RYR2

Summary

RYR2 (ryanodine receptor 2, HGNC:10484) is a protein-coding gene on chromosome 1q43, encoding Ryanodine receptor 2 (Q92736). Cytosolic calcium-activated calcium channel that mediates the release of Ca(2+) from the sarcoplasmic reticulum into the cytosol and thereby plays a key role in triggering cardiac muscle contraction.

This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia.

Source: NCBI Gene 6262 — RefSeq curated summary.

At a glance

• Gene–disease (curated): catecholaminergic polymorphic ventricular tachycardia (Definitive, ClinGen) — +6 more curated relationships
• GWAS associations: 22
• Clinical variants (ClinVar): 9,498 total — 73 pathogenic, 141 likely-pathogenic (top 1% of genes corpus-wide)
• Regional missense constraint (gnomAD): 5 of 17 regions constrained (≈6% of expected missense variation)
• GTEx eGene: eQTL in 23 tissues, sQTL in 2 (q < 0.05)
• Phenotypes (HPO): 22
• ChEMBL bioactivity: 1 clinical-phase molecule tested; no curated mechanism-of-action drug
• Dosage sensitivity (ClinGen): haploinsufficiency no evidence, triplosensitivity no evidence
• Constraint (gnomAD): pLI 1.00 (loss-of-function intolerant), LOEUF 0.42 (moderately constrained)
• MANE Select transcript: NM_001035
• Interaction hub: 2,770 STRING partners (top 3% of genes corpus-wide)

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:10484
Approved symbol	RYR2
Name	ryanodine receptor 2
Location	1q43
Locus type	gene with protein product
Status	Approved
Aliases	ARVC2, VTSIP
Ensembl gene	ENSG00000198626
Ensembl biotype	protein_coding
OMIM	180902
Entrez	6262

Gene structure

Transcript identifiers

Ensembl transcripts: 12 — 8 protein_coding, 2 retained_intron, 1 protein_coding_CDS_not_defined, 1 nonsense_mediated_decay

MANE Select: ENST00000366574

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 1, TSL 2: 1, TSL 5: 1

ENST00000366574, ENST00000462585, ENST00000466626, ENST00000608590, ENST00000609119, ENST00000659194, ENST00000660292, ENST00000661330, ENST00000714018, ENST00000714019, ENST00000714021, ENST00000714022

RefSeq mRNA: 1 — MANE Select: NM_001035 NM_001035

CCDS: CCDS55691

Canonical transcript exons

ENST00000366574 — 105 exons

Exon	Start	End
ENSE00000908141	237550544	237550691
ENSE00000908143	237569145	237569319
ENSE00000908149	237602025	237602111
ENSE00000908150	237610762	237610988
ENSE00000908152	237617286	237617486
ENSE00000908157	237633578	237633710
ENSE00000908159	237638357	237638492
ENSE00000908162	237643327	237643447
ENSE00000908164	237649877	237650097
ENSE00000908166	237654274	237654414
ENSE00000908167	237655821	237655984
ENSE00000908169	237659985	237660074
ENSE00000908170	237660810	237660947
ENSE00000908171	237666512	237666589
ENSE00000908172	237667883	237667958
ENSE00000908206	237787988	237788135
ENSE00000908209	237793867	237793997
ENSE00000908211	237798037	237798170
ENSE00000908212	237801856	237801916
ENSE00000908214	237808901	237809035
ENSE00000908215	237819036	237819192
ENSE00000908216	237828381	237828445
ENSE00000908217	237830530	237830630
ENSE00001022769	237492954	237493087
ENSE00001022773	237387281	237387380
ENSE00001022774	237506710	237506814
ENSE00001022775	237441319	237441483
ENSE00001022777	237445401	237445522
ENSE00001022814	237511688	237511791
ENSE00001022824	237456600	237456735
ENSE00001022826	237374717	237374795
ENSE00001165465	237705213	237705343
ENSE00001165474	237701978	237702059
ENSE00001165512	237678048	237678112
ENSE00001165519	237674731	237674846
ENSE00001165528	237674096	237674219
ENSE00001165545	237651411	237651501
ENSE00001165554	237648444	237648613
ENSE00001165561	237640897	237641002
ENSE00001165569	237639015	237639201
ENSE00001165574	237634889	237634992
ENSE00001165593	237625661	237625804
ENSE00001165599	237614039	237614843
ENSE00001165606	237595498	237595657
ENSE00001165611	237593476	237593636
ENSE00001165618	237591739	237591853
ENSE00001165629	237589793	237590001
ENSE00001165645	237548431	237548590
ENSE00001165655	237530427	237530510
ENSE00001165664	237503289	237503505
ENSE00001165670	237500711	237500903
ENSE00001165676	237496511	237496752
ENSE00001165684	237491806	237491924
ENSE00001165690	237469092	237469187
ENSE00001165694	237454391	237454574
ENSE00001165701	237423092	237423248
ENSE00001165706	237417049	237417123
ENSE00001165710	237388087	237388183
ENSE00001165714	237377323	237377435
ENSE00001165752	237785969	237786036
ENSE00001165758	237566567	237566775
ENSE00001165779	237627807	237628080
ENSE00001165786	237623765	237623870
ENSE00001166352	237369534	237369608
ENSE00001303582	237590640	237590992
ENSE00001308608	237791429	237791515
ENSE00001329360	237783675	237784972
ENSE00001401585	237042184	237042569
ENSE00001422468	237832552	237833988
ENSE00001604858	237806137	237806283
ENSE00001611202	237657944	237658022
ENSE00001631808	237687455	237687504
ENSE00002211141	237330878	237330982
ENSE00002233717	237631427	237631541
ENSE00002242722	237795289	237795331
ENSE00003475557	237770807	237770887
ENSE00003485861	237730260	237730356
ENSE00003488686	237742296	237742349
ENSE00003507227	237759776	237759852
ENSE00003509423	237760955	237761028
ENSE00003517487	237732046	237732149
ENSE00003518284	237792105	237792323
ENSE00003524890	237727087	237727199
ENSE00003524981	237772012	237772100
ENSE00003531557	237700229	237700467
ENSE00003533550	237711745	237711837
ENSE00003533727	237708858	237709098
ENSE00003545364	237756288	237756387
ENSE00003557444	237831514	237831565
ENSE00003579451	237706949	237707269
ENSE00003582754	237778666	237778770
ENSE00003599358	237680456	237680577
ENSE00003604153	237723128	237723262
ENSE00003607820	237717198	237717368
ENSE00003612583	237773520	237773648
ENSE00003616334	237709480	237709567
ENSE00003620408	237757697	237757776
ENSE00003630461	237733705	237733756
ENSE00003645048	237698965	237699025
ENSE00003673763	237718462	237718521
ENSE00003674190	237781565	237781646
ENSE00003686434	237726273	237726308
ENSE00003728105	237270497	237270616
ENSE00004022506	237355965	237355985
ENSE00004022517	237364358	237364372

Expression profiles

Bgee: expression breadth ubiquitous, 210 present calls, max score 99.63.

FANTOM5 (CAGE): breadth broad, TPM avg 10.4210 / max 1158.8465, expressed in 330 samples.

Highest expression (Bgee): heart right ventricle, ventricle myocardium, myocardium, cardiac muscle of right atrium, apex of heart.

Genetic regulation across tissues (GTEx eQTL / sQTL)

RYR2 is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 23 tissues and its splicing (sQTL) in 2 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 25 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Artery Aorta	eqtl	1.2e-18	+0.41	1:237031622:A:G
Artery Tibial	eqtl	7.3e-16	-0.41	1:237040183:T:A
Skin Sun Exposed Lower leg	eqtl	1.4e-11	+0.25	1:237031622:A:G
Esophagus Mucosa	eqtl	5.4e-07	+0.18	1:237112321:T:C
Esophagus Muscularis	eqtl	1.0e-06	-0.19	1:237112768:T:C
Artery Coronary	eqtl	1.5e-06	+0.27	1:237031622:A:G
Heart Atrial Appendage	eqtl	2.3e-06	+0.13	1:237031622:A:G
Thyroid	eqtl	2.6e-06	-0.16	1:237044785:C:T
Adipose Subcutaneous	eqtl	1.8e-05	+0.11	1:237036475:T:G
Brain Cerebellum	eqtl	3.5e-05	-0.23	1:237289649:CAT:C
Stomach	eqtl	1.2e-04	-0.25	1:237046703:C:T
Nerve Tibial	eqtl	6.2e-04	+0.17	1:237031622:A:G
Brain Anterior cingulate cortex BA24	eqtl	9.7e-04	+0.77	1:237952766:G:A
Skin Not Sun Exposed Suprapubic	eqtl	1.1e-03	+0.22	1:237031622:A:G
Testis	eqtl	1.9e-03	-0.95	1:236950728:G:T
Heart Left Ventricle	eqtl	2.8e-03	-0.15	1:236997490:C:T
Ovary	eqtl	5.7e-03	+0.40	1:237136049:T:C
Brain Cortex	sqtl	2.0e-02	-1.73	1:237789517:G:GTATAGTTCTATTAATTATAGGTCATGGCTGCAGA
Brain Cortex	eqtl	2.1e-02	+0.31	1:236668648:T:C
Pancreas	eqtl	2.7e-02	+0.48	1:237475092:A:G

FANTOM5 promoters

4 alternative TSS:

Promoter ID	TPM avg	Samples expressed
9272	10.1640	327
9273	0.1653	72
9285	0.0627	8
9284	0.0290	9

Top tissues by expression

showing 100 of 291 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
heart right ventricle	UBERON:0002080	99.63	gold quality
left ventricle myocardium	UBERON:0006566	99.37	gold quality
myocardium	UBERON:0002349	99.35	gold quality
cardiac muscle of right atrium	UBERON:0003379	99.31	gold quality
apex of heart	UBERON:0002098	98.75	gold quality
cardiac atrium	UBERON:0002081	98.49	gold quality
right atrium auricular region	UBERON:0006631	98.42	gold quality
cardiac ventricle	UBERON:0002082	98.35	gold quality
heart left ventricle	UBERON:0002084	98.31	gold quality
endothelial cell	CL:0000115	97.64	gold quality
heart	UBERON:0000948	96.89	gold quality
Brodmann (1909) area 23	UBERON:0013554	94.87	gold quality
vena cava	UBERON:0004087	94.74	gold quality
primary visual cortex	UBERON:0002436	93.05	gold quality
right hemisphere of cerebellum	UBERON:0014890	92.91	gold quality
cerebellar hemisphere	UBERON:0002245	92.89	gold quality
cerebellar cortex	UBERON:0002129	92.88	gold quality
cerebellum	UBERON:0002037	92.06	gold quality
right coronary artery	UBERON:0001625	92.02	gold quality
orbitofrontal cortex	UBERON:0004167	90.65	gold quality
occipital lobe	UBERON:0002021	89.88	gold quality
postcentral gyrus	UBERON:0002581	89.83	gold quality
popliteal artery	UBERON:0002250	89.66	gold quality
tibial artery	UBERON:0007610	89.65	gold quality
superior frontal gyrus	UBERON:0002661	89.45	gold quality
parietal lobe	UBERON:0001872	88.94	gold quality
middle temporal gyrus	UBERON:0002771	88.77	gold quality
prefrontal cortex	UBERON:0000451	88.51	gold quality
Brodmann (1909) area 46	UBERON:0006483	88.39	gold quality
aorta	UBERON:0000947	88.27	gold quality
frontal cortex	UBERON:0001870	87.79	gold quality
Brodmann (1909) area 9	UBERON:0013540	87.67	gold quality
right frontal lobe	UBERON:0002810	87.64	gold quality
cerebellar vermis	UBERON:0004720	87.42	gold quality
lower esophagus muscularis layer	UBERON:0035833	87.40	gold quality
lower esophagus	UBERON:0013473	87.34	gold quality
descending thoracic aorta	UBERON:0002345	86.93	gold quality
Brodmann (1909) area 10	UBERON:0013541	86.78	gold quality
CA1 field of hippocampus	UBERON:0003881	86.72	gold quality
thoracic aorta	UBERON:0001515	86.70	gold quality
ascending aorta	UBERON:0001496	86.45	gold quality
nucleus accumbens	UBERON:0001882	86.41	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	86.31	gold quality
neocortex	UBERON:0001950	86.17	gold quality
mucosa of stomach	UBERON:0001199	85.92	gold quality
entorhinal cortex	UBERON:0002728	85.88	gold quality
cortical plate	UBERON:0005343	85.45	gold quality
cerebral cortex	UBERON:0000956	85.23	gold quality
coronary artery	UBERON:0001621	84.98	gold quality
germinal epithelium of ovary	UBERON:0001304	84.70	gold quality
left coronary artery	UBERON:0001626	84.63	gold quality
telencephalon	UBERON:0001893	84.22	gold quality
caudate nucleus	UBERON:0001873	83.56	gold quality
putamen	UBERON:0001874	83.48	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	83.34	gold quality
brain	UBERON:0000955	82.79	gold quality
forebrain	UBERON:0001890	82.49	gold quality
central nervous system	UBERON:0001017	82.34	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	82.09	gold quality
lateral globus pallidus	UBERON:0002476	81.93	gold quality
Ammon’s horn	UBERON:0001954	81.79	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	81.56	gold quality
blood vessel layer	UBERON:0004797	81.52	gold quality
body of pancreas	UBERON:0001150	81.20	gold quality
cingulate cortex	UBERON:0003027	80.69	gold quality
anterior cingulate cortex	UBERON:0009835	80.52	gold quality
temporal lobe	UBERON:0001871	78.70	gold quality
middle frontal gyrus	UBERON:0002702	77.43	gold quality
thyroid gland	UBERON:0002046	77.04	gold quality
frontal pole	UBERON:0002795	76.96	gold quality
left ovary	UBERON:0002119	76.83	gold quality
left lobe of thyroid gland	UBERON:0001120	76.69	gold quality
paraflocculus	UBERON:0005351	76.08	gold quality
saphenous vein	UBERON:0007318	75.85	gold quality
right ovary	UBERON:0002118	75.66	gold quality
muscle layer of sigmoid colon	UBERON:0035805	75.53	gold quality
ovary	UBERON:0000992	75.01	gold quality
upper lobe of left lung	UBERON:0008952	74.84	gold quality
right lung	UBERON:0002167	74.64	gold quality
right lobe of thyroid gland	UBERON:0001119	74.61	gold quality
pituitary gland	UBERON:0000007	74.53	gold quality
corpus callosum	UBERON:0002336	74.51	gold quality
pancreas	UBERON:0001264	74.17	gold quality
pons	UBERON:0000988	74.15	gold quality
esophagus	UBERON:0001043	74.07	gold quality
upper lobe of lung	UBERON:0008948	73.86	gold quality
amygdala	UBERON:0001876	73.75	gold quality
adenohypophysis	UBERON:0002196	73.59	gold quality
hypothalamus	UBERON:0001898	72.28	gold quality
gall bladder	UBERON:0002110	71.36	gold quality
fundus of stomach	UBERON:0001160	70.94	gold quality
dorsal root ganglion	UBERON:0000044	70.75	gold quality
body of stomach	UBERON:0001161	70.23	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	69.65	gold quality
stomach	UBERON:0000945	69.61	gold quality
substantia nigra	UBERON:0002038	69.45	gold quality
midbrain	UBERON:0001891	69.23	gold quality
sigmoid colon	UBERON:0001159	69.01	gold quality
superior vestibular nucleus	UBERON:0007227	68.63	gold quality
spinal cord	UBERON:0002240	68.50	gold quality

Single-cell (SCXA)

Detected in 6 experiment(s), a significant marker in 5.

Experiment	Marker?	Max mean expression
E-ANND-2	yes	26892.65
E-GEOD-180759	yes	2868.56
E-HCAD-35	yes	1943.69
E-HCAD-25	yes	1752.31
E-ANND-3	yes	9.67
E-MTAB-11268	no	24838.24

HPA expression

RNA tissue specificity: Tissue enriched

showing 60 of 72 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Heart muscle	tissue	130.5	medium
Postcentral gyrus	tissue	98.3
Nucleus accumbens	tissue	69.1
Cerebellum	tissue	66.0	not detected
Cerebral cortex	tissue	59.5	medium
Somatosensory cortex	tissue	59.5
Occipital cortex	tissue	57.4
Hippocampus	tissue	52.7	medium
Motor cortex	tissue	49.8
Olfactory bulb	tissue	48.3
Retrosplenial and cingulate cortex	tissue	47.9
Hippocampal formation	tissue	47.4
Entorhinal cortex	tissue	47.4
Retrosplenial cortex	tissue	45.5
Temporal cortex	tissue	44.8
Prefrontal cortex	tissue	44.0
Insular cortex	tissue	41.5
Putamen	tissue	30.2
Basal ganglia	tissue	27.6	medium
Frontal cortex	tissue	25.8
Ventral forebrain	tissue	25.2
Amygdala	tissue	25.1
Septum	tissue	19.7
Locus coeruleus	tissue	14.7
Pons	tissue	13.5
Caudate putamen	tissue	13.2
Superior colliculi	tissue	12.3
Hypothalamus	tissue	12.2
Medulla oblongata	tissue	11.9
Thalamus	tissue	11.7
Periaqueductal gray	tissue	11.0
Midbrain	tissue	10.7
Substantia nigra	tissue	9.1
Spinal cord	tissue	8.4
Pancreas	tissue	8.0	not detected
Retina	tissue	6.5
Thyroid gland	tissue	4.4	not detected
Corpus callosum	tissue	4.2
Ovary	tissue	4.1	not detected
Esophagus	tissue	2.8	not detected
Prostate	tissue	2.8	not detected
Choroid plexus	tissue	2.5
Pituitary gland	tissue	2.2
Lung	tissue	1.8	not detected
Gallbladder	tissue	1.8	not detected
Seminal vesicle	tissue	1.7	not detected
Cervix	tissue	1.5	not detected
Spleen	tissue	1.3	not detected
Placenta	tissue	1.2	medium
Testis	tissue	1.1	medium
Urinary bladder	tissue	1.1	not detected
Appendix	tissue	0.8	not detected
Breast	tissue	0.7	not detected
Smooth muscle	tissue	0.7	not detected
Endometrium 1	tissue	0.7	not detected
Adrenal gland	tissue	0.7	not detected
Fallopian tube	tissue	0.7	not detected
Colon	tissue	0.6	not detected
Vagina	tissue	0.5	not detected
Adipose tissue	tissue	0.5	not detected

Brain sub-regions (HPA Brain Atlas): detected in 189; highest nTPM — Posterior cingulate cortex (80.3), Somatosensory cortex, postcentral gyrus, ventral (white matter) (74.8), Somatomor cortex, precentral gyrus (white matter) (71.6), Caudate nucleus (71.1), Frontal eye field (69.2).

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): E2F6, NKX2-5, SP1

miRNA regulators (miRDB)

Targeting RYR2 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 139 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-1193	100.00	65.93	529
HSA-MIR-574-5P	100.00	66.01	989
HSA-MIR-513A-5P	100.00	69.77	2465
HSA-MIR-6833-3P	100.00	70.63	3197
HSA-MIR-4768-5P	100.00	69.49	2861
HSA-MIR-6758-5P	100.00	66.21	1470
HSA-MIR-6856-5P	100.00	65.47	1298
HSA-MIR-371B-5P	99.99	75.34	4759
HSA-MIR-186-5P	99.99	70.83	3707
HSA-MIR-3667-3P	99.99	67.17	1636
HSA-MIR-485-3P	99.98	70.68	1585
HSA-MIR-539-3P	99.98	70.74	1616
HSA-MIR-520D-5P	99.98	73.34	4883
HSA-MIR-524-5P	99.98	73.43	4882
HSA-MIR-373-5P	99.98	75.36	4753
HSA-MIR-616-5P	99.98	75.58	4775
HSA-MIR-3617-3P	99.98	67.86	918
HSA-MIR-5696	99.98	72.36	4487
HSA-MIR-3148	99.97	75.06	6478
HSA-MIR-3688-3P	99.97	72.02	2834
HSA-MIR-3065-5P	99.97	71.56	3281
HSA-MIR-302E	99.96	70.74	2669
HSA-MIR-4666A-3P	99.96	71.71	3434
HSA-MIR-1468-3P	99.96	72.74	3797
HSA-MIR-6825-5P	99.96	69.81	3431
HSA-MIR-545-3P	99.95	70.74	2783
HSA-MIR-3910	99.95	71.13	2227
HSA-MIR-9983-3P	99.94	71.48	3631
HSA-MIR-651-3P	99.94	73.48	5177
HSA-MIR-335-3P	99.93	73.36	4958

Functional genomics

gnomAD constraint: pLI 1, LOEUF 0.424, missense Z 6.44 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD)

ENST00000366574 splits into 17 regions with different missense tolerance; 5 are missense-constrained (≈6% of the expected missense variation). Missense variants in a constrained region (low observed/expected) are more likely to be pathogenic. gnomAD

Region (GRCh38)	Missense obs / exp	o/e	Constrained
1:237,042,522–237,377,357	153 / 203.6	0.75	no
1:237,377,358–237,377,399	1 / 16.2	0.06	yes (p 1.6e-04)
1:237,377,400–237,423,121	87 / 144.7	0.60	no
1:237,423,122–237,617,414	1807 / 2088.1	0.87	no
1:237,617,415–237,617,485	7 / 26.9	0.26	yes (p 1.2e-04)
1:237,617,486–237,628,002	170 / 184.5	0.92	no
1:237,628,003–237,639,096	137 / 273.6	0.50	no
1:237,639,097–237,770,856	1497 / 1842.6	0.81	no
1:237,770,857–237,783,784	90 / 213.3	0.42	no
1:237,783,785–237,783,969	66 / 80.7	0.82	no
1:237,783,970–237,784,344	70 / 164.6	0.43	no
1:237,784,345–237,792,265	364 / 442.9	0.82	no
1:237,792,266–237,798,062	37 / 102.8	0.36	yes (p 8.5e-11)
1:237,798,063–237,806,212	76 / 97.4	0.78	no
1:237,806,213–237,808,945	8 / 45.1	0.18	yes (p 3.3e-08)
1:237,808,946–237,809,007	21 / 24.8	0.85	no
1:237,809,008–237,832,644	55 / 204.7	0.27	yes (p 1.3e-25)
ClinGen dosage: haploinsufficiency 0 (no evidence), triplosensitivity 0 (no evidence). ClinGen Gene Dosage Map

Literature-anchored findings (GeneRIF, showing 40)

• Mutations in the gene coding for cardiac ryanodine receptor (hRYR2) may be a key step in molecular pathogenesis of ARVDs, and catecholaminergic ventricular arrhythmias or with familial ventricular tachyarrhythmia. (PMID:12015469)
• RyR2 mutations are associated with polymorphic ventricular arrhythmia, syncope and sudden death in response to physical or emotional stress. (PMID:12106942)
• identification of binding site for FKBP12.6 protein (PMID:12446682)
• Data show that VTSIP- and ARVD2-associated point mutations influence positively and negatively, respectively, the binding of RyR2 to its gating protein FKBP12.6. (PMID:12459180)
• the DR3 region of Ryanodine Receptor 2 has a role in excitation-contraction coupling and in channel regulation (PMID:12576471)
• data demonstrate that defective regulation of ryanodine receptor 2 causes altered cellular phenotype via profound perturbations in intracellular calcium signaling and highlight a key modulatory role of FK506 binding protein 12.6 (PMID:12754204)
• RYR2 mutations associated with ventricular tachycardia mediate increased calcium release in stimulated cardiomyocytes. (PMID:12919952)
• The RyR2 C-terminal tail may be important for the oligomeric assembly of the native channel. (PMID:12959641)
• the TM10 sequence constitutes an essential determinant for channel activation and gating; TM10 is an inner helix of RyR (PMID:14593104)
• there is a specific binding subdomain in RyR1 and RyR2 participating in RyR-RyR interaction (PMID:14722100)
• CaMKII-mediated phosphorylation of RyR2 at Ser-2815 may contribute to the enhanced contractility observed at higher heart rates. (PMID:15016728)
• This is the 1st evidence that RyRs directly control primary beta cell insulin secretion independently of glucose & by 2 mechanisms, including a novel cytosolic Ca2+-independent mechanism likely involving changes in Ca2+ in the lumens of non-ER organelles. (PMID:15033925)
• RyR2 activity seems to play an essential role in beta-cell survival in vitro by suppressing a death pathway mediated by calpain-10 (PMID:15044459)
• compelling evidence that specific interaction between cytoplasmic and transmembrane domains is an important mechanism in the intrinsic modulation of RyR Ca(2+) release channels (PMID:15047862)
• CLIC2 inhibited cardiac ryanodine receptor Ca2+ release channels in lipid bilayers when added to the cytoplasmic side of the channels and inhibited Ca2+ release from cardiac sarcoplasmic reticulum vesicles (PMID:15147738)
• 3 mutations (P2328S, Q4201R, & V4653F)had decreased FKBP12.6 binding, that stabilizes the channel’s closed state. After PKA phosphorylation, mutant channels had a gain-of-function defect (leaky Ca2+ release) & a rightward shift in the Mg2+ IC50. (PMID:15197150)
• five non-conserved amino acids in the C-terminal region flanking the CaM-binding domain have a key role in CaM inhibition of RyR2 (PMID:15215235)
• 9 new RYR2 mutations were found among people with long-QT syndrome revealed by swimming-triggered arrhythmias. (PMID:15466642)
• novel interaction site for FKBP12.6 may be present at the RyR2 C terminus, proximal to the channel pore, a sterically appropriate location that would enable this protein to play a central role in the modulation of this critical ion channel (PMID:15591045)
• The R2401H mutation can be expected to alter Ca-induced Ca release and E-C coupling resulting in CPVT. (PMID:15749201)
• Atrial tissue from both dogs and humans with chronic atrial fibrillation showed a significant increase in PKA phosphorylation of RyR2, with a corresponding decrease in calstabin2 binding to the channel (PMID:15851612)
• RyR2-encoded cardiac ryanodine receptor/calcium release channel mutations are responsible for catecholaminergic polymorphic ventricular tachycardia (CPVT)- a novel pathogenic basis for unexplained drownings. (PMID:15887426)
• Putative pathogenic type 1 catecholaminergic polymorphic ventricular tachycardia-causing mutations in RyR2 were detected in 6% of unrelated, genotype-negative long QT syndrome referrals. (PMID:16188589)
• RYR2 mutations may have a role in catecholaminergic polymorphic ventricular tachycardia (PMID:16272262)
• Ser-2030, but not Ser-2808, is the major PKA phosphorylation site in RyR2 responding to PKA activation upon beta-adrenergic stimulation in both normal and failing hearts, and that RyR2 is not hyperphosphorylated by PKA in heart failure. (PMID:16483256)
• Intracellular Ca2+ cycling in normal heart relies on intricate interplay of CASQ2 with proteins of RyR2 channel complex, and disruption of these interactions can lead to cardiac arrhythmia. (PMID:16601229)
• Putative CPVT1-causing mutations in RyR2 were seen in <40% of unrelated patients referred with a diagnosis of CPVT and preferentially in males. (PMID:16818210)
• The knock-in mouse harboring the RyR2 R4497C mutation(also found in patients with familial sudden death) cause cardiac arrhythmias through delayed afterdepolarization and triggered activity due to altered intracellular calcium handling. (PMID:16825580)
• Cardiac RyR2 plasmids with various CPVT mutations enable expression and analysis of Ca2+ release mediated by the wild-type and mutated RyR2. (PMID:17052226)
• Postmortem molecular screening of the RyR2 gene could be useful for investigation for cause of death in sudden unexplained death (SUD). The possible association of the RyR2 mutation with status thymico-lymphaticus is discussed. (PMID:17062961)
• the redox state of the RyR is intimately connected with FKBP binding affinity. (PMID:17200109)
• together, our results demonstrate that RyR1 differs markedly from RyR2 with respect to their responses to Ca(2+) overload and luminal Ca(2+). (PMID:17259277)
• Data show that K201 abolished spontaneous calcium release in cardiac myocytes, and that treating ventricular myocytes with FK506 to dissociate FKBP12.6 from ryanodine receptor RyR2 did not affect the suppression of spontaneous Ca2+ release by K201. (PMID:17313373)
• We provide the first evidence that RyR2 splice variants exquisitely modulate intracellular Ca(2+) signaling and are key determinants of cardiomyocyte apoptotic susceptibility. (PMID:17322175)
• P2X(7) receptor has an antiapoptotic function in melanoma cells (PMID:17330843)
• Finds a link between RyR2 mutations and the alterations of ion channels that may trigger cardiac arrhythmias associated with SIDS. (PMID:17556193)
• No disease-causing mutations in the RyR2 were found in Finish patients with sporadic arrhythmogenic right ventricular cardiomyopathy; an allelic variant A1136V was found in patients and health controls. (PMID:17558603)
• PKA-dependent phosphorylation enhances the response of RyR2 to luminal Ca(2+) and reduces the threshold for SOICR and this effect of PKA is largely mediated by phosphorylation at Ser-2,030 (PMID:17693412)
• large genomic deletion in RYR2 leads to extended clinical phenotypes eg, sinoatrial node and atrioventricular node dysfunction, atrial fibrillation, atrial standstill, and dilated cardiomyopathy (PMID:17875969)
• the loss of FKBP12.6 has no significant effect on the conduction and activation of RyR2 or the propensity for spontaneous Ca(2+) release and stress-induced ventricular arrhythmias (PMID:17921453)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	ryr2a	ENSDARG00000098856
mus_musculus	Ryr2	ENSMUSG00000021313
rattus_norvegicus	Ryr2	ENSRNOG00000017060
drosophila_melanogaster	RyR	FBGN0011286
caenorhabditis_elegans		WBGENE00006801

Paralogs (5): ITPR3 (ENSG00000096433), ITPR2 (ENSG00000123104), ITPR1 (ENSG00000150995), RYR1 (ENSG00000196218), RYR3 (ENSG00000198838)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:99685) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 85 distinct phenotype terms.

Mouse phenotype (MP)	Records
abnormal myocardial fiber physiology	11
decreased heart rate	9
ventricular tachycardia	7
irregular heartbeat	5
ventricular premature beat	4
abnormal myocardial fiber morphology	3
ventricular fibrillation	3
increased susceptibility to induced morbidity/mortality	3
abnormal cardiovascular system physiology	2
premature death	2
increased heart rate	2
increased susceptibility to pharmacologically induced seizures	2
abnormal heart left ventricle morphology	2
abnormal sarcoplasmic reticulum morphology	2
increased response of heart to induced stress	2
abnormal brain wave pattern	2
decreased cardiac muscle contractility	2
cardiomyopathy	2
increased physiological sensitivity to xenobiotic	2
atrioventricular block	2
prenatal lethality, complete penetrance	2
embryonic lethality, complete penetrance	2
embryonic lethality during organogenesis, complete penetrance	2
ventricular arrhythmia	2
polymorphic ventricular tachycardia	2

+60 more (showing top 25).

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Pongo abelii	Q5R881	99.8%	Diamond
Macaca fascicularis	Q95LP3	99.3%	Diamond
Oryctolagus cuniculus	P30957	98.4%	Diamond
Bos taurus	Q8WN96	97.3%	Diamond
Sus scrofa	P16960	95.8%	Diamond
Arabidopsis thaliana	Q9SIZ8	39.4%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
MIR4428	ncRNA	100616141
ZP4	protein-coding	57829
MT1HL1	protein-coding	645745

Protein

Protein identifiers

Ryanodine receptor 2 — Q92736 (reviewed: Q92736)

Alternative names: Cardiac muscle ryanodine receptor, Cardiac muscle ryanodine receptor-calcium release channel, Type 2 ryanodine receptor

All UniProt accessions (9): A0A590UJF6, A0A590UJZ8, A0A590UK06, A0A590UKB7, A0AAQ5BHA4, A0AAQ5BHB1, A0AAQ5BHB3, A0AAQ5BHC6, Q92736

UniProt curated annotations — full annotation on UniProt →

Function. Cytosolic calcium-activated calcium channel that mediates the release of Ca(2+) from the sarcoplasmic reticulum into the cytosol and thereby plays a key role in triggering cardiac muscle contraction. Aberrant channel activation can lead to cardiac arrhythmia. In cardiac myocytes, calcium release is triggered by increased Ca(2+) cytosolic levels due to activation of the L-type calcium channel CACNA1C. The calcium channel activity is modulated by formation of heterotetramers with RYR3. Required for cellular calcium ion homeostasis. Required for embryonic heart development.

Subunit / interactions. Homotetramer. Can also form heterotetramers with RYR1 and RYR3. Interacts with FKBP1A and FKBP1B; these interactions may stabilize the channel in its closed state and prevent Ca(2+) leaks. Interacts with CALM and S100A1; these interactions regulate channel activity. Identified in a complex composed of RYR2, FKBP1B, PKA catalytic subunit, PRKAR2A, AKAP6, and the protein phosphatases PP2A and PP1. Interacts directly with FKBP1B, PKA, PP1 and PP2A. Interacts with SELENON. In cardiac muscles, identified in a complex, composed of FSD2, CMYA5 and RYR2. Interacts with PKD2 (via N-terminus); regulates RYR2 channel activity.

Subcellular location. Sarcoplasmic reticulum membrane.

Tissue specificity. Detected in heart muscle (at protein level). Heart muscle, brain (cerebellum and hippocampus) and placenta.

Post-translational modifications. Channel activity is modulated by phosphorylation. Phosphorylation at Ser-2808 and Ser-2814 increases the open probability of the calcium channel. Phosphorylation is increased in failing heart, leading to calcium leaks and increased cytoplasmic Ca(2+) levels. Phosphorylation at Ser-2031 by PKA enhances the response to lumenal calcium.

Disease relevance. Ventricular tachycardia, catecholaminergic polymorphic, 1, with or without atrial dysfunction and/or dilated cardiomyopathy (CPVT1) [MIM:604772] An arrhythmogenic disorder characterized by stress-induced, bidirectional ventricular tachycardia that may degenerate into cardiac arrest and cause sudden death. Patients present with recurrent syncope, seizures, or sudden death after physical activity or emotional stress. CPVT1 inheritance is autosomal dominant. The disease is caused by variants affecting the gene represented in this entry. Ventricular arrhythmias due to cardiac ryanodine receptor calcium release deficiency syndrome (VACRDS) [MIM:115000] An autosomal dominant arrhythmogenic disorder characterized by syncope, cardiac arrest and/or sudden unexpected death, often in association with physical exertion or acute emotional stress. Patients who survive manifest polymorphic ventricular tachycardia and ventricular fibrillation. Unlike typical catecholaminergic ventricular tachycardia, arrhythmias are not reproducible on exercise stress testing or adrenaline challenge. The disease is caused by variants affecting the gene represented in this entry.

Activity regulation. The calcium release is activated by increased cytosolic calcium levels, by nitric oxyde (NO), caffeine and ATP. Channel activity is modulated by the alkaloid ryanodine that binds to the open Ca-release channel with high affinity. At low concentrations, ryanodine maintains the channel in an open conformation. High ryanodine concentrations inhibit channel activity. Channel activity is regulated by calmodulin (CALM). Channel activity is inhibited by magnesium ions, possibly by competition for calcium binding sites.

Domain organisation. The calcium release channel activity resides in the C-terminal region while the remaining part of the protein resides in the cytoplasm.

Induction. By TGFB1.

Similarity. Belongs to the ryanodine receptor (TC 1.A.3.1) family. RYR2 subfamily.

Isoforms (2)

UniProt ID	Names	Canonical?
Q92736-1	1	yes
Q92736-2	2

RefSeq proteins (1): NP_001026* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000699	RIH_dom	Domain
IPR001870	B30.2/SPRY	Domain
IPR002048	EF_hand_dom	Domain
IPR003032	Ryanodine_rcpt	Domain
IPR003877	SPRY_dom	Domain
IPR005821	Ion_trans_dom	Domain
IPR009460	Ryanrecept_TM4-6	Domain
IPR011992	EF-hand-dom_pair	Homologous_superfamily
IPR013320	ConA-like_dom_sf	Homologous_superfamily
IPR013333	Ryan_recept	Family
IPR013662	RIH_assoc-dom	Domain
IPR014821	Ins145_P3_rcpt	Domain
IPR015925	Ryanodine_IP3_receptor	Family
IPR016093	MIR_motif	Domain
IPR035761	SPRY1_RyR	Domain
IPR035762	SPRY3_RyR	Domain
IPR035764	SPRY2_RyR	Domain
IPR035910	RyR/IP3R_RIH_dom_sf	Homologous_superfamily
IPR036300	MIR_dom_sf	Homologous_superfamily
IPR043136	B30.2/SPRY_sf	Homologous_superfamily
IPR048581	RYDR_Jsol	Domain

Pfam: PF00520, PF00622, PF01365, PF02026, PF02815, PF06459, PF08454, PF08709, PF13499, PF21119

Catalyzed reactions (Rhea)

• Ca(2+)(in) = Ca(2+)(out) (RHEA:29671)

UniProt features (565 total): helix 247, strand 145, turn 65, sequence variant 53, modified residue 10, mutagenesis site 9, domain 8, transmembrane region 6, region of interest 6, repeat 4, compositionally biased region 4, topological domain 2, sequence conflict 2, chain 1, coiled-coil region 1, splice variant 1, intramembrane region 1

Structure

Experimental structures (PDB)

26 structures by resolution:

PDB	Title	Method	Resolution (Å)
7KL5	Structure of Calmodulin Bound to the Cardiac Ryanodine Receptor (RyR2) at Residues: …	X-RAY DIFFRACTION	1.65
6Y4O	Calmodulin bound to cardiac ryanodine receptor (RyR2) calmodulin binding domain	X-RAY DIFFRACTION	1.84
6Y4P	Calmodulin N53I variant bound to cardiac ryanodine receptor (RyR2) calmodulin binding …	X-RAY DIFFRACTION	2.13
4JKQ	Crystal structure of the N-terminal region of the human ryanodine receptor 2	X-RAY DIFFRACTION	2.39
7U9X	Structure of PKA phosphorylated human RyR2-R2474S in the closed state	ELECTRON MICROSCOPY	2.58
7U9T	Structure of PKA phosphorylated human RyR2 in the closed state in the presence of …	ELECTRON MICROSCOPY	2.68
7UA5	Structure of dephosphorylated human RyR2 in the closed state	ELECTRON MICROSCOPY	2.83
8UXC	Structure of PKA phosphorylated human RyR2-R420Q in the primed state	ELECTRON MICROSCOPY	2.86
7UA4	Structure of PKA phosphorylated human RyR2-R2474S in the open state in the presence of …	ELECTRON MICROSCOPY	2.93
7UA3	Structure of PKA phosphorylated human RyR2-R2474S in the closed state in the presence of …	ELECTRON MICROSCOPY	2.97
8UQ2	Structure of human RyR2-S2808D in the subprimed state	ELECTRON MICROSCOPY	2.98
7UA1	Structure of PKA phosphorylated human RyR2-R2474S in the closed state in the presence of …	ELECTRON MICROSCOPY	2.99
8UXG	Structure of PKA phosphorylated human RyR2-R420W in the closed state in the presence of …	ELECTRON MICROSCOPY	3.08
7U9Q	Structure of PKA phosphorylated human RyR2 in the closed state	ELECTRON MICROSCOPY	3.11
8UXL	Structure of PKA phosphorylated human RyR2-R420W in the primed state in the presence of …	ELECTRON MICROSCOPY	3.12
8UXF	Structure of PKA phosphorylated human RyR2-R420W in the primed state	ELECTRON MICROSCOPY	3.13
8UQ3	Structure of human RyR2-S2808D in the closed state in the presence of ARM210	ELECTRON MICROSCOPY	3.18
7U9Z	Structure of PKA phosphorylated human RyR2-R2474S in the open state	ELECTRON MICROSCOPY	3.29
8UXI	Structure of PKA phosphorylated human RyR2-R420W in the open state in the presence of …	ELECTRON MICROSCOPY	3.29
8UXH	Structure of PKA phosphorylated human RyR2-R420W in the primed state in the presence of …	ELECTRON MICROSCOPY	3.52
8UXE	Structure of PKA phosphorylated human RyR2-R420Q in the closed state in the presence of …	ELECTRON MICROSCOPY	3.53
8UXM	Structure of PKA phosphorylated human RyR2-R420W in the open state in the presence of …	ELECTRON MICROSCOPY	3.56
7UA9	Structure of dephosphorylated human RyR2 in the open state	ELECTRON MICROSCOPY	3.59
8UQ4	Structure of human RyR2-S2808D in the subprimed state in the presence of H2O2/NOC-12/GSH	ELECTRON MICROSCOPY	3.64
7U9R	Structure of PKA phosphorylated human RyR2 in the open state	ELECTRON MICROSCOPY	3.69
8UQ5	Structure of human RyR2-S2808D in the primed state in the presence of Rapamycin	ELECTRON MICROSCOPY	3.96

Predicted structure (AlphaFold)

No AlphaFold model available for Q92736 — AlphaFold DB does not currently provide models for proteins above ~3000 aa.

Human Protein Atlas

Protein class: Transporters, Transporter channels and pores, Predicted membrane proteins, Predicted intracellular proteins, Plasma proteins, Disease related genes, FDA approved drug targets, Small molecule drugs, Human disease related genes

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): plasma membrane; cytosol; nucleoplasm

Antibody reliability (HPA): IH approved · IF uncertain

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (10)

Type	Positions
Phosphoserine	1341, 1869, 2031, 2369, 2697, 2797, 2808, 2811, 2814, 2947

Mutagenesis-validated functional residues (9)

Position	Phenotype
3995	decreased function in release of sequestered calcium ion into cytosol by sarcoplasmic reticulum. changed ryanodine-sensitive …
4108	changed ryanodine-sensitive calcium-release channel activity characterized by increased sensitivity to cytosolic calcium activation.
4112	decreased function in release of sequestered calcium ion into cytosol by sarcoplasmic reticulum. changed ryanodine-sensitive …
4855	decreased function in release of sequestered calcium ion into cytosol by sarcoplasmic reticulum. changed ryanodine-sensitive …
4879	decreased function in release of sequestered calcium ion into cytosol by sarcoplasmic reticulum. changed ryanodine-sensitive …
2808	abolishes phosphorylation by pka.
3946	changed ryanodine-sensitive calcium-release channel activity characterized by increased sensitivity to cytosolic calcium activation.
3978	changed ryanodine-sensitive calcium-release channel activity characterized by increased sensitivity to cytosolic calcium activation.

Function

Pathways and Gene Ontology

Reactome pathways

2 curated (TAS) of 6; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

6 pathways:

ID	Pathway	Evidence
R-HSA-5578775	Ion homeostasis	curated
R-HSA-2672351	Stimuli-sensing channels	curated
R-HSA-5576891	Cardiac conduction	—
R-HSA-983712	Ion channel transport	—
R-HSA-397014	Muscle contraction	—
R-HSA-382551	Transport of small molecules	—

MSigDB gene sets: 377 (showing top): GOBP_CARDIAC_CHAMBER_DEVELOPMENT, GOBP_MORPHOGENESIS_OF_AN_EPITHELIUM, GOBP_RESPONSE_TO_NITROGEN_COMPOUND, GOBP_EPITHELIUM_DEVELOPMENT, GOBP_POSITIVE_REGULATION_OF_SEQUESTERING_OF_CALCIUM_ION, MODY_HIPPOCAMPUS_POSTNATAL, GOBP_MUSCLE_TISSUE_DEVELOPMENT, GOBP_RESPONSE_TO_MUSCLE_STRETCH, GOBP_CIRCULATORY_SYSTEM_PROCESS, GOBP_CARDIAC_LEFT_VENTRICLE_MORPHOGENESIS, GOBP_CARDIAC_CHAMBER_MORPHOGENESIS, GOBP_ESTABLISHMENT_OF_PROTEIN_LOCALIZATION_TO_ENDOPLASMIC_RETICULUM, GOBP_ESTABLISHMENT_OF_PROTEIN_LOCALIZATION_TO_ORGANELLE, CTATGCA_MIR153, GOBP_REGULATION_OF_CARDIAC_MUSCLE_CONTRACTION_BY_REGULATION_OF_THE_RELEASE_OF_SEQUESTERED_CALCIUM_ION

GO Biological Process (46): response to hypoxia (GO:0001666), regulation of heart rate (GO:0002027), embryonic heart tube morphogenesis (GO:0003143), left ventricular cardiac muscle tissue morphogenesis (GO:0003220), cardiac muscle hypertrophy (GO:0003300), detection of calcium ion (GO:0005513), calcium ion transport (GO:0006816), intracellular calcium ion homeostasis (GO:0006874), striated muscle contraction (GO:0006941), positive regulation of heart rate (GO:0010460), regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881), regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882), release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808), response to muscle activity (GO:0014850), calcium-mediated signaling (GO:0019722), response to caffeine (GO:0031000), response to muscle stretch (GO:0035994), release of sequestered calcium ion into cytosol (GO:0051209), regulation of cytosolic calcium ion concentration (GO:0051480), response to redox state (GO:0051775), regulation of cardiac muscle contraction (GO:0055117), cardiac muscle contraction (GO:0060048), calcium ion transport into cytosol (GO:0060402), sarcoplasmic reticulum calcium ion transport (GO:0070296), cellular response to caffeine (GO:0071313), cellular response to epinephrine stimulus (GO:0071872), ventricular cardiac muscle cell action potential (GO:0086005), Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029), cell communication by electrical coupling involved in cardiac conduction (GO:0086064), type B pancreatic cell apoptotic process (GO:0097050), positive regulation of the force of heart contraction (GO:0098735), regulation of AV node cell action potential (GO:0098904), regulation of SA node cell action potential (GO:0098907), regulation of atrial cardiac muscle cell action potential (GO:0098910), regulation of ventricular cardiac muscle cell action potential (GO:0098911), monoatomic ion transport (GO:0006811), response to nutrient (GO:0007584), response to xenobiotic stimulus (GO:0009410), response to magnesium ion (GO:0032026), monoatomic ion transmembrane transport (GO:0034220), negative regulation of cytosolic calcium ion concentration (GO:0051481), response to calcium ion (GO:0051592), transmembrane transport (GO:0055085), calcium ion transmembrane transport (GO:0070588), manganese ion transmembrane transport (GO:0071421), calcium ion export (GO:1901660)

GO Molecular Function (16): ryanodine-sensitive calcium-release channel activity (GO:0005219), calcium channel activity (GO:0005262), calcium ion binding (GO:0005509), calmodulin binding (GO:0005516), intracellularly gated calcium channel activity (GO:0015278), enzyme binding (GO:0019899), protein kinase A catalytic subunit binding (GO:0034236), protein kinase A regulatory subunit binding (GO:0034237), identical protein binding (GO:0042802), suramin binding (GO:0043924), transmembrane transporter binding (GO:0044325), calcium-induced calcium release activity (GO:0048763), monoatomic ion channel activity (GO:0005216), protein binding (GO:0005515), protein kinase binding (GO:0019901), scaffold protein binding (GO:0097110)

GO Cellular Component (14): smooth endoplasmic reticulum (GO:0005790), plasma membrane (GO:0005886), junctional sarcoplasmic reticulum membrane (GO:0014701), membrane (GO:0016020), sarcoplasmic reticulum (GO:0016529), Z disc (GO:0030018), protein-containing complex (GO:0032991), sarcoplasmic reticulum membrane (GO:0033017), calcium channel complex (GO:0034704), sarcolemma (GO:0042383), nuclear envelope (GO:0005635), sarcomere (GO:0030017), extrinsic component of cytoplasmic side of plasma membrane (GO:0031234), A band (GO:0031672)

Reactome top-level categories

4 top-level categories:

Category	Pathways
Ion channel transport	1
Cardiac conduction	1
Muscle contraction	1
Transport of small molecules	1

GO top-level categories

showing 60 of 72 GO namespaces:

Category	Terms
protein binding	5
cellular anatomical structure	4
protein kinase A binding	2
endoplasmic reticulum	2
response to stress	1
response to decreased oxygen levels	1
regulation of heart contraction	1
regulation of biological quality	1
heart morphogenesis	1
embryonic heart tube development	1
embryonic organ morphogenesis	1
embryonic morphogenesis	1
epithelial tube morphogenesis	1
cardiac left ventricle morphogenesis	1
ventricular cardiac muscle tissue morphogenesis	1
striated muscle hypertrophy	1
detection of chemical stimulus	1
response to calcium ion	1
metal ion transport	1
intracellular monoatomic cation homeostasis	1
calcium ion homeostasis	1
muscle contraction	1
regulation of heart rate	1
positive regulation of heart contraction	1
regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum	1
regulation of cardiac muscle contraction by calcium ion signaling	1
calcium-mediated signaling	1
regulation of cardiac muscle contraction	1
cardiac muscle contraction	1
sarcoplasmic reticulum calcium ion transport	1
release of sequestered calcium ion into cytosol by endoplasmic reticulum	1
response to activity	1
intracellular signaling cassette	1
response to purine-containing compound	1
response to alkaloid	1
response to mechanical stimulus	1
calcium ion transmembrane import into cytosol	1
intracellular calcium ion homeostasis	1
response to stimulus	1
calcium-induced calcium release activity	1
monoatomic cation channel activity	1
calcium ion transmembrane transporter activity	1
metal ion binding	1
intracellularly ligand-gated monoatomic ion channel activity	1
ligand-gated calcium channel activity	1
protein kinase binding	1
anion binding	1
organic acid binding	1
sulfur compound binding	1
intracellularly gated calcium channel activity	1
monoatomic ion transmembrane transporter activity	1
channel activity	1
binding	1
kinase binding	1
membrane	1
cell periphery	1
sarcoplasmic reticulum membrane	1
sarcoplasm	1
I band	1
cellular_component	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 36 of 76 annotations. The rest are phylogenetic / computational / electronic (IEA).

36 experimentally-supported GO terms:

GO term	NS	Evidence
calcium ion transport	BP	direct assay
calcium ion transport into cytosol	BP	direct assay
calcium-mediated signaling	BP	direct assay
cardiac muscle contraction	BP	mutant phenotype
cellular response to caffeine	BP	direct assay
detection of calcium ion	BP	direct assay
positive regulation of the force of heart contraction	BP	mutant phenotype
regulation of AV node cell action potential	BP	mutant phenotype
regulation of SA node cell action potential	BP	mutant phenotype
regulation of atrial cardiac muscle cell action potential	BP	mutant phenotype
regulation of cardiac muscle contraction	BP	mutant phenotype
regulation of cardiac muscle contraction by calcium ion signaling	BP	mutant phenotype
regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion	BP	direct assay
regulation of heart rate	BP	mutant phenotype
regulation of ventricular cardiac muscle cell action potential	BP	mutant phenotype
release of sequestered calcium ion into cytosol	BP	direct assay
release of sequestered calcium ion into cytosol by sarcoplasmic reticulum	BP	direct assay
response to caffeine	BP	direct assay
response to muscle activity	BP	mutant phenotype
response to muscle stretch	BP	mutant phenotype
response to redox state	BP	direct assay
type B pancreatic cell apoptotic process	BP	mutant phenotype
Z disc	CC	direct assay
calcium channel complex	CC	direct assay
membrane	CC	direct assay
protein-containing complex	CC	direct assay
sarcoplasmic reticulum	CC	direct assay
calcium-induced calcium release activity	MF	direct assay
calmodulin binding	MF	direct assay
enzyme binding	MF	physical interaction
identical protein binding	MF	physical interaction
intracellularly gated calcium channel activity	MF	direct assay
protein kinase A catalytic subunit binding	MF	direct assay
protein kinase A regulatory subunit binding	MF	direct assay
ryanodine-sensitive calcium-release channel activity	MF	direct assay
suramin binding	MF	mutant phenotype

Protein interactions and networks

STRING

showing 15 of 2,770 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
RYR2	FKBP1B	P68106	970
RYR2	TRDN	Q13061	950
RYR2	CASQ2	O14958	949
RYR2	ASPH	Q12797	927
RYR2	ATP2A2	P16614	855
RYR2	SCN5A	Q14524	852
RYR2	TMEM43	Q9BTV4	823
RYR2	CACNA1C	Q13936	807
RYR2	JPH2	Q9BR39	804
RYR2	JUP	P14923	799
RYR2	PKP2	Q99959	795
RYR2	DNAH8	Q96JB1	795
RYR2	AKAP6	Q13023	789
RYR2	TTN	Q8WZ42	786
RYR2	PRKACA	P17612	781

IntAct

Human interaction partners of RYR2 in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

11 partners by confidence:

Partner	Interaction type	MIscore	Records
FKBP1B	proximity	0.720	5
MDM2	physical association	0.520	2
MAP1LC3B	direct interaction	0.440	1
CAMK2D	physical association	0.400	1
FKBP1A	physical association	0.400	1
GOLGA2	physical association	0.400	1
PRKACA	physical association	0.400	1
HSPB2	physical association	0.370	1
SMAD5	physical association	0.370	1
AKAP6	colocalization	0.270	1
BIN1	physical association	0.000	1

BioGRID (73 interactions; top human partners by supporting records): RYR1 (Reconstituted Complex; 4 records), FKBP1B (Affinity Capture-Western; 3 records), SRI (Affinity Capture-Western; 3 records), UBE2C (Affinity Capture-Western; 3 records), AKAP6 (Co-fractionation; 2 records), CALM1 (Affinity Capture-Western; 2 records), GRIN2B (Affinity Capture-Western; 2 records), PRKACA (Biochemical Activity; 2 records), PRKACB (Biochemical Activity; 2 records), PRKACG (Biochemical Activity; 2 records), RPL13A (Cross-Linking-MS (XL-MS); 2 records), RYR3 (Affinity Capture-Western; 2 records), ABLIM3 (Cross-Linking-MS (XL-MS)), ALB (Affinity Capture-MS), ARL2 (Proximity Label-MS)

SIGNOR signaling

2 signaling interactions:

A	Effect	B	Mechanism
SPEG	“down-regulates activity”	RYR2	phosphorylation
PRKACA	“up-regulates activity”	RYR2	phosphorylation

Protein complexes (CORUM) (1)

Experimentally-characterized complexes this protein is a subunit of (★ = the complex contains a known drug target).

1 complexes by size:

Complex	Subunits	Members
★ RYR2 homotetramer	1	RYR2

Disease & clinical

Genetic variants

Variant evidence for RYR2: 9,498 ClinVar records (214 pathogenic / likely pathogenic); 2 PharmGKB clinical annotations; 22 GWAS associations. Per-variant detail is on Sugi Variant.

ClinVar

9,498 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	73
Likely pathogenic	141
Uncertain significance	4690
Likely benign	3297
Benign	368

Top pathogenic / likely-pathogenic (15)

Showing the 15 best-reviewed of 214 pathogenic / likely-pathogenic ClinVar records, ranked by ClinVar review status (expert panel → multiple submitters → single submitter), then by number of submitting labs.

Variant ID	HGVS	Classification	Review	Submitters
201214	NM_001035.3(RYR2):c.1258C>T (p.Arg420Trp)	Pathogenic	criteria provided, multiple submitters, no conflicts	13
519533	NM_001035.3(RYR2):c.1069G>A (p.Gly357Ser)	Pathogenic	criteria provided, multiple submitters, no conflicts	9
12957	NM_001035.3(RYR2):c.13489C>T (p.Arg4497Cys)	Pathogenic	criteria provided, multiple submitters, no conflicts	7
201194	NM_001035.3(RYR2):c.527G>A (p.Arg176Gln)	Pathogenic	criteria provided, multiple submitters, no conflicts	7
201357	NM_001035.3(RYR2):c.14311G>A (p.Val4771Ile)	Pathogenic	criteria provided, multiple submitters, no conflicts	7
12954	NM_001035.3(RYR2):c.6737C>T (p.Ser2246Leu)	Pathogenic	criteria provided, multiple submitters, no conflicts	6
201315	NM_001035.3(RYR2):c.11836G>A (p.Gly3946Ser)	Pathogenic	criteria provided, multiple submitters, no conflicts	6
12959	NM_001035.3(RYR2):c.1298T>C (p.Leu433Pro)	Pathogenic	criteria provided, multiple submitters, no conflicts	4
12960	NM_001035.3(RYR2):c.6982C>T (p.Pro2328Ser)	Pathogenic	criteria provided, multiple submitters, no conflicts	4
12961	NM_001035.3(RYR2):c.13957G>T (p.Val4653Phe)	Pathogenic	criteria provided, multiple submitters, no conflicts	4
201188	NM_001035.3(RYR2):c.11814C>A (p.Ser3938Arg)	Pathogenic	criteria provided, multiple submitters, no conflicts	2
201330	NM_001035.3(RYR2):c.12372C>A (p.Ser4124Arg)	Pathogenic	criteria provided, multiple submitters, no conflicts	2
449306	NM_001035.3(RYR2):c.14864G>A (p.Gly4955Glu)	Pathogenic	criteria provided, multiple submitters, no conflicts	2
957942	NM_001035.3(RYR2):c.6649C>T (p.His2217Tyr)	Pathogenic	criteria provided, multiple submitters, no conflicts	2
1072597	NM_001035.3(RYR2):c.7421G>A (p.Arg2474Lys)	Pathogenic	criteria provided, multiple submitters, no conflicts	2

Per-variant reference — Sugi Variant

Explore RYR2’s pathogenic and likely-pathogenic variants individually — each with its ClinVar classification and conditions, applied ACMG criteria (ClinGen expert panel, where curated), the calibrated in-silico predictors (AlphaMissense, REVEL, SaProt, conservation), gnomAD frequency, and the predictor-disagreement QC signal — on Sugi Variant.

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 31 predictions of 11,414):

Position(s)	Effect	Δscore	Sites
1:237270492	acceptor_gain	1.0000
1:237270495–237270496	acceptor_loss	1.0000	3
1:237270496	acceptor_gain	1.0000
1:237369531	acceptor_gain	1.0000
1:237369532–237369533	acceptor_loss	1.0000	6
1:237369609–237369610	donor_loss	1.0000	5
1:237377304–237377306	acceptor_gain	1.0000	2
1:237386932	donor_gain	1.0000
1:237388184–237388185	donor_loss	1.0000	5
1:237441317–237441318	acceptor_loss	1.0000	6

AlphaMissense

6,100 missense substitutions predicted likely pathogenic (of 32,953 scored), across 1,389 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
M935	9	0.992	1.000
H890	8	0.999	1.000
H1004	8	0.999	1.000
N1002	8	0.998	1.000
H915	8	0.996	1.000
F207	8	0.992	1.000
N888	8	0.992	1.000
D1039	8	0.990	0.998
D910	8	0.986	0.999
H299	8	0.985	0.997
F489	8	0.983	0.998
N932	8	0.983	1.000
D179	8	0.982	0.997
N1046	8	0.980	1.000
D401	8	0.977	0.994
F768	8	0.975	0.999
F13	8	0.973	0.999
D400	8	0.973	0.993
F862	8	0.973	0.999
S1049	8	0.973	1.000

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Disease associations

OMIM: gene MIM:180902 | disease phenotypes: MIM:600996, MIM:604772, MIM:115000, MIM:611938, MIM:115080

GenCC curated gene-disease

6 curated gene-disease records:

Disease	Classification	Inheritance	Records
arrhythmogenic right ventricular dysplasia 2	Definitive	Autosomal dominant	2
catecholaminergic polymorphic ventricular tachycardia	Definitive	Autosomal dominant
catecholaminergic polymorphic ventricular tachycardia 1	Strong	Autosomal dominant	2
hypertrophic cardiomyopathy	Limited	Autosomal dominant
familial hypertrophic cardiomyopathy	Limited	Autosomal dominant
arrhythmogenic right ventricular cardiomyopathy	Refuted Evidence	Autosomal dominant	2

ClinGen Gene-Disease Validity

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

4 validity classifications:

Disease	Classification	Inheritance
catecholaminergic polymorphic ventricular tachycardia	Definitive	AD
hypertrophic cardiomyopathy	Limited	AD
arrhythmogenic right ventricular cardiomyopathy	Refuted	AD
dilated cardiomyopathy	Limited	AD

Genomics England panels (PanelApp)

Clinical diagnostic gene panels including this gene (12 panels, 6 green/diagnostic-grade). Confidence: green = diagnostic, amber = moderate.

12 panels:

Panel	Rating
Cardiac arrhythmias	green
Catecholaminergic polymorphic VT	green
Dilated and arrhythmogenic cardiomyopathy	green
Idiopathic ventricular fibrillation	green
Paediatric or syndromic cardiomyopathy	green
Sudden unexplained death or survivors of a cardiac event	green
Early onset or syndromic epilepsy	amber
Hypotonic infant	amber
Intellectual disability	amber
Leukodystrophy, childhood onset	amber
Paediatric disorders	amber
Unexplained death in infancy and sudden unexplained death in childhood	amber

Mondo (14): catecholaminergic polymorphic ventricular tachycardia 1 (MONDO:0011484), catecholaminergic polymorphic ventricular tachycardia (MONDO:0017990), ventricular arrhythmias due to cardiac ryanodine receptor calcium release deficiency syndrome (MONDO:0020745), cardiomyopathy (MONDO:0004994), long QT syndrome (MONDO:0002442), arrhythmogenic right ventricular cardiomyopathy (MONDO:0016587), ventricular fibrillation (MONDO:0000190), childhood-onset schizophrenia (MONDO:0957430), cardiac rhythm disease (MONDO:0007263), catecholaminergic polymorphic ventricular tachycardia 2 (MONDO:0012762), cardiac conduction defect (MONDO:0100042), (MONDO:0010975), hypertrophic cardiomyopathy (MONDO:0005045), familial hypertrophic cardiomyopathy (MONDO:0024573)

Orphanet (5): Catecholaminergic polymorphic ventricular tachycardia (Orphanet:3286), Rare cardiomyopathy (Orphanet:167848), Inherited arrhythmogenic cardiomyopathy (Orphanet:247), Childhood-onset schizophrenia (Orphanet:641496), Hereditary progressive cardiac conduction defect (Orphanet:871)

HPO phenotypes

22 phenotypes (HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0001250	Seizure
HP:0001279	Syncope
HP:0001644	Dilated cardiomyopathy
HP:0001645	Sudden cardiac death
HP:0001663	Ventricular fibrillation
HP:0001664	Torsade de pointes
HP:0001678	Atrioventricular block
HP:0003621	Juvenile onset
HP:0004756	Ventricular tachycardia
HP:0004757	Paroxysmal atrial fibrillation
HP:0004758	Effort-induced polymorphic ventricular tachycardia
HP:0006673	Reduced systolic function
HP:0006696	Polymorphic and polytopic ventricular extrasystoles
HP:0011462	Young adult onset
HP:0011463	Childhood onset
HP:0011664	Left ventricular noncompaction cardiomyopathy
HP:0011704	Sick sinus syndrome
HP:0025478	Atrial standstill
HP:0031628	Aborted sudden cardiac death
HP:0034039	Ventricular couplet
HP:0034040	Bidirectional ventricular tachycardia

GWAS associations

22 associations:

Study	Trait	p-value
GCST007325_150	General risk tolerance (MTAG)	3e-9
GCST008959_13	Lipid traits	5e-9
GCST010320_95	PR interval	7e-9
GCST010321_69	PR interval	7e-9
GCST006481_12	Lung function (FEV1)	4e-8
GCST006483_3	Lung function (FVC)	4e-8
GCST007325_15	General risk tolerance (MTAG)	4e-8
GCST001002_1	Cerivastatin-induced rhabdomyolysis	2e-7
GCST002321_6	Lipid traits	3e-7
GCST006483_4	Lung function (FVC)	3e-7
GCST007977_4	Postoperative stroke after cardiac surgery	6e-7
GCST000041_1	Hypertension	8e-7
GCST008810_29	Smoking initiation (ever regular vs never regular)	8e-7
GCST000464_2	Acute lymphoblastic leukemia (childhood)	2e-6
GCST001762_740	Obesity-related traits	2e-6
GCST009391_1776	Metabolite levels	2e-6
GCST012162_1	cognitive impairment (MMSE score) in Parkinson’s disease	3e-6
GCST000089_2	Exercise treadmill test traits	4e-6
GCST009260_3	Hippocampal volume	4e-6
GCST001692_15	Response to taxane treatment (docetaxel)	6e-6
GCST003135_2	Bipolar disorder and eating disorder	7e-6
GCST001762_235	Obesity-related traits	8e-6

EFO canonical traits (from GWAS)

14 canonical traits:

EFO ID	Trait name
EFO:0004328	exercise test
EFO:0003867	rhabdomyolysis
EFO:0004730	hormone measurement
EFO:0005134	amino acid measurement
EFO:0004530	triglyceride measurement
EFO:0004314	forced expiratory volume
EFO:0004312	vital capacity
EFO:0008579	risk-taking behaviour
EFO:0009951	response to surgery
EFO:0009956	post-operative stroke
EFO:0005670	smoking initiation
EFO:0005035	hippocampal volume
EFO:0010546	uridine measurement
EFO:0004462	PR interval

MeSH disease descriptors

7 disease descriptors:

Descriptor	Name	Tree numbers
D019571	Arrhythmogenic Right Ventricular Dysplasia	C14.240.400.145; C14.280.238.028; C14.280.400.145; C16.131.240.400.145
D009202	Cardiomyopathies	C14.280.238
D002312	Cardiomyopathy, Hypertrophic	C14.280.238.100; C14.280.484.048.750.070.160
D024741	Cardiomyopathy, Hypertrophic, Familial	C14.280.238.100.500; C14.280.484.048.750.070.160.500; C16.320.160
D008133	Long QT Syndrome	C14.280.067.565; C14.280.123.625; C16.131.240.400.715; C23.550.073.547
D014693	Ventricular Fibrillation	C14.280.067.922; C23.550.073.922
C563409	Arrhythmogenic Right Ventricular Dysplasia, Familial, 2 *(supp.)*

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL4403 (SINGLE PROTEIN)

Molecules with ChEMBL bioactivity

Phase ≥1, by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 64 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

1 molecules by phase:

Molecule	Name	Phase	Patents
CHEMBL2104951	ALADORIAN	2	64

PharmGKB: 1 entry (CPIC guideline: no)

PharmGKB clinical annotations

2 annotations by evidence level (1 strongest → 4):

Variant	Association	Level	Drugs	Phenotypes
rs2819742	Toxicity	3	cerivastatin	Rhabdomyolysis
rs2819742	Toxicity	3	atorvastatin;simvastatin	Cardiovascular Disease

PharmGKB variants

1 variants:

Variant	Genes	Level	Score	#Clin annots	Drugs
rs2819742	RYR2	3	0.50	2	atorvastatin;simvastatin;cerivastatin

PharmGKB variant annotations

Per-publication pharmacogenomic findings for this gene (significant associations).

2 published findings:

Variant	Drug(s)	Category	Finding	PMID
rs2819742	atorvastatin, simvastatin	Toxicity	Allele A is associated with increased likelihood of Muscular Diseases and Myalgia unspecified when exposed to atorvastatin or simvastatin in people with Cardiovascular Diseases as compared to allele G.	PMID:25753936
rs2819742	cerivastatin	Toxicity	Genotype AA is associated with decreased risk of Rhabdomyolysis when treated with cerivastatin as compared to genotype GG.	PMID:21386754

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: vgic — Ryanodine receptors (RyR)

Most potent curated ligand interactions (3 total), top 3:

Ligand	Action	Affinity	Parameter
ryanozole	Inhibition	7.89	pEC50
carvedilol	Inhibition	4.8	pIC50
VK-II-86	Inhibition	4.77	pIC50

Binding affinities (BindingDB)

5 measured of 6 human assays (6 total across all organisms); most potent 5 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value
CHEMBL5413930	EC50	10 nM
CHEMBL5409619	EC50	19 nM
CHEMBL5398491	EC50	82 nM
CHEMBL5435124	EC50	2700 nM
CHEMBL5437537	EC50	8170 nM

ChEMBL bioactivities

57 potent at pChembl≥5 of 57 total, top 50 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
7.99	EC50	10.2	nM	CHEMBL5413930
7.82	EC50	15	nM	ALADORIAN
7.73	EC50	18.6	nM	CHEMBL5409619
7.70	EC50	20	nM	CHEMBL3958409
7.60	EC50	25	nM	CHEMBL3958287
7.40	EC50	40	nM	CHEMBL3982028
7.40	EC50	40	nM	CHEMBL3933375
7.40	EC50	40	nM	CHEMBL3965149
7.36	EC50	44	nM	CHEMBL3984280
7.36	EC50	44	nM	CHEMBL3980215
7.35	EC50	45	nM	CHEMBL3894901
7.30	EC50	50	nM	CHEMBL3928727
7.28	EC50	52	nM	CHEMBL3892168
7.26	EC50	55	nM	CHEMBL3952083
7.26	EC50	55	nM	CHEMBL3962505
7.22	EC50	60	nM	CHEMBL3955655
7.17	EC50	68	nM	CHEMBL3954061
7.14	EC50	73	nM	CHEMBL3943880
7.11	EC50	77	nM	CHEMBL3970844
7.10	EC50	80	nM	CHEMBL3957737
7.10	EC50	80	nM	CHEMBL3893618
7.09	EC50	81	nM	CHEMBL3953088
7.09	EC50	81.5	nM	CHEMBL5398491
7.05	EC50	89	nM	CHEMBL3978868
7.02	EC50	95	nM	CHEMBL3925875
7.02	EC50	95	nM	CHEMBL3951388
7.00	EC50	100	nM	CHEMBL3932540
7.00	EC50	100	nM	CHEMBL333343
7.00	EC50	100	nM	CHEMBL3904927
6.99	EC50	102	nM	CHEMBL3902651
6.99	EC50	102	nM	CHEMBL3971511
6.98	EC50	105	nM	CHEMBL3909873
6.96	EC50	111	nM	CHEMBL3916053
6.96	EC50	110	nM	CHEMBL3930185
6.96	EC50	111	nM	CHEMBL3892659
6.92	EC50	121	nM	CHEMBL3984065
6.87	EC50	135	nM	CHEMBL3963470
6.84	EC50	143	nM	CHEMBL3925184
6.82	EC50	150	nM	CHEMBL3941132
6.82	EC50	150	nM	CHEMBL3918890
6.82	EC50	150	nM	CHEMBL3915771
6.76	EC50	174	nM	CHEMBL3936508
6.76	EC50	175	nM	CHEMBL3961914
6.74	EC50	181	nM	CHEMBL3906571
6.74	EC50	182	nM	CHEMBL3895741
6.72	EC50	190	nM	CHEMBL2440854
6.71	EC50	197	nM	CHEMBL3933756
6.69	EC50	205	nM	CHEMBL3909362
6.68	EC50	211	nM	CHEMBL3932239
6.68	EC50	208	nM	CHEMBL3899882

PubChem BioAssay actives

5 with measured affinity, of 25 total; 5 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
1-[4-[3-(4-methoxyphenyl)sulfanylpropylamino]butyl]cyclopropan-1-ol	2023093: Modulator activity at wild type RyR2 (unknown origin) expressed in HEK293T co-expressed with R-CEPIA1er assessed as decrease in RyR2-mediated calcium leak in presence of calcium chloride by time-lapse fluorescence analysis	ec50	0.0102	uM
1-[4-[4-(1-hydroxycyclopropyl)butyl-[3-(4-methoxyphenyl)sulfanylpropyl]amino]butyl]cyclopropan-1-ol	2023093: Modulator activity at wild type RyR2 (unknown origin) expressed in HEK293T co-expressed with R-CEPIA1er assessed as decrease in RyR2-mediated calcium leak in presence of calcium chloride by time-lapse fluorescence analysis	ec50	0.0186	uM
1-[4-[3-(4-methoxyphenoxy)propylamino]butyl]cyclopropan-1-ol	2023093: Modulator activity at wild type RyR2 (unknown origin) expressed in HEK293T co-expressed with R-CEPIA1er assessed as decrease in RyR2-mediated calcium leak in presence of calcium chloride by time-lapse fluorescence analysis	ec50	0.0815	uM
1-[4-[4-(1-hydroxycyclopropyl)butyl-[4-(7-methoxy-3,5-dihydro-2H-1,4-benzothiazepin-4-yl)butyl]amino]butyl]cyclopropan-1-ol	2023093: Modulator activity at wild type RyR2 (unknown origin) expressed in HEK293T co-expressed with R-CEPIA1er assessed as decrease in RyR2-mediated calcium leak in presence of calcium chloride by time-lapse fluorescence analysis	ec50	2.7000	uM
1-[4-[4-(7-methoxy-3,5-dihydro-2H-1,4-benzothiazepin-4-yl)butylamino]butyl]cyclopropan-1-ol	2023093: Modulator activity at wild type RyR2 (unknown origin) expressed in HEK293T co-expressed with R-CEPIA1er assessed as decrease in RyR2-mediated calcium leak in presence of calcium chloride by time-lapse fluorescence analysis	ec50	8.1700	uM

CTD chemical–gene interactions

36 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	decreases expression, affects splicing, increases expression, affects methylation	4
Benzo(a)pyrene	affects methylation, decreases expression, increases mutagenesis	4
Doxorubicin	decreases expression	3
Carvedilol	affects activity, decreases reaction, increases phosphorylation, affects binding, increases reaction (+1 more)	2
Daunorubicin	decreases expression	2
Mitoxantrone	decreases expression	2
Rotenone	decreases expression	2
Aflatoxin B1	increases methylation, decreases methylation	2
MYK-461	decreases expression, decreases reaction	1
methylmercuric chloride	increases expression	1
methyleugenol	decreases expression	1
bisphenol A	affects cotreatment, increases methylation, decreases methylation	1
terbufos	increases methylation	1
sulforaphane	decreases expression	1
perfluorooctanoic acid	increases expression	1
benzo(e)pyrene	increases methylation	1
aflatoxin B2	increases methylation	1
CGP 52608	affects binding, increases reaction	1
(+)-JQ1 compound	decreases expression	1
Fulvestrant	affects cotreatment, increases methylation	1
Vorinostat	decreases expression	1
Arsenic	affects methylation	1
Atenolol	affects binding, increases reaction, increases activity	1
Calcium	decreases reaction, increases activity	1
Diethylhexyl Phthalate	increases expression	1
Fonofos	increases methylation	1
Etoposide	decreases expression	1
Isoproterenol	decreases reaction, increases phosphorylation	1
Methapyrilene	increases methylation	1
Metoprolol	increases reaction, increases activity, affects binding	1

ChEMBL screening assays

15 unique, capped per target: 15 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1028512	Binding	Activation of ryanodine receptor in human IMR32 cells assessed as induction of calcium mobilization	New and selective ryanodine receptor activators for insect control. — *Bioorg Med Chem*

Cellosaurus cell lines

26 cell lines: 22 induced pluripotent stem cell, 2 cancer cell line, 1 transformed cell line, 1 hybrid cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_2Z94	UKKi007-A	Induced pluripotent stem cell	Female
CVCL_9S36	UKKi007-B	Induced pluripotent stem cell	Female
CVCL_A4KY	UMGi041-A	Induced pluripotent stem cell	Male
CVCL_A4KZ	UMGi041-B.2	Induced pluripotent stem cell	Male
CVCL_A5QG	UMGi041-B.3	Induced pluripotent stem cell	Male
CVCL_A8LS	INSRMi011-A	Induced pluripotent stem cell	Male
CVCL_B5QA	ITXi009-A	Induced pluripotent stem cell	Female
CVCL_B5QB	ITXi010-A	Induced pluripotent stem cell	Female
CVCL_B5QC	ITXi011-A	Induced pluripotent stem cell	Female
CVCL_C7YF	SCVIi077-A	Induced pluripotent stem cell	Female

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

showing 60 of 558 trials:

NCT	Phase	Status	Title
NCT00879060	Phase 4	COMPLETED	Clinical and Therapeutic Implications of Fibrosis in Hypertrophic Cardiomyopathy
NCT01721967	Phase 4	COMPLETED	Ranolazine for the Treatment of Chest Pain in HCM Patients
NCT02948998	Phase 4	UNKNOWN	Evaluating the Effect of Spironolactone on Hypertrophic Cardiomyopathy
NCT03249272	Phase 4	TERMINATED	Microvascular Dysfunction in Nonischemic Cardiomyopathy: Insights From CMR Assessment of Coronary Flow Reserve
NCT04133532	Phase 4	COMPLETED	Effect of Metoprolol in Post Alcohol Septal Ablation Patients With Hypertrophic Cardiomyopathy
NCT06401343	Phase 4	UNKNOWN	Use of SGLT2i in noHCM With HFpEF
NCT07103655	Phase 4	ENROLLING_BY_INVITATION	The Therapeutic Value of Mavacamten in Hypertrophic Cardiomyopathy With Mid-to-Apical Left Ventricular Obstruction
NCT07600177	Phase 4	RECRUITING	Mavacamten to Aficamten Transition in Patients With Obstructive Hypertrophic Cardiomyopathy
NCT07807384	Phase 4	NOT_YET_RECRUITING	Efficacy and Safety of an LVEF-Guided Mavacamten Dose Up-Titration Strategy in Chinese Patients With Symptomatic Obstructive Hypertrophic Cardiomyopathy
NCT00348530	Phase 4	UNKNOWN	Carvedilol Versus Verapamil in Chronic Heart Failure Secondary to Non-Ischemic Cardiomyopathy
NCT00371891	Phase 4	COMPLETED	Ontario Multidetector Computed Tomographic (MDCT) Coronary Angiography Study (OMCAS)
NCT00401856	Phase 4	COMPLETED	CMR to Assess Fibrosis in Cardiomyopathy Using Eplerenone
NCT00559338	Phase 4	COMPLETED	Impact of Nesiritide Infusion for Decompensated Heart Failure in the Emergency Department
NCT00606775	Phase 4	UNKNOWN	The Preventive Efficacy of Carvedilol on Cardiac Dysfunction in Duchenne Muscular Dystrophy
NCT00658203	Phase 4	COMPLETED	Clinical Evaluation on Advanced Resynchronization
NCT00701220	Phase 4	COMPLETED	Statin Therapy for Ischemic and Nonischemic Cardiomyopathy
NCT00800761	Phase 4	COMPLETED	Intensive Combined Chelation Therapy for Iron-Induced Cardiac Disease in Patients With Thalassemia Major
NCT00806390	Phase 4	TERMINATED	Prevention of Anthracycline or Trastuzumab Induced Cardiomyopathy by Metoprolol
NCT01006473	Phase 4	COMPLETED	Exercise Training in Chagas Cardiomyopathy
NCT01261065	Phase 4	COMPLETED	Mechanisms of Improvement With Beta-Blocker Treatment in Heart Failure
NCT01345188	Phase 4	COMPLETED	Ranolazine in Ischemic Cardiomyopathy
NCT01868841	Phase 4	COMPLETED	123-I mIBG (AdreView) Heart-to-Mediastinal (H/M) Ratio and SPECT Imaging on a Small Field of View-High Efficiency Cardiac SPECT System
NCT02640846	Phase 4	UNKNOWN	Effects of Levosimendan, Milrinone and Norepinephrine on Left and Right Ventricular Function in Septic Shock
NCT03228823	Phase 4	UNKNOWN	Prospective Assessment of Premature Ventricular Contractions Suppression in Cardiomyopathy(PAPS)
NCT04323852	Phase 4	COMPLETED	Can Vitamin D Reduce Heart Muscle Damage After Bypass Surgery?
NCT05034432	Phase 4	RECRUITING	The PIVATAL Study -Study of Ventricular Arrhythmia (VTA) Ablation in Left Ventricular Assist Device (LVAD) Patients
NCT05371496	Phase 4	COMPLETED	Cardiac and Metabolic Effects of Semaglutide in Heart Failure With Preserved Ejection Fraction
NCT05718128	Phase 4	RECRUITING	Clinical Study of Endocardial Myocardial Biopsy
NCT06964464	Phase 4	RECRUITING	Comparative Effectiveness of Carvedilol Versus Metoprolol Succinate in Heart Failure Patients With an Implantable Cardioverter Defibrillator
NCT00317967	Phase 3	COMPLETED	Study to Determine if Atorvastatin Reduces Size and Stiffness of Muscle in the Left Ventricle of the Heart
NCT00698074	Phase 3	UNKNOWN	Diastolic Ventricular Interaction and the Effects of Biventricular Pacing in Hypertrophic Cardiomyopathy
NCT00821353	Phase 3	COMPLETED	Antiarrhythmic Therapy Versus Catheter Ablation for Atrial Fibrillation in Hypertrophic Cardiomyopathy
NCT02431221	Phase 3	WITHDRAWN	Efficacy, Safety, and Tolerability of Perhexiline in Subjects With Hypertrophic Cardiomyopathy and Heart Failure
NCT03470545	Phase 3	COMPLETED	Clinical Study to Evaluate Mavacamten (MYK-461) in Adults With Symptomatic Obstructive Hypertrophic Cardiomyopathy
NCT05174416	Phase 3	COMPLETED	A Study to Evaluate the Efficacy and Safety of Mavacamten in Chinese Adults With Symptomatic Obstructive HCM
NCT05182658	Phase 3	ACTIVE_NOT_RECRUITING	Empagliflozin in Hypertrophic Cardiomyopathy
NCT05186818	Phase 3	COMPLETED	Phase 3 Trial to Evaluate the Efficacy and Safety of Aficamten Compared to Placebo in Adults With Symptomatic oHCM
NCT05767346	Phase 3	COMPLETED	Phase 3 Trial to Evaluate the Efficacy and Safety of Aficamten Compared to Metoprolol Succinate in Adults With Symptomatic oHCM
NCT06116968	Phase 3	COMPLETED	An Open-Label Study of Aficamten for Chinese Patients With Symptomatic oHCM
NCT06873828	Phase 3	NOT_YET_RECRUITING	Evaluation of the Efficacy and Safety of Wearable ECG (AT-Patch) in Patients With Hypertrophic Cardiomyopathy Requiring 48-Hour Holter MonitoringEvaluation of the Efficacy and Safety of Wearable ECG (AT-Patch) in Patients With Hypertrophic Cardiomyopathy Requiring 48-Hour Holter Monitoring
NCT07021976	Phase 3	ACTIVE_NOT_RECRUITING	A Phase III Trial of HRS-1893 in Patients With Obstructive Hypertrophic Cardiomyopathy
NCT07023341	Phase 3	ACTIVE_NOT_RECRUITING	A Study to Learn More About How Well Aficamten Works in Japanese Participants With Symptomatic Obstructive Hypertrophic Cardiomyopathy
NCT07202897	Phase 3	RECRUITING	LA-HCM Study : Rivaroxaban for Antithrombotic Prevention in Hypertrophic Cardiomyopathy Patients With Abnormal Left Atrial Strain.
NCT00170183	Phase 3	COMPLETED	Brain Natriuretic Peptide (BNP) to Preserve Renal Function in Hospitalized Patients With Heart Failure
NCT00270387	Phase 3	COMPLETED	A Study of Short-Term Outcomes and Economic Impact For Patients With Worsening Congestive Heart Failure When Natrecor (Nesiritide) is Added to Standard-Care Therapy, Compared to Administration of Placebo With Standard-Care Therapy
NCT00321295	Phase 3	COMPLETED	Biventricular Pacing In Patients With Left Ventricular Dysfunction After Cardiovascular Surgery
NCT00483197	Phase 3	UNKNOWN	VentrAssistTM LVAD as a Bridge to Cardiac Transplantation - Pivotal Trial
NCT00490321	Phase 3	UNKNOWN	VentrAssistTM LVAD for the Treatment of Advanced Heart Failure - Destination Therapy
NCT00626028	Phase 3	COMPLETED	Comparison of Inhaled Nitric Oxide and Oxygen in Participants Reactivity During Acute Pulmonary Vasodilator Testing
NCT01013714	Phase 3	UNKNOWN	Cardiac Sympathetic Denervation for Prevention of Ventricular Tachyarrhythmias
NCT01217827	Phase 3	COMPLETED	Implantable Cardioverter-Defibrillator Use in the VA System
NCT01648634	Phase 3	COMPLETED	Nebivolol for the Prevention of Left Ventricular Systolic Dysfunction in Patients With Duchenne Muscular Dystrophy
NCT02924285	Phase 3	COMPLETED	Catheter Ablation Versus Amiodarone for Therapy of Premature Ventricular Contractions in Patients With Structural Heart Disease
NCT03860935	Phase 3	COMPLETED	Efficacy and Safety of AG10 in Subjects With Transthyretin Amyloid Cardiomyopathy
NCT04166331	Phase 3	COMPLETED	Adjunctive DobutAmine in sePtic Cardiomyopathy With Tissue Hypoperfusion
NCT05175066	Phase 3	COMPLETED	Bisoprolol Administration to Prevent Anthracycline-induced Cardiotoxicity
NCT05237323	Phase 3	COMPLETED	Micophenolate Mofetil Versus Azathioprine in Myocarditis
NCT06158698	Phase 3	RECRUITING	CMP-MYTHiC Trial and Registry - CardioMyoPathy With MYocarditis THerapy With Colchicine
NCT06563895	Phase 3	RECRUITING	Acoramidis Transthyretin Amyloidosis Prevention Trial in the Young (ACT-EARLY) Study in Asymptomatic Carriers of a Pathogenic TTR Variant
NCT06846086	Phase 3	RECRUITING	Cardioprotective Effects of Melatonin in Patients With Cardiomyopathy

Predicted chemistry — Sugi Predict

The predicted patent-compound landscape for RYR2 across ~30M SureChEMBL compounds — explore on Sugi Predict.