	tissue	4.8
Placenta	tissue	4.3	not detected
Spleen	tissue	4.1	not detected
Skin 1	tissue	3.4	not detected
Ovary	tissue	3.0	not detected
Liver	tissue	2.9	not detected
Vagina	tissue	2.8	low
Breast	tissue	2.7	not detected
Testis	tissue	2.7	low
Frontal cortex	tissue	2.7
Cervix	tissue	2.0	not detected
Endometrium 1	tissue	2.0	not detected
Lung	tissue	1.8	not detected
Spinal cord	tissue	1.6
Adipose tissue	tissue	1.4	not detected
Basal ganglia	tissue	1.3	not detected
Medulla oblongata	tissue	1.3
Substantia nigra	tissue	1.3
Pons	tissue	1.2
Nucleus accumbens	tissue	1.2
Postcentral gyrus	tissue	1.2
Midbrain	tissue	1.1
Thalamus	tissue	1.1
Superior colliculi	tissue	1.1
Corpus callosum	tissue	1.1
Pancreas	tissue	1.0	not detected
Amygdala	tissue	1.0
Hypothalamus	tissue	1.0
Gallbladder	tissue	1.0	not detected
Hippocampal formation	tissue	1.0
Salivary gland	tissue	0.9	not detected
Thyroid gland	tissue	0.9	not detected
Hippocampus	tissue	0.9	not detected
Prostate	tissue	0.9	not detected
Kidney	tissue	0.8	not detected
Locus coeruleus	tissue	0.8
Ventral forebrain	tissue	0.8
Periaqueductal gray	tissue	0.8
Septum	tissue	0.8
Cerebral cortex	tissue	0.7	not detected
Entorhinal cortex	tissue	0.7
Olfactory bulb	tissue	0.7
Fallopian tube	tissue	0.7	not detected
Temporal cortex	tissue	0.7
Insular cortex	tissue	0.7
Prefrontal cortex	tissue	0.6

Brain sub-regions (HPA Brain Atlas): detected in 189; highest nTPM — Anterior thalamic nucleus, ventral (2.7), Flocculonodular lobe (1.8), Frontal operculum (1.8), Vermis (1.8), Corpus callosum, splenium (white matter) (1.7).

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): CREB1, E2F1, E2F4, NFKB, POU2F1, SP1, SRSF1, SRSF2, TFAP2A

miRNA regulators (miRDB)

Targeting RRM2 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 118 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-3646	100.00	73.56	5283
HSA-LET-7A-3P	100.00	74.03	3932
HSA-LET-7B-3P	100.00	74.08	3913
HSA-LET-7F-1-3P	100.00	74.02	3928
HSA-MIR-98-3P	100.00	74.08	3907
HSA-MIR-150-5P	99.99	66.69	1976
HSA-MIR-371B-5P	99.99	75.34	4759
HSA-MIR-4500	99.99	72.72	2367
HSA-MIR-4789-3P	99.99	70.75	2484
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-373-5P	99.98	75.36	4753
HSA-MIR-616-5P	99.98	75.58	4775
HSA-LET-7A-5P	99.98	72.29	1790
HSA-LET-7B-5P	99.98	72.31	1790
HSA-LET-7C-5P	99.98	72.29	1790
HSA-LET-7E-5P	99.98	72.29	1790
HSA-LET-7F-5P	99.98	72.56	1784
HSA-LET-7G-5P	99.98	72.37	1784
HSA-LET-7I-5P	99.98	72.37	1788
HSA-MIR-98-5P	99.98	72.33	1787
HSA-MIR-3148	99.97	75.06	6478
HSA-MIR-3688-3P	99.97	72.02	2834
HSA-MIR-4666A-3P	99.96	71.71	3434
HSA-MIR-3658	99.96	73.87	4379
HSA-LET-7D-5P	99.96	71.76	1632
HSA-MIR-4458	99.96	71.64	1650
HSA-MIR-4760-3P	99.93	70.50	2385
HSA-MIR-539-5P	99.93	70.30	2855
HSA-MIR-381-3P	99.93	71.87	2854

Functional genomics

gnomAD constraint: pLI 1, LOEUF 0.292, missense Z 2.11 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD)

ENST00000304567 splits into 2 regions with different missense tolerance; 0 are missense-constrained. Missense variants in a constrained region (low observed/expected) are more likely to be pathogenic. gnomAD

Region (GRCh38)	Missense obs / exp	o/e	Constrained
2:10,122,799–10,123,482	131 / 121.4	1.08	no
2:10,123,483–10,129,383	212 / 368.1	0.58	no
DepMap (CRISPR cell-line fitness): dependent in 99.8% of screened cell lines, common-essential.

Most-dependent cell lines (DepMap gene-effect, lower = stronger; ≤ −0.5 shown): EFO-21 (-3.805), TF-1 (-3.795), THP-1 (-3.693), JH-EsoAd1 (-3.646), SCC-25 (-3.622), LOU-NH91 (-3.593), KLE (-3.549), NCI-H226 (-3.544), SK-N-DZ (-3.5), KELLY (-3.498), CAL-29 (-3.472), AsPC-1 (-3.457), RPMI-7951 (-3.437), BICR 31 (-3.411), NCI-H520 (-3.394).

Literature-anchored findings (GeneRIF, showing 40)

• Human ribonucleotide reductase M2 subunit gene amplification and transcriptional regulation in a homogeneous staining chromosome region responsible for the mechanism of drug resistance (PMID:11978967)
• Characterization of the human ribonucleotide reductase M2 subunit gene; genomic structure and promoter analyses (PMID:11978970)
• Wild-type p53 regulates human ribonucleotide reductase by protein-protein interaction with p53R2 as well as hRRM2 subunits. (PMID:12615712)
• Sequences downstream of the transcription initiation site are important for proper initiation and regulation of this gene’s transcription. (PMID:12694192)
• Expression of antisense hRRM2 in PC3 cells led to decreased hRRM2 expression and resulted in greater sensitivity to UV than observed in wild-type PC3 cells. (PMID:14583450)
• Susceptibility differences to RR inhibitors between hRRM1 and hRRM2 may lead to a new direction in drug design for human cancer treatment. (PMID:14729598)
• R2 subunitof RNR can substuitute for the function of p53R2 in providing dNTPs for DNA repair in cells lacking functional p53R2. (PMID:15096505)
• RRM2 and p53R2 subunits share the same binding site on RRM1 (PMID:16376858)
• NF-kappaB is a key mediator of the invasive phenotypic changes induced by RRM2 overexpression. (PMID:17222798)
• RR M2 protein may not have a critical role in the malignant potential of pancreatic cancer (PMID:18278438)
• Ribonucleotide reductase subunit RRM2 mRNA expression in lung adenocarcinoma is associated with clinical outcome of docetaxel/gemcitabine therapy. (PMID:18414411)
• Esophageal and gastric cancers overexpressed RRM2 protein when compared to prostate cancer. Esophageal and gastric cancers also overexpressed RRM2 mRNA when compared to prostate cancer (PMID:18941749)
• RRM2 mRNA levels were assessed by quantitative PCR and correlated with response, time to progression and survival (PMID:19002265)
• The redox property, structure, and function of hRRM2 and p53R2, are studied. (PMID:19082948)
• These findings suggest a positive role of RRM2 in tumor angiogenesis and growth through regulation of the expression of TSP-1 and VEGF. (PMID:19250552)
• Up-regulation in RRM2 expression levels coupled with its nuclear recruitment suggests an active role for ribonucleotide reductase in the cellular response to camptothecin-mediated DNA damage (PMID:19416980)
• thymidylate synthase/ribonucleotide reductase gene silencing and deoxycytidine kinase::uridine monophosphate kinase fusion gene gene overexpression markedly improved gemcitabine’s therapeutic activity (PMID:19568409)
• Data show that cases with high RRM2 expression had a shorter OS than cases with low RRM2 levels. (PMID:19639316)
• we provide molecular evidence for a new mechanism of HBV-host cell interaction where RNR-R2, a critical cell-cycle gene, is selectively activated in nonproliferating cells. (PMID:20155784)
• This study correlates the distinct catalytic mechanisms of the small subunits hp53R2 and hRRM2 with a hydrogen-bonding network. (PMID:20484015)
• Ribonucleotide reductase M2 subunit overexpression could be associated with the gastric cancer progression. (PMID:20825972)
• High RRM2 is associated with gemcitabine resistance in pancreatic cancer. (PMID:20927319)
• We have shown frequent overexpression of RRM2 protein and its possible role in bladder cancer. (PMID:21166702)
• Data suggest ribonucleotide reductase A site binding with inhibitor. (PMID:21628579)
• HDM-2 inhibition suppresses expression of ribonucleotide reductase subunit M2, and synergistically enhances gemcitabine-induced cytotoxicity in mantle cell lymphoma. (PMID:21844567)
• Under serum-starved conditions, the expression level of RRM2 protein increased in HCT116 cells compared to HKe3 cells (HCT116 cells with a disruption in oncogenic KRAS), and the re-expression of KRAS in HKe3 cells induced the expression of RRM2. (PMID:21873171)
• Knockdown of the ribonucleotide RR2 subunit leads to decreased cisplatin-induced gap-filling synthesis in nucleotide excision repair and a reduced 2’-deoxyadenosine triphosphate (dATP) level in the G2/M phase of the cell cycle. (PMID:21875941)
• p53R2 expression seems more important than that of hRRM2 in prognosis of early-stage lung cancer. (PMID:21965764)
• Recombinant RRM2 translocates from the cytoplasm to the nucleus in a time-dependent manner, leading to stabilization of urokinase mRNA. Overexpression of RRM2 inhibits urokinase protein and mRNA expression through destabilization of uPA mRNA. (PMID:22166006)
• High tumor expression of RRM2 and ERCC1 are associated with reduced recurrence free survival and overall survival after resection of pancreas cancer. (PMID:22569992)
• After DNA damage, cyclin F is downregulated in an ATR-dependent manner to allow accumulation of RRM2. Defective elimination of cyclin F delays DNA repair and sensitizes cells to DNA damage, a phenotype that is reverted by expressing a nondegradable RRM2 mutant. (PMID:22632967)
• RRM2 protein expression in pancreatic adenocarcinoma is neither prognostic nor predictive of adjuvant gemcitabine benefit in patients with resectable pancreatic adenocarcinoma. (PMID:22670179)
• RRM2 expression closely correlates with the development of ovarian tumor and may serve as a novel predictive marker for diagnosis and prognosis of the disease. (PMID:22884145)
• RRM2 may be a facilitating factor in colorectal tumorigenesis and UV-induced DNA damage repair. (PMID:23002339)
• Report essential roles for ribonucleotide reductase and thymidylate synthase in C-MYC-dependent suppression of senescence in melanoma cells. (PMID:23249808)
• RRM2 was found to be a key determinant of both inherent and acquired gemcitabine with reduced let-7 expression likely to contribute to RRM2-mediated inherent chemoresistance in poorly differentiated pancreatic cancer cells. (PMID:23335963)
• RRM2 small interfering RNA-mediated treatment is an effective strategy to inverse chemosensitivity of tumor cells to cisplatin, enhance the efficacy of Gem-induced cytotoxicity and promote apoptosis of cisplatin-resistant ovarian cancer cells in vitro. (PMID:23466567)
• The crystal structure of RRM1/2 complexed with target mRNA has been solved; comparison of the two structures show that RNA-binding protein RRM1/2 undergoes conformational changes upon RNA binding. (PMID:23519412)
• Our novel findings add to the knowledge of RRM2 in regulating expression of the antiapoptotic protein Bcl-2 and reveal a critical link between RRM2 and Bcl-2 in apoptosis signaling. (PMID:23719266)
• These results suggest that SNPs within ribonucleotide reductase (RRM1 and RRM2) might be helpful predictive markers of response to nucleoside analogs and should be further validated in larger cohorts. (PMID:24024897)

Cross-species orthologs

7 orthologs

Organism	Symbol	Gene ID
danio_rerio	rrm2	ENSDARG00000020711
danio_rerio	rrm2l	ENSDARG00000078069
mus_musculus	Rrm2	ENSMUSG00000020649
rattus_norvegicus	Rrm2	ENSRNOG00000054286
rattus_norvegicus	Rrm2l1	ENSRNOG00000088764
drosophila_melanogaster	RnrS	FBGN0011704
caenorhabditis_elegans		WBGENE00004392

Paralogs (1): RRM2B (ENSG00000048392)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:98181) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 3 distinct phenotype terms.

Mouse phenotype (MP)	Records
increased circulating phosphate level	1
preweaning lethality, complete penetrance	1
embryonic lethality prior to organogenesis	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Arabidopsis thaliana	P0DKH2	100.0%	Diamond
Pongo abelii	Q5R9G0	99.7%	Diamond
Macaca fascicularis	Q4R741	98.6%	Diamond
Plasmodium falciparum FCR-3/Gambia	P50649	95.9%	Diamond
Plasmodium falciparum Dd2	P50650	95.9%	Diamond
Mesocricetus auratus	Q60561	93.8%	Diamond
Nicotiana tabacum	P49730	83.1%	Diamond
Spisula solidissima	P07201	83.0%	Diamond
Trypanosoma brucei brucei	O15910	78.9%	Diamond
Leishmania amazonensis	O46310	78.9%	Diamond
Neurospora crassa OR74A	Q9C167	76.8%	Diamond
Schizosaccharomyces pombe 972h-	P36603	73.2%	Diamond
Dictyostelium discoideum	P42521	73.0%	Diamond
Saccharomyces cerevisiae S288C	P09938	72.3%	Diamond
Encephalitozoon cuniculi GB-M1	Q8SRR2	67.4%	Diamond
Vaccinia virus Ankara	O57175	99.7%	Diamond
Vaccinia virus WR	P11158	99.7%	Diamond
Vaccinia virus Copenhagen	P20493	99.7%	Diamond
Monkeypox virus	A0A7H0DN21	99.1%	Diamond
Vaccinia virus L-IPV	P29883	99.1%	Diamond
African swine fever virus tick/South Africa/Pretoriuskop Pr4/1996	P0C8I1	98.8%	Diamond
African swine fever virus warthog/Namibia/Wart80/1980	P0C8I2	98.8%	Diamond
African swine fever virus BA71V	P42492	98.8%	Diamond
Variola virus human/India/Ind3/1967	P0DSS7	98.4%	Diamond
Variola virus	P0DSS8	98.4%	Diamond
African swine fever virus Malawi LIL 20/1	P26713	98.2%	Diamond
African swine fever virus pig/Kenya/KEN-50/1950	P0C8I0	96.9%	Diamond
Swinepox virus (STRAIN KASZA)	P32209	79.1%	Diamond
Yaba-like disease virus	Q9DHU2	79.1%	Diamond
Suid herpesvirus 1 strain Kaplan	P50645	75.1%	Diamond
Marek’s disease herpesvirus type 1 strain MD5	Q77MS0	65.1%	Diamond
Red seabream iridovirus	Q9QTF2	59.6%	Diamond
Acanthamoeba polyphaga mimivirus	Q7T6Y9	52.1%	Diamond
Ostreid herpesvirus 1 (isolate France)	Q6R7K3	40.3%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
MIR4261	ncRNA	100422929
HPCAL1	protein-coding	3241
CYS1	protein-coding	192668
KLF11	protein-coding	8462
KLF11-DT	ncRNA	101929882

Protein

Protein identifiers

Ribonucleoside-diphosphate reductase subunit M2 — P31350 (reviewed: P31350)

Alternative names: Ribonucleotide reductase small chain, Ribonucleotide reductase small subunit

All UniProt accessions (4): P31350, A0A286YFD6, A0A2R8Y837, A0A7P0SBL1

UniProt curated annotations — full annotation on UniProt →

Function. Provides the precursors necessary for DNA synthesis. Catalyzes the biosynthesis of deoxyribonucleotides from the corresponding ribonucleotides. Inhibits Wnt signaling.

Subunit / interactions. Heterodimer of a large and a small subunit. Interacts (via Cy motif and when phosphorylated at Thr-33) with CCNF; the interaction occurs exclusively in G2 and early M.

Subcellular location. Cytoplasm. Nucleus.

Post-translational modifications. Phosphorylation on Ser-20 relieves the inhibitory effect on Wnt signaling. Phosphorylated on Thr-33 by CDK1 and CDK2; predominantly in G2 and M phase. Ubiquitinated by the SCF(CCNF) E3 ubiquitin-protein ligase complex; leading to its degradation by the proteasome.

Cofactor. Binds 2 iron ions per subunit.

Induction. Up-regulated in response to DNA damage induced by doxorubicin, camptothecin, UV-C, methyl methanesulfonate, nocodazole, or gamma-irradiation.

Miscellaneous. Two distinct regulatory sites have been defined: the specificity site, which controls substrate specificity, and the activity site which regulates overall catalytic activity. A substrate-binding catalytic site, located on M1, is formed only in the presence of the second subunit M2.

Similarity. Belongs to the ribonucleoside diphosphate reductase small chain family.

Isoforms (2)

UniProt ID	Names	Canonical?
P31350-1	1	yes
P31350-2	2

RefSeq proteins (2): NP_001025, NP_001159403 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000358	RNR_small_fam	Family
IPR009078	Ferritin-like_SF	Homologous_superfamily
IPR012348	RNR-like	Homologous_superfamily
IPR030475	RNR_small_AS	Active_site
IPR033909	RNR_small	Family

Pfam: PF00268

Enzyme classification (BRENDA)

• EC 1.17.4.1 — ribonucleoside-diphosphate reductase (BRENDA: 56 organisms, 130 substrates, 474 inhibitors, 39 Km, 9 kcat entries)

Substrate kinetics (BRENDA)

10 substrates with measured Km, best-characterized 10. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
CDP	0.0005–0.31	14
ADP	0.0078–0.3	6
GDP	0.0012–0.37	4
UDP	0.08–1.2	4
ATP	0.07	1
DATP	0.003	1
DTTP	0.0015	1
GLUTAREDOXIN	0.0001	1
GLUTAREDOXIN 1	0.006	1
THIOREDOXIN	0.003	1

Catalyzed reactions (Rhea)

• a 2’-deoxyribonucleoside 5’-diphosphate + [thioredoxin]-disulfide + H2O = a ribonucleoside 5’-diphosphate + [thioredoxin]-dithiol (RHEA:23252)

UniProt features (43 total): helix 21, binding site 7, mutagenesis site 4, modified residue 2, turn 2, sequence conflict 2, chain 1, short sequence motif 1, splice variant 1, active site 1, strand 1

Structure

Experimental structures (PDB)

5 structures by resolution:

PDB	Title	Method	Resolution (Å)
3OLJ	Crystal structure of human ribonucleotide reductase subunit M2 (hRRM2)	X-RAY DIFFRACTION	2.1
3VPN	Crystal structure of human ribonucleotide reductase subunit M2 (hRRM2) mutant	X-RAY DIFFRACTION	2.25
3VPO	Crystal structure of human ribonucleotide reductase subunit M2 (hRRM2) mutant	X-RAY DIFFRACTION	2.3
3VPM	Crystal structure of human ribonucleotide reductase subunit M2 (hRRM2) mutant	X-RAY DIFFRACTION	2.7
2UW2	Crystal structure of human ribonucleotide reductase subunit R2	X-RAY DIFFRACTION	2.8

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P31350-F1	80.54	0.64

Human Protein Atlas

Protein class: Enzymes, ENZYME proteins, Oxidoreductases, Metabolic proteins, Predicted membrane proteins, Plasma proteins, FDA approved drug targets, Small molecule drugs, Essential proteins

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): cytosol; nucleoplasm

Antibody reliability (HPA): IH enhanced · IF supported

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1)

Position	Role
176

Ligand- & substrate-binding residues (7)

Position	Role
138	Fe cation
169	Fe cation
172	Fe cation
232	Fe cation
266	Fe cation
269	Fe cation

Post-translational modifications (2)

Type	Positions
Phosphoserine	20
Phosphothreonine	33

Mutagenesis-validated functional residues (4)

Position	Phenotype
20	enhances inhibitory effect on wnt signaling.
20	prevents inhibitory effect on wnt signaling.
33	strongly reduces the interaction with ccnf. lack of proteasomal degradation. increase in the cellular concentration of datp and dgtp, but …
49–51	abolishes the interaction with ccnf. lack of proteasomal degradation. increase in the cellular concentration of datp and dgtp, but not dctp …

Function

Pathways and Gene Ontology

Reactome pathways

3 curated (TAS) of 12; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

12 pathways:

ID	Pathway	Evidence
R-HSA-69205	G1/S-Specific Transcription	curated
R-HSA-499943	Interconversion of nucleotide di- and triphosphates	curated
R-HSA-8953750	Transcriptional Regulation by E2F6	curated
R-HSA-1640170	Cell Cycle	—
R-HSA-69278	Cell Cycle, Mitotic	—
R-HSA-69206	G1/S Transition	—
R-HSA-74160	Gene expression (Transcription)	—
R-HSA-212436	Generic Transcription Pathway	—
R-HSA-1430728	Metabolism	—
R-HSA-15869	Metabolism of nucleotides	—
R-HSA-453279	Mitotic G1 phase and G1/S transition	—
R-HSA-73857	RNA Polymerase II Transcription	—

MSigDB gene sets: 0 (showing top):

GO Biological Process (8): DNA repair (GO:0006281), ribonucleoside diphosphate metabolic process (GO:0009185), deoxyribonucleotide biosynthetic process (GO:0009263), 2’-deoxyribonucleotide biosynthetic process (GO:0009265), protein heterotetramerization (GO:0051290), positive regulation of G1/S transition of mitotic cell cycle (GO:1900087), dTMP biosynthetic process (GO:0006231), positive regulation of mitotic cell cycle phase transition (GO:1901992)

GO Molecular Function (8): ribonucleoside-diphosphate reductase activity, thioredoxin disulfide as acceptor (GO:0004748), ferric iron binding (GO:0008199), ribonucleoside-diphosphate reductase activity, glutaredoxin disulfide as acceptor (GO:0036175), protein homodimerization activity (GO:0042803), protein binding (GO:0005515), oxidoreductase activity (GO:0016491), identical protein binding (GO:0042802), metal ion binding (GO:0046872)

GO Cellular Component (5): nucleus (GO:0005634), nucleoplasm (GO:0005654), cytosol (GO:0005829), ribonucleoside-diphosphate reductase complex (GO:0005971), cytoplasm (GO:0005737)

Reactome top-level categories

9 top-level categories:

Category	Pathways
Metabolism of nucleotides	1
G1/S Transition	1
Generic Transcription Pathway	1
Metabolism	1
RNA Polymerase II Transcription	1
Cell Cycle, Mitotic	1
Mitotic G1 phase and G1/S transition	1
Cell Cycle	1
Gene expression (Transcription)	1

GO top-level categories

36 GO namespaces:

Category	Terms
cellular anatomical structure	3
ribonucleoside-diphosphate reductase activity	2
DNA metabolic process	1
DNA damage response	1
nucleoside diphosphate metabolic process	1
biosynthetic process	1
deoxyribonucleotide metabolic process	1
nucleotide biosynthetic process	1
2’-deoxyribonucleotide metabolic process	1
deoxyribose phosphate biosynthetic process	1
protein tetramerization	1
protein heterooligomerization	1
G1/S transition of mitotic cell cycle	1
positive regulation of mitotic cell cycle phase transition	1
positive regulation of cell cycle G1/S phase transition	1
regulation of G1/S transition of mitotic cell cycle	1
pyrimidine deoxyribonucleoside monophosphate biosynthetic process	1
pyrimidine deoxyribonucleotide biosynthetic process	1
dTMP metabolic process	1
mitotic cell cycle phase transition	1
positive regulation of mitotic cell cycle	1
positive regulation of cell cycle phase transition	1
regulation of mitotic cell cycle phase transition	1
iron ion binding	1
identical protein binding	1
protein dimerization activity	1
binding	1
catalytic activity	1
protein binding	1
cation binding	1
intracellular membrane-bounded organelle	1
nuclear lumen	1
cytoplasm	1
cytosol	1
oxidoreductase complex	1
intracellular anatomical structure	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 7 of 21 annotations. The rest are phylogenetic / computational / electronic (IEA).

7 experimentally-supported GO terms:

GO term	NS	Evidence
2’-deoxyribonucleotide biosynthetic process	BP	direct assay
DNA repair	BP	direct assay
positive regulation of G1/S transition of mitotic cell cycle	BP	direct assay
ribonucleoside diphosphate metabolic process	BP	direct assay
cytosol	CC	direct assay
nucleoplasm	CC	direct assay
nucleus	CC	direct assay

Protein interactions and networks

STRING

showing 15 of 2,622 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
RRM2	RRM1	P23921	988
RRM2	CELF3	Q5SZQ8	815
RRM2	CELF6	Q96J87	789
RRM2	ODC1	P11926	743
RRM2	PDIA6	Q15084	724
RRM2	CS	O75390	663
RRM2	TOP2A	P11388	659
RRM2	CEBPD	P49716	640
RRM2	DCK	P27707	638
RRM2	TYMS	P04818	629
RRM2	TK1	P04183	623
RRM2	CCNB1	P14635	620
RRM2	UBE2C	O00762	609
RRM2	CDK1	P06493	607
RRM2	TARDBP	Q13148	606

IntAct

Human interaction partners of RRM2 in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

12 partners by confidence:

Partner	Interaction type	MIscore	Records
RRM1	direct interaction	0.850	5
CCNF	association	0.710	10
FZR1	physical association	0.710	1
HSPA8	association	0.640	1
SDCBP	physical association	0.560	3
INPPL1	association	0.530	2
CDC27	association	0.530	1
RRM2B	association	0.530	1
CDK1	phosphorylation reaction	0.440	1
DNM1L	physical association	0.370	1
TSG101	physical association	0.370	1
CREB1	association	0.350	1

BioGRID (164 interactions; top human partners by supporting records): RRM1 (Co-fractionation; 8 records), CCNF (Affinity Capture-Western; 5 records), FZR1 (Affinity Capture-MS; 5 records), FAF2 (Affinity Capture-MS; 4 records), RRM2B (Affinity Capture-MS; 4 records), ANAPC4 (Affinity Capture-MS; 3 records), CDC27 (Affinity Capture-MS; 3 records), INPPL1 (Affinity Capture-MS; 3 records), SKP2 (Two-hybrid; 3 records), USP12 (Affinity Capture-Western; 3 records), HSPA8 (Affinity Capture-MS; 2 records), PLK1 (Co-fractionation; 2 records), ANAPC15 (Affinity Capture-MS), AR (Affinity Capture-MS), ARID2 (Negative Genetic)

SIGNOR signaling

9 signaling interactions:

A	Effect	B	Mechanism
CDK1	down-regulates	RRM2	phosphorylation
clofarabine	“down-regulates activity”	RRM2	“chemical inhibition”
hydroxyurea	“down-regulates activity”	RRM2	“chemical inhibition”
RRM2	“form complex”	“Ribonucleotide reductase”	binding
CDK1	unknown	RRM2	phosphorylation
gemcitabine	“down-regulates activity”	RRM2	“chemical inhibition”
(2R,3S,4S,5R)-2-(6-amino-2-fluoro-9-purinyl)-5-(hydroxymethyl)oxolane-3,4-diol	“down-regulates activity”	RRM2	“chemical inhibition”
YAP1	“up-regulates quantity by expression”	RRM2	“transcriptional regulation”
YAP/TAZ	“up-regulates quantity by expression”	RRM2	“transcriptional regulation”

Protein complexes (CORUM) (1)

Experimentally-characterized complexes this protein is a subunit of (★ = the complex contains a known drug target).

1 complexes by size:

Complex	Subunits	Members
★ RRM1-RRM2 complex	2	RRM1, RRM2

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 12 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

GO biological processes:

GO term	Partners	Fold	FDR
cell division	5	19.2×	2e-04

Disease & clinical

Genetic variants

Variant evidence for RRM2: 38 ClinVar records (0 pathogenic / likely pathogenic); 1 CIViC cancer variant; 2 PharmGKB clinical annotations; 3 GWAS associations.

ClinVar

38 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	23
Likely benign	1
Benign	1

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 37 predictions of 458):

Position(s)	Effect	Δscore	Sites
2:10122898–10122899	donor_loss	1.0000	5
2:10123385–10123386	acceptor_loss	1.0000	5
2:10123531–10123532	donor_loss	1.0000	5
2:10124708	acceptor_gain	1.0000
2:10124713	acceptor_gain	1.0000
2:10124715–10124716	acceptor_loss	1.0000	6
2:10124851	donor_loss	1.0000	2
2:10126853	acceptor_gain	1.0000
2:10126873–10126874	acceptor_loss	1.0000	6
2:10126970–10126971	donor_loss	1.0000	5

AlphaMissense

1,618 missense substitutions predicted likely pathogenic (of 2,602 scored), across 297 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
M350	9	0.981	0.999
M320	9	0.974	0.998
M175	9	0.929	0.999
M315	9	0.878	0.998
M93	9	0.866	0.989
D138	8	1.000	1.000
D265	8	1.000	1.000
D112	8	0.999	1.000
H172	8	0.999	1.000
F240	8	0.998	1.000
H269	8	0.998	1.000
F134	8	0.997	1.000
N144	8	0.997	1.000
F236	8	0.997	1.000
F362	8	0.997	1.000
F361	8	0.993	1.000
F149	8	0.992	0.999
F228	8	0.990	1.000
N170	8	0.989	1.000
F272	8	0.989	1.000

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

8 prognostic cancer types:

Cancer	Prognostic	p-value
Kidney Renal Papillary Cell Carcinoma (TCGA)	unfavorable	1.54e-11
Liver Hepatocellular Carcinoma (validation)	unfavorable	1.47e-08
Lung Adenocarcinoma (TCGA)	unfavorable	8.75e-08
Kidney Renal Clear Cell Carcinoma (validation)	unfavorable	1.59e-07
Kidney Renal Clear Cell Carcinoma (TCGA)	unfavorable	2.93e-07
Liver Hepatocellular Carcinoma (TCGA)	unfavorable	4.94e-07
Pancreatic Adenocarcinoma (TCGA)	unfavorable	3.66e-05
Kidney Chromophobe (TCGA)	unfavorable	0.000193

Disease associations

OMIM: gene MIM:180390 | disease phenotypes:

GWAS associations

3 associations:

Study	Trait	p-value
GCST006482_8	Lung function (FEV1/FVC)	9e-11
GCST001942_5	Prostate cancer	3e-8
GCST002720_5	Kidney function decline traits	3e-6

EFO canonical traits (from GWAS)

1 canonical traits:

EFO ID	Trait name
EFO:0004713	FEV/FVC ratio

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (2): CHEMBL1954 (SINGLE PROTEIN), CHEMBL2095215 (PROTEIN COMPLEX GROUP)

Drugs acting on a complex or family that includes this protein

Curated ChEMBL mechanism-of-action drugs whose target is a protein complex or family of ≤10 members that includes RRM2 — the drug acts on the assembly or class, not necessarily on this subunit alone.

7 drugs via a complex or family:

Drug	Target (ChEMBL)	Members	Max phase
CLOFARABINE	Ribonucleoside-diphosphate reductase RR1	3	4
FLUDARABINE PHOSPHATE	Ribonucleoside-diphosphate reductase RR1	3	4
GALLIUM NITRATE	Ribonucleoside-diphosphate reductase RR1	3	4
GEMCITABINE HYDROCHLORIDE	Ribonucleoside-diphosphate reductase RR1	3	4
HYDROXYUREA	Ribonucleoside-diphosphate reductase RR1	3	4
MOTEXAFIN GADOLINIUM	Ribonucleoside-diphosphate reductase RR1	3	3
TEZACITABINE	Ribonucleoside-diphosphate reductase RR1	3	2

Molecules with ChEMBL bioactivity

Phase ≥1, by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 4,615 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

1 molecules by phase:

Molecule	Name	Phase	Patents
CHEMBL231616	TRIAPINE	3	4,615

Clinical evidence (CIViC)

Drug × variant × indication, from 1 curated evidence items. CIViC evidence level: A (validated) → B (clinical) → C (case study) → D (preclinical) → E (inferential).

1 predictive associations by evidence level:

Variant	Therapy	Indication	Effect	Level	CIViC
RRM2 OVEREXPRESSION	Gemcitabine	Pancreatic Cancer	Resistance	CIViC D	EID1860

CIViC curated variants (1)

Named clinical variants curated in CIViC for this gene (the catalogue beneath the predictive evidence above):

OVEREXPRESSION.

PharmGKB: 1 entry (CPIC guideline: no)

PharmGKB clinical annotations

2 annotations by evidence level (1 strongest → 4):

Variant	Association	Level	Drugs	Phenotypes
rs1130609	Efficacy	3	cladribine;cytarabine	Leukemia;Myeloid;Acute
rs5030743	Efficacy	3	cladribine;cytarabine	Leukemia;Myeloid;Acute

PharmGKB variants

2 variants:

Variant	Genes	Level	Score	#Clin annots	Drugs
rs1130609	RRM2	3	1.50	1	cladribine;cytarabine
rs5030743	RRM2	3	1.75	1	cladribine;cytarabine

PharmGKB variant annotations

Per-publication pharmacogenomic findings for this gene (significant associations).

2 published findings:

Variant	Drug(s)	Category	Finding	PMID
rs1130609	cladribine, cytarabine	Efficacy	Genotypes GT + TT is associated with decreased response to cladribine and cytarabine in children with Leukemia, Myeloid, Acute as compared to genotype GG.	PMID:24024897
rs5030743	cladribine, cytarabine	Efficacy	Genotypes CG + GG is associated with decreased response to cladribine and cytarabine in children with Leukemia, Myeloid, Acute as compared to genotype CC.	PMID:24024897

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: enzyme — Nucleoside synthesis and metabolism

Most potent curated ligand interactions (3 total), top 3:

Ligand	Action	Affinity	Parameter
clofarabine	Inhibition	8.3	pIC50
fludarabine	Inhibition	6.0	pIC50
hydroxyurea	Inhibition	3.83	pIC50

Binding affinities (BindingDB)

392 measured of 414 human assays (424 total across all organisms); most potent 50 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value	Patent
(S)-2-[(S)-3-Carboxy-2-((S)-2-{(S)-2-[3-(1-ethyl-propyl)-ureido]-3,3-dimethyl-butyrylamino}-4-oxo-4-pyrrolidin-1-yl-butyrylamino)-propionylamino]-4,4-dimethyl-pentanoic acid	IC50	0.6 nM
(S)-2-[(S)-2-((S)-2-{(S)-2-[(S)-2-(2-Benzyl-3-phenyl-propionylamino)-3-methyl-butyrylamino]-3-methyl-butyrylamino}-4-oxo-4-pyrrolidin-1-yl-butyrylamino)-3-carboxy-propionylamino]-4-methyl-pentanoic acid	IC50	0.7 nM
1-[(S)-((S)-1-Carboxy-3-methyl-butylcarbamoyl)-((S)-2-{(S)-3-methyl-2-[(S)-3-methyl-2-(3-phenyl-propionylamino)-butyrylamino]-butyrylamino}-4-oxo-4-pyrrolidin-1-yl-butyrylamino)-methyl]-cyclopentanecarboxylic acid	IC50	1 nM
CHEMBL1169533	IC50	2 nM
(S)-2-[(S)-3-Carboxy-2-((S)-2-{(S)-2-[3-(1-ethyl-propyl)-ureido]-3,3-dimethyl-butyrylamino}-5,5-dimethyl-4-oxo-hexanoylamino)-propionylamino]-4-methyl-pentanoic acid	IC50	3 nM
(S)-2-[(S)-3-Carboxy-2-((S)-2-{(S)-3,3-dimethyl-2-[(S)-3-methyl-2-(3-phenyl-propionylamino)-butyrylamino]-butyrylamino}-4-oxo-4-pyrrolidin-1-yl-butyrylamino)-propionylamino]-4-methyl-pentanoic acid	IC50	4 nM
(S)-2-[(S)-3-Carboxy-2-((S)-2-{(S)-3-methyl-2-[(S)-3-methyl-2-(3-phenyl-propionylamino)-butyrylamino]-butyrylamino}-4-oxo-4-pyrrolidin-1-yl-butyrylamino)-propionylamino]-4,4-dimethyl-pentanoic acid	IC50	5 nM
(S)-2-((S)-3-Carboxy-2-{(2R,5S)-2-(3,3-dimethyl-2-oxo-butyl)-5-[3-(1-ethyl-propyl)-ureido]-6,6-dimethyl-4-oxo-heptanoylamino}-propionylamino)-4-methyl-pentanoic acid	IC50	5 nM
(S)-3-((S)-2-{(S)-2-[3-(1-Ethyl-propyl)-ureido]-3,3-dimethyl-butyrylamino}-4-oxo-4-pyrrolidin-1-yl-butyrylamino)-N-((S)-1-hydroxymethyl-3,3-dimethyl-butyl)-succinamic acid	IC50	6 nM
1-((S)-((S)-1-Carboxy-3-methyl-butylcarbamoyl)-{(S)-2-[(S)-2-(2-ethyl-butyrylamino)-3,3-dimethyl-butyrylamino]-4-oxo-4-pyrrolidin-1-yl-butyrylamino}-methyl)-cyclopent-3-enecarboxylic acid	IC50	6.4 nM
(S)-2-{(S)-3-Carboxy-2-[(2S,5S)-5-[3-(1-ethyl-propyl)-ureido]-6,6-dimethyl-4-oxo-2-(2-oxo-2-pyrrolidin-1-yl-ethyl)-heptanoylamino]-propionylamino}-4-methyl-pentanoic acid	IC50	7 nM
(S)-2-{(S)-3-Carboxy-2-[(S)-2-((S)-3-methyl-2-{(S)-3-methyl-2-[methyl-(3-phenyl-propionyl)-amino]-butyrylamino}-butyrylamino)-4-oxo-4-pyrrolidin-1-yl-butyrylamino]-propionylamino}-4-methyl-pentanoic acid	IC50	7.5 nM
(S)-N-((R)-1-Ethyl-2,2-dimethyl-propyl)-3-((S)-2-{(S)-2-[3-(1-ethyl-propyl)-ureido]-3,3-dimethyl-butyrylamino}-4-oxo-4-pyrrolidin-1-yl-butyrylamino)-succinamic acid	IC50	18 nM
5-bromo-2-[[(1S,2R)-2-(6-fluoro-2,3-dimethylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]sulfamoyl]pyridine-3-carboxamide	IC50	20 nM	US-10889555: Sulfonamide compound or salt thereof
CHEMBL1169532	IC50	20 nM
(S)-2-[(S)-3-Carboxy-2-((S)-2-{(S)-2-[(S)-2-cyclohexyl-2-(3-phenyl-propionylamino)-acetylamino]-3-methyl-butyrylamino}-4-oxo-4-pyrrolidin-1-yl-butyrylamino)-propionylamino]-4-methyl-pentanoic acid	IC50	22 nM
(S)-2-{(S)-2-[(S)-2-((S)-2-{(S)-2-[(2-Benzyl-3-phenyl-propionyl)-methyl-amino]-3-methyl-butyrylamino}-3-methyl-butyrylamino)-3-carbamoyl-propionylamino]-3-carboxy-propionylamino}-4-methyl-pentanoic acid	IC50	22 nM
(S)-3-((S)-2-{(S)-2-[3-(1-Ethyl-propyl)-ureido]-3,3-dimethyl-butyrylamino}-4-oxo-4-pyrrolidin-1-yl-butyrylamino)-N-((R)-1,2,2-trimethyl-propyl)-succinamic acid	IC50	27 nM
5-chloro-N-[(1S,2R)-2-(6-fluoro-2,3-dimethylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]-6-(8-oxa-3-azabicyclo[3.2.1]octane-3-carbonyl)pyridine-2-sulfonamide	IC50	30 nM	US-10889555: Sulfonamide compound or salt thereof
(4S)-5-chloro-N-[(1S,2R)-2-(6-fluoro-2,3-dimethylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]-4-hydroxy-4-(trideuteriomethyl)-2,3-dihydrochromene-8-sulfonamide	IC50	30 nM	US-12344588: Sulfonamide compounds and use thereof
5-chloro-N-[(1S,2R)-2-(6-fluoro-2,3-dimethylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]-4-hydroxy-4-(trideuteriomethyl)-2,3-dihydrochromene-8-sulfonamide	IC50	30 nM	US-20250223270: Sulfonamide Compounds and Use Thereof
(S)-N-((S)-1-Hydroxymethyl-3,3-dimethyl-butyl)-3-((S)-2-{(S)-3-methyl-2-[(S)-3-methyl-2-(3-phenyl-propionylamino)-butyrylamino]-butyrylamino}-4-oxo-4-pyrrolidin-1-yl-butyrylamino)-succinamic acid	IC50	34 nM
(S)-2-[(S)-3-Carboxy-2-((S)-2-{(S)-2-[(S)-3,3-dimethyl-2-(3-phenyl-propionylamino)-butyrylamino]-3-methyl-butyrylamino}-4-oxo-4-pyrrolidin-1-yl-butyrylamino)-propionylamino]-4-methyl-pentanoic acid	IC50	36 nM
2-chloro-5-[[(1S,2R)-2-(6-fluoro-2,3-dimethylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]sulfamoyl]-1-N,1-N-dimethylbenzene-1,4-dicarboxamide	IC50	40 nM	US-10889555: Sulfonamide compound or salt thereof
5-chloro-2-[[(1S,2R)-2-(6-fluoro-2,3-dimethylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]sulfamoyl]pyridine-3-carboxamide	IC50	40 nM	US-10889555: Sulfonamide compound or salt thereof
(S)-N-(2,2-Dimethyl-propyl)-3-((S)-2-{(S)-2-[3-(1-ethyl-propyl)-ureido]-3,3-dimethyl-butyrylamino}-4-oxo-4-pyrrolidin-1-yl-butyrylamino)-succinamic acid	IC50	40 nM
(4R)-N-[(1S,2R)-2-(3-bromo-6-fluoro-2-methylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]-5-chloro-4-hydroxy-4-methyl-2,3-dihydrochromene-8-sulfonamide	IC50	50 nM	US-10889555: Sulfonamide compound or salt thereof
(4R)-5-fluoro-N-[(1S,2R)-2-(6-fluoro-2,3-dimethylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]-4-hydroxy-3,4-dihydro-2H-chromene-8-sulfonamide	IC50	50 nM	US-10889555: Sulfonamide compound or salt thereof
5-chloro-2-[[(1S,2R)-2-(6-fluoro-2,3-dimethylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]sulfamoyl]benzenecarbothioamide	IC50	50 nM	US-10889555: Sulfonamide compound or salt thereof
N-[(1S,2R)-2-(3-bromo-6-fluoro-2-methylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]-5-chloro-4-hydroxy-4-methyl-2,3-dihydrochromene-8-sulfonamide	IC50	50 nM	US-11634395: Sulfonamide compound or salt thereof
5-bromo-2-[[(1S,2R)-2-(6-fluoro-2,3-dimethylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]sulfamoyl]benzamide	IC50	60 nM	US-10889555: Sulfonamide compound or salt thereof
methyl 3-chloro-6-[[(1S,2R)-2-(6-fluoro-2,3-dimethylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]sulfamoyl]pyridine-2-carboxylate	IC50	60 nM	US-10889555: Sulfonamide compound or salt thereof
5-chloro-N-[(1S,2R)-2-(6-fluoro-2,3-dimethylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]-6-(morpholine-4-carbonyl)pyridine-2-sulfonamide	IC50	60 nM	US-10889555: Sulfonamide compound or salt thereof
5-chloro-N-[(1S,2R)-2-(6-fluoro-2,3-dimethylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]-6-(pyrrolidine-1-carbonyl)pyridine-2-sulfonamide	IC50	60 nM	US-10889555: Sulfonamide compound or salt thereof
2-[[(1S,2R)-2-(6-fluoro-2,3-dimethylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]sulfamoyl]-4-(2-hydroxypropan-2-yl)benzamide	IC50	60 nM	US-10889555: Sulfonamide compound or salt thereof
5-chloro-2-[[(1S,2R)-2-(6-fluoro-2,3-dimethylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]sulfamoyl]-4-(2-hydroxypropan-2-yl)benzamide	IC50	60 nM	US-10889555: Sulfonamide compound or salt thereof
(4S)-N-[(1S,2R)-2-(3-bromo-6-fluoro-2-methylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]-5-chloro-4-hydroxy-4-methyl-2,3-dihydrochromene-8-sulfonamide	IC50	60 nM	US-12344588: Sulfonamide compounds and use thereof
3-chloro-6-[[(1S,2R)-2-(6-fluoro-2,3-dimethylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]sulfamoyl]-N-methylpyridine-2-carboxamide	IC50	60 nM	US-10889555: Sulfonamide compound or salt thereof
2-[[(1S,2R)-2-(3-bromo-6-fluoro-2-methylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]sulfamoyl]-5-chloropyridine-3-carboxamide	IC50	60 nM	US-10889555: Sulfonamide compound or salt thereof
5-chloro-N-[(1S,2R)-2-(6-fluoro-2,3-dimethylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]-4-methyl-2,3-dihydro-1,4-benzoxazine-8-sulfonamide	IC50	60 nM	US-10889555: Sulfonamide compound or salt thereof
4-amino-N-[(1S,2R)-2-(3-bromo-6-fluoro-2-methylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]-5-chloro-4-methyl-2,3-dihydrochromene-8-sulfonamide	IC50	60 nM	US-10889555: Sulfonamide compound or salt thereof
5-chloro-N-[(1S,2R)-2-(6-fluoro-2,3-dimethylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]-4-hydroxy-4-(trifluoromethyl)-2,3-dihydrochromene-8-sulfonamide	IC50	60 nM	US-11634395: Sulfonamide compound or salt thereof
US11634395, Example 226B	IC50	60 nM	US-20250223270: Sulfonamide Compounds and Use Thereof
CHEMBL1790855	IC50	61 nM
5-chloro-N-[(1S,2R)-2-(6-fluoro-2,3-dimethylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]-6-(3-oxa-8-azabicyclo[3.2.1]octane-8-carbonyl)pyridine-2-sulfonamide	IC50	70 nM	US-10889555: Sulfonamide compound or salt thereof
(4R)-5-chloro-N-[(1S,2R)-2-(6-fluoro-2,3-dimethylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]-4-hydroxy-3,4-dihydro-2H-chromene-8-sulfonamide	IC50	70 nM	US-10889555: Sulfonamide compound or salt thereof
(4S)-N-[(1S,2R)-2-(3-bromo-6-fluoro-2-methylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]-5-chloro-4-hydroxy-3,4-dihydro-2H-chromene-8-sulfonamide	IC50	70 nM	US-10889555: Sulfonamide compound or salt thereof
5-bromo-2-[[(1S,2R)-2-(3-chloro-6-fluoro-2-methylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]sulfamoyl]pyridine-3-carboxamide	IC50	70 nM	US-10889555: Sulfonamide compound or salt thereof
4-(2,2-difluoroethoxy)-2-[[(1S,2R)-2-(6-fluoro-2,3-dimethylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]sulfamoyl]benzamide	IC50	70 nM	US-10889555: Sulfonamide compound or salt thereof
5-chloro-2-[[(1S,2R)-2-(6-fluoro-2,3-dimethylphenyl)-1-(2-oxo-3H-1,3,4-oxadiazol-5-yl)propyl]sulfamoyl]-N-hydroxybenzamide	IC50	70 nM	US-10889555: Sulfonamide compound or salt thereof

ChEMBL bioactivities

77 potent at pChembl≥5 of 115 total, top 50 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
9.22	IC50	0.6	nM	CHEMBL336289
9.15	IC50	0.7	nM	CHEMBL96993
9.00	IC50	1	nM	CHEMBL98729
8.70	IC50	2	nM	CHEMBL1169533
8.52	IC50	3	nM	CHEMBL133754
8.52	IC50	3	nM	CHEMBL305199
8.40	IC50	4	nM	CHEMBL95998
8.30	IC50	5	nM	CHEMBL95766
8.30	IC50	5	nM	CHEMBL335164
8.22	IC50	6	nM	CHEMBL134961
8.19	IC50	6.4	nM	CHEMBL120710
8.15	IC50	7	nM	CHEMBL133827
8.15	IC50	7	nM	CHEMBL37210
8.12	IC50	7.5	nM	CHEMBL431851
7.82	IC50	15	nM	CHEMBL71945
7.75	IC50	18	nM	CHEMBL443029
7.70	IC50	20	nM	CHEMBL1169532
7.66	IC50	22	nM	CHEMBL96993
7.66	IC50	22	nM	CHEMBL439791
7.66	IC50	22	nM	CHEMBL120060
7.62	IC50	24	nM	CHEMBL305229
7.57	IC50	27	nM	CHEMBL131682
7.47	IC50	34	nM	CHEMBL414818
7.44	IC50	36	nM	CHEMBL118524
7.43	IC50	37	nM	CHEMBL98729
7.40	IC50	40	nM	CHEMBL132130
7.37	IC50	43	nM	CHEMBL99950
7.26	IC50	55	nM	CHEMBL1169533
7.21	IC50	61	nM	CHEMBL1790855
7.00	IC50	100	nM	CHEMBL131731
6.91	IC50	123	nM	CHEMBL95998
6.75	IC50	180	nM	CHEMBL19667
6.73	IC50	185	nM	TRIAPINE
6.68	IC50	210	nM	CHEMBL431851
6.47	IC50	340	nM	CHEMBL331870
6.46	IC50	350	nM	CHEMBL280440
6.36	IC50	440	nM	CHEMBL71721
6.35	IC50	450	nM	CHEMBL19766
6.30	IC50	500	nM	CHEMBL132309
6.23	IC50	588	nM	CHEMBL305229
6.09	IC50	820	nM	CHEMBL315999
6.07	IC50	860	nM	CHEMBL121015
6.07	IC50	860	nM	CHEMBL445620
6.06	IC50	880	nM	CHEMBL306879
6.03	IC50	925	nM	CHEMBL305199
6.00	IC50	1000	nM	CHEMBL87471
6.00	IC50	1000	nM	CHEMBL86188
5.89	IC50	1300	nM	CHEMBL314693
5.85	IC50	1400	nM	CHEMBL82809
5.85	IC50	1400	nM	CHEMBL86963

PubChem BioAssay actives

64 with measured affinity, of 376 total; 50 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
(2S)-2-[[(2S)-3-carboxy-2-[[(2S)-2-[[(2S)-3,3-dimethyl-2-(pentan-3-ylcarbamoylamino)butanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]propanoyl]amino]-4,4-dimethylpentanoic acid	197982: Inhibitory effect was evaluated on Herpes simplex virus (HSV) ribonucleotide reductase (RR) enzyme.	ic50	0.0006	uM
(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[(2-benzyl-3-phenylpropanoyl)amino]-3-methylbutanoyl]amino]-3-methylbutanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]-3-carboxypropanoyl]amino]-4-methylpentanoic acid	198112: In vitro inhibitory activity against HSV ribonucleotide reductase	ic50	0.0007	uM
1-[(1S)-2-[[(1S)-1-carboxy-3-methylbutyl]amino]-1-[[(2S)-2-[[(2S)-3-methyl-2-[[(2S)-3-methyl-2-(3-phenylpropanoylamino)butanoyl]amino]butanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]-2-oxoethyl]cyclopentane-1-carboxylic acid	198112: In vitro inhibitory activity against HSV ribonucleotide reductase	ic50	0.0010	uM
(2R)-2-[[(2R)-3-carboxy-2-[[(2S)-2-[[(2R)-2-[[(2R,6S)-2,6-dimethylcyclohexyl]carbamoylamino]-3-methylbutanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]propanoyl]amino]-4-methylpentanoic acid	197982: Inhibitory effect was evaluated on Herpes simplex virus (HSV) ribonucleotide reductase (RR) enzyme.	ic50	0.0020	uM
(2S)-2-[[(2S)-3-carboxy-2-[[(2S)-2-[[(2S)-3,3-dimethyl-2-(pentan-3-ylcarbamoylamino)butanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]propanoyl]amino]-4-methylpentanoic acid	197982: Inhibitory effect was evaluated on Herpes simplex virus (HSV) ribonucleotide reductase (RR) enzyme.	ic50	0.0030	uM
(2S)-2-[[(2S)-3-carboxy-2-[[(2S)-2-[[(2S)-3,3-dimethyl-2-(pentan-3-ylcarbamoylamino)butanoyl]amino]-5,5-dimethyl-4-oxohexanoyl]amino]propanoyl]amino]-4-methylpentanoic acid	197982: Inhibitory effect was evaluated on Herpes simplex virus (HSV) ribonucleotide reductase (RR) enzyme.	ic50	0.0030	uM
(2S)-2-[[(2S)-3-carboxy-2-[[(2S)-2-[[(2S)-3,3-dimethyl-2-[[(2S)-3-methyl-2-(3-phenylpropanoylamino)butanoyl]amino]butanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]propanoyl]amino]-4-methylpentanoic acid	198112: In vitro inhibitory activity against HSV ribonucleotide reductase	ic50	0.0040	uM
(2S)-2-[[(2S)-3-carboxy-2-[[(2S)-2-[[(2S)-3-methyl-2-[[(2S)-3-methyl-2-(3-phenylpropanoylamino)butanoyl]amino]butanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]propanoyl]amino]-4,4-dimethylpentanoic acid	198112: In vitro inhibitory activity against HSV ribonucleotide reductase	ic50	0.0050	uM
(2S)-2-[[(2S)-3-carboxy-2-[[(2R,5S)-2-(3,3-dimethyl-2-oxobutyl)-6,6-dimethyl-4-oxo-5-(pentan-3-ylcarbamoylamino)heptanoyl]amino]propanoyl]amino]-4-methylpentanoic acid	197982: Inhibitory effect was evaluated on Herpes simplex virus (HSV) ribonucleotide reductase (RR) enzyme.	ic50	0.0050	uM
(3S)-3-[[(2S)-2-[[(2S)-3,3-dimethyl-2-(pentan-3-ylcarbamoylamino)butanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]-4-[[(2S)-1-hydroxy-4,4-dimethylpentan-2-yl]amino]-4-oxobutanoic acid	197982: Inhibitory effect was evaluated on Herpes simplex virus (HSV) ribonucleotide reductase (RR) enzyme.	ic50	0.0060	uM
1-[(1S)-2-[[(1S)-1-carboxy-3-methylbutyl]amino]-1-[[(2S)-2-[[(2S)-2-(2-ethylbutanoylamino)-3,3-dimethylbutanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]-2-oxoethyl]cyclopent-3-ene-1-carboxylic acid	198112: In vitro inhibitory activity against HSV ribonucleotide reductase	ic50	0.0064	uM
(2S)-2-[[(2S)-3-carboxy-2-[[(2S)-2-[[(2S)-2-(heptan-4-ylcarbamoylamino)-3-methylbutanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]propanoyl]amino]-4-methylpentanoic acid	197982: Inhibitory effect was evaluated on Herpes simplex virus (HSV) ribonucleotide reductase (RR) enzyme.	ic50	0.0070	uM
(2S)-2-[[(2S)-3-carboxy-2-[[(2S,5S)-6,6-dimethyl-4-oxo-2-(2-oxo-2-pyrrolidin-1-ylethyl)-5-(pentan-3-ylcarbamoylamino)heptanoyl]amino]propanoyl]amino]-4-methylpentanoic acid	197982: Inhibitory effect was evaluated on Herpes simplex virus (HSV) ribonucleotide reductase (RR) enzyme.	ic50	0.0070	uM
(2S)-2-[[(2S)-3-carboxy-2-[[(2S)-2-[[(2S)-3-methyl-2-[[(2S)-3-methyl-2-[methyl(3-phenylpropanoyl)amino]butanoyl]amino]butanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]propanoyl]amino]-4-methylpentanoic acid	198112: In vitro inhibitory activity against HSV ribonucleotide reductase	ic50	0.0075	uM
(2S)-2-[[(2S)-3-carboxy-2-[[(2S)-2-[[(2S)-3-methyl-2-(pentan-3-ylcarbamoylamino)butanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]propanoyl]amino]-4-methylpentanoic acid	197982: Inhibitory effect was evaluated on Herpes simplex virus (HSV) ribonucleotide reductase (RR) enzyme.	ic50	0.0150	uM
(3S)-4-[[(3R)-2,2-dimethylpentan-3-yl]amino]-3-[[(2S)-2-[[(2S)-3,3-dimethyl-2-(pentan-3-ylcarbamoylamino)butanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]-4-oxobutanoic acid	197982: Inhibitory effect was evaluated on Herpes simplex virus (HSV) ribonucleotide reductase (RR) enzyme.	ic50	0.0180	uM
(2R)-2-[[(2R)-3-carboxy-2-[[(2S)-2-[[(2R)-2-[[(2S,6S)-2,6-dimethylcyclohexyl]carbamoylamino]-3-methylbutanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]propanoyl]amino]-4-methylpentanoic acid;(2R)-2-[[(2R)-3-carboxy-2-[[(2S)-2-[[(2R)-2-[[(2R,6R)-2,6-dimethylcyclohexyl]carbamoylamino]-3-methylbutanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]propanoyl]amino]-4-methylpentanoic acid	197982: Inhibitory effect was evaluated on Herpes simplex virus (HSV) ribonucleotide reductase (RR) enzyme.	ic50	0.0200	uM
(2S)-2-[[(2S)-2-[[(2S)-4-amino-2-[[(2S)-2-[[(2S)-2-[(2-benzyl-3-phenylpropanoyl)-methylamino]-3-methylbutanoyl]amino]-3-methylbutanoyl]amino]-4-oxobutanoyl]amino]-3-carboxypropanoyl]amino]-4-methylpentanoic acid	198112: In vitro inhibitory activity against HSV ribonucleotide reductase	ic50	0.0220	uM
(2S)-2-[[(2S)-3-carboxy-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-cyclohexyl-2-(3-phenylpropanoylamino)acetyl]amino]-3-methylbutanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]propanoyl]amino]-4-methylpentanoic acid	198112: In vitro inhibitory activity against HSV ribonucleotide reductase	ic50	0.0220	uM
(2S)-2-[[(2S)-3-carboxy-2-[[(2S)-2-[[(2S)-3-methyl-2-[[(2S)-3-methyl-2-(3-phenylpropanoylamino)butanoyl]amino]butanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]propanoyl]amino]-4-methylpentanoic acid	197982: Inhibitory effect was evaluated on Herpes simplex virus (HSV) ribonucleotide reductase (RR) enzyme.	ic50	0.0240	uM
(3S)-4-[[(2R)-3,3-dimethylbutan-2-yl]amino]-3-[[(2S)-2-[[(2S)-3,3-dimethyl-2-(pentan-3-ylcarbamoylamino)butanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]-4-oxobutanoic acid	197982: Inhibitory effect was evaluated on Herpes simplex virus (HSV) ribonucleotide reductase (RR) enzyme.	ic50	0.0270	uM
(3S)-4-[[(2S)-1-hydroxy-4,4-dimethylpentan-2-yl]amino]-3-[[(2S)-2-[[(2S)-3-methyl-2-[[(2S)-3-methyl-2-(3-phenylpropanoylamino)butanoyl]amino]butanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]-4-oxobutanoic acid	198112: In vitro inhibitory activity against HSV ribonucleotide reductase	ic50	0.0340	uM
(2S)-2-[[(2S)-3-carboxy-2-[[(2S)-2-[[(2S)-2-[[(2S)-3,3-dimethyl-2-(3-phenylpropanoylamino)butanoyl]amino]-3-methylbutanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]propanoyl]amino]-4-methylpentanoic acid	198112: In vitro inhibitory activity against HSV ribonucleotide reductase	ic50	0.0360	uM
(3S)-3-[[(2S)-2-[[(2S)-3,3-dimethyl-2-(pentan-3-ylcarbamoylamino)butanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]-4-(2,2-dimethylpropylamino)-4-oxobutanoic acid	197982: Inhibitory effect was evaluated on Herpes simplex virus (HSV) ribonucleotide reductase (RR) enzyme.	ic50	0.0400	uM
(3S)-4-[[(1S)-1-carboxy-3-methylbutyl]amino]-3-[[(2S)-2-[[(2S)-2-(2-ethylbutanoylamino)-3,3-dimethylbutanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]-2,2-dimethyl-4-oxobutanoic acid	198112: In vitro inhibitory activity against HSV ribonucleotide reductase	ic50	0.0430	uM
(2S)-2-[[(2S)-3-carboxy-2-[[(2S)-2-[[(2S)-3-methyl-2-[[(2S,3S)-3-methyl-2-(3-phenylpropanoylamino)pentanoyl]amino]butanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]propanoyl]amino]-4-methylpentanoic acid	198112: In vitro inhibitory activity against HSV ribonucleotide reductase	ic50	0.0610	uM
(3S)-4-(3,3-dimethylbutylamino)-3-[[(2S)-2-[[(2S)-3,3-dimethyl-2-(pentan-3-ylcarbamoylamino)butanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]-4-oxobutanoic acid	197982: Inhibitory effect was evaluated on Herpes simplex virus (HSV) ribonucleotide reductase (RR) enzyme.	ic50	0.1000	uM
(2S)-2-[[(2S)-2-[[(2S)-4-amino-2-[[(2S)-2-[[(2S)-2-[(2-benzyl-3-phenylpropanoyl)amino]-3-methylbutanoyl]amino]-3-methylbutanoyl]amino]-4-oxobutanoyl]amino]-3-carboxypropanoyl]amino]-4-methylpentanoic acid	198112: In vitro inhibitory activity against HSV ribonucleotide reductase	ic50	0.1800	uM
[(E)-(3-amino-2-pyridinyl)methylideneamino]thiourea	1472802: Inhibition of human RRM2 expressed in Escherichia coli BL21-codon plus(DE3) using [14C]-ADP as substrate after 3 mins by liquid scintillation counting method	ic50	0.1850	uM
(2S)-2-[[(2S)-3-carboxy-2-[[(2S)-2-[[(2S)-3-methyl-2-[[(2S)-2-(3-phenylpropanoylamino)butanoyl]amino]butanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]propanoyl]amino]-4-methylpentanoic acid	198112: In vitro inhibitory activity against HSV ribonucleotide reductase	ic50	0.3400	uM
(3S)-3-[[(2S)-2-[[(2S)-3,3-dimethyl-2-(pentan-3-ylcarbamoylamino)butanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]-4-(3-methylbutylamino)-4-oxobutanoic acid	197982: Inhibitory effect was evaluated on Herpes simplex virus (HSV) ribonucleotide reductase (RR) enzyme.	ic50	0.3500	uM
(2S)-2-[[(2S)-3-carboxy-2-[[(2S)-2-[[(2S)-3-methyl-2-(propan-2-ylcarbamoylamino)butanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]propanoyl]amino]-4-methylpentanoic acid	197982: Inhibitory effect was evaluated on Herpes simplex virus (HSV) ribonucleotide reductase (RR) enzyme.	ic50	0.4400	uM
(2S)-2-[[(2S)-3-carboxy-2-[[(2S)-2-[[(2S)-2-(cyclohexylcarbamoylamino)-3-methylbutanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]propanoyl]amino]-4-methylpentanoic acid	197982: Inhibitory effect was evaluated on Herpes simplex virus (HSV) ribonucleotide reductase (RR) enzyme.	ic50	0.5000	uM
[(5-amino-6-formyl-2-pyridinyl)amino]thiourea	197981: Inhibitory activity against CDP reductase.	ic50	0.8200	uM
(2S)-2-[[(2S)-3-carboxy-2-[[(2S)-2-[[(2S)-2-(2-ethylbutanoylamino)-3-methylbutanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]propanoyl]amino]-4-methylpentanoic acid	197982: Inhibitory effect was evaluated on Herpes simplex virus (HSV) ribonucleotide reductase (RR) enzyme.	ic50	0.8600	uM
(2S)-2-[[(2S)-2-[[(2S)-4-amino-2-[[(2S)-3-methyl-2-[[(2S)-3-methyl-2-[[(2R)-2-methyl-3-phenylpropanoyl]amino]butanoyl]amino]butanoyl]amino]-4-oxobutanoyl]amino]-3-carboxypropanoyl]amino]-4-methylpentanoic acid	198112: In vitro inhibitory activity against HSV ribonucleotide reductase	ic50	0.8600	uM
(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-[[(2S)-2-acetamido-3-methylbutanoyl]amino]-3-methylbutanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]-3-carboxypropanoyl]amino]-4-methylpentanoic acid	198112: In vitro inhibitory activity against HSV ribonucleotide reductase	ic50	0.8800	uM
[(E)-[5-(ethylamino)-2-pyridinyl]methylideneamino]thiourea	197981: Inhibitory activity against CDP reductase.	ic50	1.0000	uM
[(E)-[3-(methylamino)-2-pyridinyl]methylideneamino]thiourea	197981: Inhibitory activity against CDP reductase.	ic50	1.0000	uM
[(E)-[5-(methylamino)-2-pyridinyl]methylideneamino]thiourea	197981: Inhibitory activity against CDP reductase.	ic50	1.3000	uM
[(E)-[5-(propylamino)-2-pyridinyl]methylideneamino]thiourea	197981: Inhibitory activity against CDP reductase.	ic50	1.4000	uM
[(E)-[5-(prop-2-enylamino)-2-pyridinyl]methylideneamino]thiourea	197981: Inhibitory activity against CDP reductase.	ic50	1.4000	uM
[(E)-[3-(prop-2-enylamino)-2-pyridinyl]methylideneamino]thiourea	197981: Inhibitory activity against CDP reductase.	ic50	1.7000	uM
(3S)-3-[[(2S)-2-[[(2S)-3-carboxy-2-[[(2S)-2-[[2-[9H-fluoren-9-ylmethoxycarbonyl(methyl)amino]-2-phenylacetyl]amino]-4-methylpentanoyl]amino]propanoyl]amino]-3-cyclohexylpropanoyl]amino]-4-[[(1S)-1-carboxy-2-phenylethyl]amino]-4-oxobutanoic acid	242343: Inhibition of mammalian ribonucleotide reductase in a standard dTTP-dependent GDP reductase assay	ic50	1.9000	uM
(3S)-3-[[(2S)-2-[[(2S)-3,3-dimethyl-2-(pentan-3-ylcarbamoylamino)butanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]-4-(2-methylpropylamino)-4-oxobutanoic acid	197982: Inhibitory effect was evaluated on Herpes simplex virus (HSV) ribonucleotide reductase (RR) enzyme.	ic50	1.9000	uM
(3S)-4-[[(3S)-2,2-dimethylpentan-3-yl]amino]-3-[[(2S)-2-[[(2S)-3,3-dimethyl-2-(pentan-3-ylcarbamoylamino)butanoyl]amino]-4-oxo-4-pyrrolidin-1-ylbutanoyl]amino]-4-oxobutanoic acid	197982: Inhibitory effect was evaluated on Herpes simplex virus (HSV) ribonucleotide reductase (RR) enzyme.	ic50	2.0000	uM
(4S)-5-[[(2S)-1-[[(2S)-3-carboxy-1-[[(1S)-1-carboxy-2-phenylethyl]amino]-1-oxopropan-2-yl]amino]-3-cyclohexyl-1-oxopropan-2-yl]amino]-4-[[(2S)-2-[[3-(9H-fluoren-9-ylmethoxy)-3-oxo-2-phenylpropanoyl]amino]-4-methylpentanoyl]amino]-5-oxopentanoic acid	242343: Inhibition of mammalian ribonucleotide reductase in a standard dTTP-dependent GDP reductase assay	ic50	2.4000	uM
(3S)-3-[[(2S)-2-[[(2S)-3-carboxy-2-[[(2S)-2-[[3-(9H-fluoren-9-ylmethoxy)-3-oxo-2-phenylpropanoyl]amino]-4-methylpentanoyl]amino]propanoyl]amino]-3-cyclohexylpropanoyl]amino]-4-[[(1S)-1-carboxy-2-phenylethyl]amino]-4-oxobutanoic acid	242343: Inhibition of mammalian ribonucleotide reductase in a standard dTTP-dependent GDP reductase assay	ic50	2.4000	uM
[(E)-[5-(butylamino)-2-pyridinyl]methylideneamino]thiourea	197981: Inhibitory activity against CDP reductase.	ic50	2.5000	uM
[(E)-[5-(aminomethyl)-2-pyridinyl]methylideneamino]thiourea	197981: Inhibitory activity against CDP reductase.	ic50	2.5000	uM

CTD chemical–gene interactions

163 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	affects expression, decreases expression, increases expression	7
Fluorouracil	affects cotreatment, affects response to substance, affects expression, decreases expression, increases expression	7
bisphenol A	increases methylation, decreases expression, increases expression, affects expression, affects cotreatment	6
Benzo(a)pyrene	affects methylation, decreases expression	5
Estradiol	decreases expression, increases expression, affects cotreatment	5
Cyclosporine	affects expression, decreases expression	5
Doxorubicin	affects expression, decreases expression, affects cotreatment, affects response to substance	4
Cisplatin	increases activity, increases phosphorylation, increases reaction, increases response to substance, increases expression (+1 more)	3
Progesterone	affects cotreatment, decreases expression, increases expression	3
Silicon Dioxide	decreases expression, increases expression	3
Tetrachlorodibenzodioxin	affects expression, decreases expression, increases expression	3
Valproic Acid	affects expression, decreases expression, increases methylation	3
Genistein	decreases expression, increases expression	3
cobaltous chloride	decreases expression	2
perfluorooctanoic acid	decreases expression	2
Resveratrol	affects cotreatment, increases expression, decreases expression	2
Arsenic Trioxide	decreases expression	2
Gemcitabine	decreases response to substance, increases expression, affects response to substance	2
Copper	affects binding, increases expression, decreases expression	2
Tobacco Smoke Pollution	increases expression, affects expression	2
Tretinoin	decreases expression	2
Aflatoxin B1	affects expression, affects cotreatment, increases expression	2
Cadmium Chloride	decreases expression, increases expression	2
Particulate Matter	decreases expression, increases abundance, affects cotreatment, increases expression	2
aristolochic acid I	increases expression, decreases expression	1
3-((6-(2-methoxyphenyl)pyrimidin-4-yl)amino)phenyl)methane sulfonamide	decreases reaction, increases degradation, decreases expression	1
afuresertib	decreases expression	1
FR900359	decreases phosphorylation	1
bismuth tripotassium dicitrate	decreases expression	1
tungsten carbide	affects cotreatment, increases expression	1

ChEMBL screening assays

37 unique, capped per target: 34 binding, 3 functional

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL4027846	Binding	Inhibition of human RRM2 expressed in Escherichia coli BL21-codon plus(DE3) using [14C]-ADP as substrate after 3 mins by liquid scintillation counting method	Structure-Guided Synthesis and Mechanistic Studies Reveal Sweetspots on Naphthyl Salicyl Hydrazone Scaffold as Non-Nucleosidic Competitive, Reversible Inhibitors of Human Ribonucleotide Reductase. — *J Med Chem*
CHEMBL652605	Functional	Inhibitory activity against HSV-1 in baby hamster kidney cell	Peptidomimetic inhibitors of herpes simplex virus ribonucleotide reductase: a new class of antiviral agents. — *J Med Chem*

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

Predicted chemistry — Sugi Predict

The predicted patent-compound landscape for RRM2 across ~30M SureChEMBL compounds — explore on Sugi Predict.