S1PR4

Summary

S1PR4 (sphingosine-1-phosphate receptor 4, HGNC:3170) is a protein-coding gene on chromosome 19p13.3, encoding Sphingosine 1-phosphate receptor 4 (O95977). G protein-coupled receptor highly expressed in immune cells, where it regulates immune response and cytokine production.

This gene is a member of the endothelial differentiation, G-protein-coupled (EDG)) receptor gene family. EDG receptors bind lysophospholipids or lysosphingolipids as ligands, and are involved in cell signalling in many different cell types. This EDG receptor gene is intronless and is specifically expressed in the lymphoid tissue.

Source: NCBI Gene 8698 — RefSeq curated summary.

At a glance

• GWAS associations: 40
• Clinical variants (ClinVar): 33 total
• Druggable target: yes — 4 molecules with ChEMBL bioactivity
• MANE Select transcript: NM_003775

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:3170
Approved symbol	S1PR4
Name	sphingosine-1-phosphate receptor 4
Location	19p13.3
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000125910
Ensembl biotype	protein_coding
OMIM	603751
Entrez	8698

Gene structure

Transcript identifiers

Ensembl transcripts: 2 — 1 protein_coding, 1 protein_coding_CDS_not_defined

ENST00000246115, ENST00000591346

RefSeq mRNA: 1 — MANE Select: NM_003775 NM_003775

CCDS: CCDS12105

Canonical transcript exons

ENST00000246115 — 1 exons

Exon	Start	End
ENSE00000859542	3178769	3180332

Expression profiles

Bgee: expression breadth ubiquitous, 156 present calls, max score 97.34.

FANTOM5 (CAGE): breadth broad, TPM avg 3.4360 / max 128.6342, expressed in 248 samples.

FANTOM5 promoters (3 alternative TSS)

Promoter ID	TPM avg	Samples expressed
173152	1.9779	224
173153	0.9150	173
173154	0.5431	156

Top tissues by expression

268 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
granulocyte	CL:0000094	97.34	gold quality
blood	UBERON:0000178	95.83	gold quality
leukocyte	CL:0000738	92.67	gold quality
monocyte	CL:0000576	92.40	gold quality
mononuclear cell	CL:0000842	92.22	gold quality
spleen	UBERON:0002106	91.14	gold quality
pancreatic ductal cell	CL:0002079	90.58	silver quality
bone marrow	UBERON:0002371	86.34	gold quality
trabecular bone tissue	UBERON:0002483	84.50	silver quality
diaphragm	UBERON:0001103	84.13	gold quality
gluteal muscle	UBERON:0002000	83.91	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	83.59	gold quality
bone marrow cell	CL:0002092	82.95	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	82.81	silver quality
olfactory bulb	UBERON:0002264	82.05	gold quality
type B pancreatic cell	CL:0000169	81.46	gold quality
epithelial cell of pancreas	CL:0000083	81.28	gold quality
lymph node	UBERON:0000029	81.13	gold quality
upper lobe of left lung	UBERON:0008952	79.85	gold quality
upper lobe of lung	UBERON:0008948	79.46	gold quality
right lung	UBERON:0002167	78.83	gold quality
vastus lateralis	UBERON:0001379	78.81	gold quality
vermiform appendix	UBERON:0001154	78.24	gold quality
periodontal ligament	UBERON:0008266	78.08	silver quality
quadriceps femoris	UBERON:0001377	77.61	gold quality
caecum	UBERON:0001153	77.36	gold quality
tongue squamous epithelium	UBERON:0006919	77.09	gold quality
superficial temporal artery	UBERON:0001614	76.46	gold quality
gingival epithelium	UBERON:0001949	76.43	gold quality
myocardium	UBERON:0002349	75.95	gold quality

Single-cell (SCXA)

Detected in 3 experiment(s), a significant marker in 3.

Experiment	Marker?	Max mean expression
E-HCAD-6	yes	34.50
E-CURD-122	yes	4.72
E-ANND-3	yes	3.21

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): FOXO1

miRNA regulators (miRDB)

4 targeting S1PR4, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4685-5P	99.25	65.99	1563
HSA-MIR-6837-5P	99.25	65.47	1632
HSA-MIR-5008-5P	98.42	65.87	1019
HSA-MIR-324-5P	95.68	65.20	560

Literature-anchored findings (GeneRIF, showing 15)

• Mutation of the ligand selectivity residue from glutamic acid to glutamine confers lysophosphatidic acid sensitivity with preference for short-chain species (PMID:15298705)
• FOXO1 controls the expression of L-selectin and EDG1 and EDG6, receptors that regulate lymphocyte trafficking (PMID:18713968)
• Data report that sphingosine 1-phosphate receptor 4 (S1P(4)) is specifically up-regulated during the development of human megakaryocytes from progenitor cells (PMID:20686109)
• Data show that S1P4 uses HER2 to regulate extracellular signal regulated kinase-1/2 MDA-MB-453 breast cancer cells. (PMID:20837468)
• analysis of novel potent and selective sphingosine-1-phosphate 4 receptor (S1P-R) agonists (PMID:22119461)
• findings highlight an important role for S1P(4) and SK1 in ER(-) breast cancer progression. (PMID:22460268)
• S1P2 translocation to the nucleus is regulated by an autocrine loop involving S1P and S1P4. In contrast, the translocation of Y416 phosphorylated c-Src to the nucleus appears to be regulated by a mechanism that does not involve S1P3 or S1P4. (PMID:24486401)
• Ig-like transcript 7 is rapidly internalized upon receptor-mediated endocytosis of TLR7/9 ligands to allow high IFN-alpha production. This is antagonized by S1PR4 signaling, thus decreasing TLR-induced IFN-alpha secretion. (PMID:26783340)
• S1PR4 missense mutation is associated with variant blood cell traits. (PMID:27399967)
• Shear stress did not induce rapid dephosphorylation of beta-arrestin-1 or rapid internalization of S1P3, indicating no GPCR activation. These findings suggest that Galphaq/11 participates in the sensing/transducing of shear stress independently of GPCR activation in ECs. (PMID:28148497)
• High S1PR4 expression is associated with anti-neutrophil cytoplasmic antibody-associated vasculitis. (PMID:28206609)
• T cell S1PR1 and S1PR4, and lymphatic endothelial cell (LEC) S1PR2, were required for migration across LECs and into lymphatic vessels and lymph nodes. S1PR1 and S1PR4 differentially regulated T cell motility and vascular cell adhesion molecule-1 (VCAM-1) binding. S1PR2 regulated LEC layer structure, permeability, and expression of the junction molecules VE-cadherin, occludin, and zonulin-1 through the ERK pathway. (PMID:30877143)
• NCF2, MYO1F, S1PR4, and FCN1 as potential noninvasive diagnostic biomarkers in patients with obstructive coronary artery: A weighted gene co-expression network analysis. (PMID:31245869)
• The sphingosine 1-phosphate receptor 2/4 antagonist JTE-013 elicits off-target effects on sphingolipid metabolism. (PMID:35013382)
• Silence of S1PR4 Represses the Activation of Fibroblast-like Synoviocytes by Regulating IL-17/STAT3 Signaling Pathway. (PMID:36068391)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	s1pr4	ENSDARG00000074851
mus_musculus	S1pr4	ENSMUSG00000044199
rattus_norvegicus	S1pr4	ENSRNOG00000005370

Paralogs (18): LPAR2 (ENSG00000064547), CNR1 (ENSG00000118432), MC3R (ENSG00000124089), GPR12 (ENSG00000132975), GPR6 (ENSG00000146360), GPR119 (ENSG00000147262), MC4R (ENSG00000166603), S1PR1 (ENSG00000170989), LPAR3 (ENSG00000171517), MC5R (ENSG00000176136), S1PR5 (ENSG00000180739), GPR3 (ENSG00000181773), MC2R (ENSG00000185231), CNR2 (ENSG00000188822), LPAR1 (ENSG00000198121), S1PR3 (ENSG00000213694), MC1R (ENSG00000258839), S1PR2 (ENSG00000267534)

Protein

Protein identifiers

Sphingosine 1-phosphate receptor 4 — O95977 (reviewed: O95977)

Alternative names: Endothelial differentiation G-protein coupled receptor 6, Sphingosine 1-phosphate receptor Edg-6

All UniProt accessions (1): O95977

UniProt curated annotations — full annotation on UniProt →

Function. G protein-coupled receptor highly expressed in immune cells, where it regulates immune response and cytokine production. Functions as a receptor for the lysosphingolipid sphingosine-1-phosphate (S1P). Upon S1P binding, promotes regulatory T-cell differentiation and enhances fatty acid oxidation, through activation of the NRF2/PPARA signaling pathway. Modulates also M1 macrophage activation through interaction with FPR2 and the JNK signaling, contributing to the inflammatory response. In addition, facilitates early neutrophil mobilization and vascular activation during inflammation, promoting lymphocyte recruitment to draining lymph nodes and supporting the development of germinal centers for an effective adaptive immune response.

Subunit / interactions. Interacts with FPR2.

Subcellular location. Cell membrane.

Tissue specificity. Specifically expressed in fetal and adult lymphoid and hematopoietic tissue as well as in lung. Considerable level of expression in adult and fetal spleen as well as adult peripheral leukocytes and lung. Lower expression in adult thymus, lymph node, bone marrow, and appendix as well as in fetal liver, thymus, and lung.

Similarity. Belongs to the G-protein coupled receptor 1 family.

RefSeq proteins (1): NP_003766* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000276	GPCR_Rhodpsn	Family
IPR004061	S1P_rcpt	Family
IPR004064	EDG6_rcpt	Family
IPR017452	GPCR_Rhodpsn_7TM	Domain

Pfam: PF00001

UniProt features (22 total): topological domain 8, transmembrane region 7, glycosylation site 2, chain 1, lipid moiety-binding region 1, sequence variant 1, helix 1, strand 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
2DCO	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O95977-F1	78.44	0.35

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (1): 323

Glycosylation sites (2): 2, 30

Function

Pathways and Gene Ontology

Reactome pathways

7 pathways

ID	Pathway
R-HSA-418594	G alpha (i) signalling events
R-HSA-419408	Lysosphingolipid and LPA receptors
R-HSA-162582	Signal Transduction
R-HSA-372790	Signaling by GPCR
R-HSA-373076	Class A/1 (Rhodopsin-like receptors)
R-HSA-388396	GPCR downstream signalling
R-HSA-500792	GPCR ligand binding

MSigDB gene sets: 223 (showing top): GOBP_SPHINGOLIPID_MEDIATED_SIGNALING_PATHWAY, MODULE_45, MODULE_64, IVANOVA_HEMATOPOIESIS_LATE_PROGENITOR, THEILGAARD_NEUTROPHIL_AT_SKIN_WOUND_DN, MODULE_16, GGGTGGRR_PAX4_03, MODULE_118, WEI_MYCN_TARGETS_WITH_E_BOX, GOBP_ADENYLATE_CYCLASE_MODULATING_G_PROTEIN_COUPLED_RECEPTOR_SIGNALING_PATHWAY, MODULE_289, MODULE_379, KEGG_NEUROACTIVE_LIGAND_RECEPTOR_INTERACTION, MODULE_88, RYTTCCTG_ETS2_B

GO Biological Process (4): sphingosine-1-phosphate receptor signaling pathway (GO:0003376), G protein-coupled receptor signaling pathway (GO:0007186), adenylate cyclase-activating G protein-coupled receptor signaling pathway (GO:0007189), signal transduction (GO:0007165)

GO Molecular Function (4): G protein-coupled receptor activity (GO:0004930), lipid binding (GO:0008289), sphingosine-1-phosphate receptor activity (GO:0038036), protein binding (GO:0005515)

GO Cellular Component (5): cytoplasm (GO:0005737), mitochondrion (GO:0005739), plasma membrane (GO:0005886), presynapse (GO:0098793), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-5 pathways:

Category	Pathways
Signaling by GPCR	2
GPCR downstream signalling	1
Class A/1 (Rhodopsin-like receptors)	1
Signal Transduction	1
GPCR ligand binding	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	3
G protein-coupled receptor signaling pathway	2
binding	2
sphingolipid mediated signaling pathway	1
G protein-coupled receptor activity	1
signal transduction	1
adenylate cyclase-modulating G protein-coupled receptor signaling pathway	1
adenylate cyclase activator activity	1
cell communication	1
cellular process	1
signaling	1
regulation of cellular process	1
cellular response to stimulus	1
transmembrane signaling receptor activity	1
sphingosine-1-phosphate receptor signaling pathway	1
bioactive lipid receptor activity	1
intracellular anatomical structure	1
cytoplasm	1
intracellular membrane-bounded organelle	1
membrane	1
cell periphery	1
synapse	1

Protein interactions and networks

STRING

1340 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
S1PR4	SPHK2	Q9NRA0	922
S1PR4	SPHK1	Q9NYA1	875
S1PR4	GNA15	P30679	870
S1PR4	GNA12	Q03113	848
S1PR4	GNA11	P29992	718
S1PR4	GNAQ	P50148	592
S1PR4	ARRB1	P49407	590
S1PR4	MFSD2B	A6NFX1	582
S1PR4	SPNS2	Q8IVW8	571
S1PR4	ARRB2	P32121	567
S1PR4	LPAR5	Q9H1C0	547
S1PR4	MAPK3	P27361	546
S1PR4	CXCR4	P30991	544
S1PR4	S1PR3	Q99500	505
S1PR4	SGPL1	O95470	497

IntAct

16 interactions, top by confidence:

A	B	Type	Score
S1PR4	GEMIN4	psi-mi:“MI:0915”(physical association)	0.560
RAMP1	S1PR4	psi-mi:“MI:0915”(physical association)	0.400
S1PR4	RAMP2	psi-mi:“MI:0915”(physical association)	0.400
RAMP2	S1PR4	psi-mi:“MI:0915”(physical association)	0.400
S1PR4	RAMP3	psi-mi:“MI:0915”(physical association)	0.400
RAMP3	S1PR4	psi-mi:“MI:0915”(physical association)	0.400
S1PR4	PITPNA	psi-mi:“MI:0914”(association)	0.350
S1PR4	TSG101	psi-mi:“MI:0914”(association)	0.350
MICA	TNFRSF10B	psi-mi:“MI:0914”(association)	0.350
S1PR4	NPC1	psi-mi:“MI:0914”(association)	0.350
S1PR4	ECD	psi-mi:“MI:0914”(association)	0.350
S1PR4	GEMIN4	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (135): TBC1D24 (Affinity Capture-MS), PITPNA (Affinity Capture-MS), GEMIN4 (Two-hybrid), GNA12 (Reconstituted Complex), TSG101 (Affinity Capture-MS), TBC1D24 (Affinity Capture-MS), SIGMAR1 (Affinity Capture-MS), NDUFAF1 (Affinity Capture-MS), INTS2 (Affinity Capture-MS), SLC39A4 (Affinity Capture-MS), NPC1 (Affinity Capture-MS), MPDU1 (Affinity Capture-MS), DERL2 (Affinity Capture-MS), PPP6R1 (Affinity Capture-MS), ATP13A3 (Affinity Capture-MS)

ESM2 similar proteins: A5D7K8, O35932, O95136, O95977, P21731, P30557, P30987, P34972, P34978, P34979, P34980, P35375, P35408, P37289, P43088, P43114, P43115, P43116, P43117, P43118, P43119, P43252, P43253, P46069, P47752, P47901, P47936, P50131, P52592, P56486, P70263, P70597, P79393, Q13258, Q28691, Q28905, Q5R949, Q62053, Q62928, Q8MJ08

Diamond homologs: E7EM37, O02213, O02777, O08530, O42384, O73810, O95136, O95977, P14416, P18089, P19020, P19328, P20272, P20288, P21453, P21554, P22270, P24628, P28286, P30545, P30728, P30951, P34972, P34973, P35412, P35462, P46089, P46095, P46628, P47746, P47752, P47936, P48303, P51651, P52592, P52702, P52703, P53453, P56971, P60026

SIGNOR signaling

1 interactions.

A	Effect	B	Mechanism
“sphingosine 1-phosphate”	“up-regulates activity”	S1PR4	“chemical activation”

Disease & clinical

Clinical variants and AI predictions

ClinVar

33 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	29
Likely benign	3
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

68 predictions. Top by Δscore:

Variant	Effect	Δscore
19:3179423:A:AG	donor_gain	0.5200
19:3179641:G:GT	donor_gain	0.4700
19:3179579:T:A	donor_gain	0.4500
19:3179723:A:AG	acceptor_gain	0.4500
19:3179724:G:GG	acceptor_gain	0.4500
19:3179723:AGCAG:A	acceptor_gain	0.4300
19:3179724:GCAGG:G	acceptor_gain	0.4300
19:3179424:T:G	donor_gain	0.4200
19:3179418:T:TA	acceptor_gain	0.4000
19:3179728:G:GT	donor_gain	0.3900
19:3179574:T:A	donor_gain	0.3500
19:3179724:GCA:G	acceptor_gain	0.3500
19:3179060:C:G	donor_gain	0.3400
19:3179727:GGGAG:G	donor_gain	0.3300
19:3179418:T:A	donor_gain	0.3200
19:3179641:GGA:G	donor_gain	0.3100
19:3179642:GAG:G	donor_gain	0.3100
19:3179697:TC:T	donor_gain	0.3000
19:3179478:T:TA	acceptor_gain	0.2900
19:3179550:TGCTG:T	donor_gain	0.2900
19:3179729:G:GT	donor_gain	0.2900
19:3179574:T:TA	acceptor_gain	0.2800
19:3179720:CGCA:C	acceptor_gain	0.2800
19:3179721:GCAG:G	acceptor_gain	0.2800
19:3179722:CAGC:C	acceptor_gain	0.2800
19:3179723:AGCA:A	acceptor_gain	0.2800
19:3179724:GCAG:G	acceptor_gain	0.2800
19:3179478:TGG:T	acceptor_gain	0.2700
19:3179578:G:A	donor_gain	0.2700
19:3179634:GGGCC:G	acceptor_gain	0.2700

AlphaMissense

2424 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
19:3179195:A:C	S135R	0.998
19:3179197:C:A	S135R	0.998
19:3179197:C:G	S135R	0.998
19:3179053:C:A	N87K	0.997
19:3179053:C:G	N87K	0.997
19:3179701:C:A	N303K	0.996
19:3179701:C:G	N303K	0.996
19:3179063:A:C	S91R	0.995
19:3179065:T:A	S91R	0.995
19:3179065:T:G	S91R	0.995
19:3179067:A:C	D92A	0.995
19:3179067:A:G	D92G	0.995
19:3179067:A:T	D92V	0.995
19:3179068:C:A	D92E	0.995
19:3179068:C:G	D92E	0.995
19:3179570:T:C	F260L	0.995
19:3179572:C:A	F260L	0.995
19:3179572:C:G	F260L	0.995
19:3179373:C:T	S194F	0.994
19:3179689:C:A	N299K	0.994
19:3179689:C:G	N299K	0.994
19:3179582:T:A	W264R	0.993
19:3179582:T:C	W264R	0.993
19:3178984:C:A	N64K	0.992
19:3178984:C:G	N64K	0.992
19:3179579:T:C	C263R	0.992
19:3179585:G:C	G265R	0.992
19:3179300:T:A	W170R	0.991
19:3179300:T:C	W170R	0.991
19:3179331:C:A	P180H	0.991

dbSNP variants (sampled 300 via entrez): RS1001389134 (19:3178445 G>A), RS1002162962 (19:3177313 G>A,T), RS1002179022 (19:3177112 C>T), RS1002991428 (19:3177381 G>A), RS1003050798 (19:3180814 C>T), RS1003112771 (19:3177209 C>T), RS1003583237 (19:3178533 G>A,T), RS1003587293 (19:3178506 G>A), RS1006628497 (19:3178228 TTTCCCCTTCTGCAACGCACCGGGC>T), RS1006964013 (19:3177508 G>A), RS1007099904 (19:3177659 G>A,T), RS1009197498 (19:3178791 C>A,G,T), RS1010039481 (19:3180485 T>A), RS1010757894 (19:3180343 C>T), RS1010834343 (19:3177550 C>T)

Disease associations

OMIM: gene MIM:603751 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

40 associations (top):

Study	Trait	p-value
GCST004600_105	Eosinophil percentage of white cells	2.000000e-17
GCST004606_45	Eosinophil count	1.000000e-16
GCST004606_46	Eosinophil count	3.000000e-10
GCST004608_129	Granulocyte percentage of myeloid white cells	2.000000e-09
GCST004609_91	Monocyte percentage of white cells	2.000000e-09
GCST004610_88	White blood cell count	2.000000e-39
GCST004613_77	Sum neutrophil eosinophil counts	2.000000e-44
GCST004614_72	Granulocyte count	2.000000e-43
GCST004617_132	Eosinophil percentage of granulocytes	1.000000e-18
GCST004620_41	Sum basophil neutrophil counts	2.000000e-41
GCST004623_91	Neutrophil percentage of granulocytes	3.000000e-15
GCST004624_52	Sum eosinophil basophil counts	3.000000e-13
GCST004625_205	Monocyte count	4.000000e-11
GCST004626_155	Myeloid white cell count	5.000000e-44
GCST004629_41	Neutrophil count	6.000000e-43
GCST004632_14	Lymphocyte percentage of white cells	7.000000e-15
GCST004633_7	Neutrophil percentage of white cells	2.000000e-15
GCST004634_55	Basophil percentage of granulocytes	8.000000e-14
GCST005973_17	White blood cell count	2.000000e-13
GCST009798_49	Asthma	7.000000e-10
GCST90002381_241	Eosinophil count	2.000000e-34
GCST90002381_242	Eosinophil count	9.000000e-36
GCST90002382_450	Eosinophil percentage of white cells	7.000000e-09
GCST90002382_499	Eosinophil percentage of white cells	2.000000e-34
GCST90002385_304	High light scatter reticulocyte count	4.000000e-11
GCST90002386_53	High light scatter reticulocyte percentage of red cells	6.000000e-13
GCST90002387_35	Immature fraction of reticulocytes	3.000000e-09
GCST90002388_30	Lymphocyte count	1.000000e-11
GCST90002393_630	Monocyte count	2.000000e-16
GCST90002393_631	Monocyte count	6.000000e-15

EFO canonical traits (16, from GWAS)

EFO ID	Trait name
EFO:0007991	eosinophil percentage of leukocytes
EFO:0004842	eosinophil count
EFO:0007997	granulocyte percentage of myeloid white cells
EFO:0007989	monocyte percentage of leukocytes
EFO:0004833	neutrophil count
EFO:0007987	granulocyte count
EFO:0007996	eosinophil percentage of granulocytes
EFO:0005090	basophil count
EFO:0007994	neutrophil percentage of granulocytes
EFO:0005091	monocyte count
EFO:0007993	lymphocyte percentage of leukocytes
EFO:0007990	neutrophil percentage of leukocytes
EFO:0007995	basophil percentage of granulocytes
EFO:0007986	reticulocyte count
EFO:0004587	lymphocyte count
EFO:0007985	platelet crit

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (2): CHEMBL2363041 (PROTEIN FAMILY), CHEMBL3230 (SINGLE PROTEIN)

Molecules with ChEMBL bioactivity

4 molecules (phase ≥1), by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 19,928 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

Molecule	Name	Phase	Patents
CHEMBL2336071	SIPONIMOD	4	1,508
CHEMBL314854	FINGOLIMOD	4	16,015
CHEMBL3358920	ETRASIMOD	4	817
CHEMBL3707247	OZANIMOD	4	1,588

PharmGKB: 1 entry (VIP=true, CPIC=false)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: gpcr — Lysophospholipid (S1P) receptors

Most potent curated ligand interactions (18 total), top 18:

Ligand	Action	Affinity	Parameter
fingolimod-phosphate	Agonist	9.22	pEC50
phytosphingosine 1-phosphate	Agonist	8.8	pIC50
AFD(R)	Agonist	8.4	pEC50
dihydrosphingosine 1-phosphate	Agonist	8.0	pIC50
mocravimod-phosphate	Agonist	8.0	pEC50
VPC03090-P	Full agonist	7.75	pEC50
CYM-50358	Antagonist	7.6	pIC50
CYM-50308	Agonist	7.25	pEC50
compound 26 [PMID: 16190743]	Agonist	7.15	pIC50
sphingosine 1-phosphate	Agonist	7.0	pIC50
etrasimod	Agonist	6.83	pEC50
compound 5c [PMID: 27894870]	Agonist	6.7	pEC50
siponimod	Agonist	6.12	pEC50
AUY954	Agonist	6.0	pEC50
ponesimod	Partial agonist	5.71	pIC50
ASP4058	Agonist	5.64	pEC50
ozanimod	Agonist	5.1	pEC50
compound 43 [PMID: 26751273]	Agonist	4.4	pEC50

Binding affinities (BindingDB)

111 measured of 175 human assays (175 total across all organisms); most potent 50 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value	Patent
1-({4-[5-(4-cyclopentylphenyl)-1,2,4-oxadiazol-3-yl]phenyl}methyl)azetidine-3-carboxylic acid	IC50	0.4 nM
1-[(4-{5-[4-(3,3,3-trifluoropropyl)phenyl]-1,2,4-oxadiazol-3-yl}phenyl)methyl]azetidine-3-carboxylic acid	IC50	0.4 nM
1-[(4-{5-[4-(2-methylpropyl)phenyl]-1,2,4-oxadiazol-3-yl}phenyl)methyl]azetidine-3-carboxylic acid	IC50	0.6 nM
1-{[4-(5-{4-[(1R)-3,3-difluorocyclopentyl]phenyl}-1,2,4-oxadiazol-3-yl)phenyl]methyl}azetidine-3-carboxylic acid	IC50	0.8 nM
1-{[4-(5-{4-[(1S)-3,3-difluorocyclopentyl]phenyl}-1,2,4-oxadiazol-3-yl)phenyl]methyl}azetidine-3-carboxylic acid	IC50	0.9 nM
{[(4Z)-2-amino-3-hydroxyoctadec-4-en-1-yl]oxy}phosphonic acid	KI	1.2 nM
1-[(4-{5-[4-(2-methylbutan-2-yl)phenyl]-1,2,4-oxadiazol-3-yl}phenyl)methyl]azetidine-3-carboxylic acid	IC50	1.3 nM
1-({4-[5-(4-propylphenyl)-1,2,4-oxadiazol-3-yl]phenyl}methyl)azetidine-3-carboxylic acid	IC50	1.3 nM
1-({4-[5-(4-cyclohexylphenyl)-1,2,4-oxadiazol-3-yl]phenyl}methyl)azetidine-3-carboxylic acid	IC50	1.4 nM
1-({4-[5-(4-phenylphenyl)-1,2,4-oxadiazol-3-yl]phenyl}methyl)azetidine-3-carboxylic acid	IC50	1.7 nM
1-[(4-{5-[4-(propan-2-yloxy)phenyl]-1,2,4-oxadiazol-3-yl}phenyl)methyl]azetidine-3-carboxylic acid	IC50	1.8 nM
[(2S)-2-amino-3-hydroxy-2-[2-(4-octylphenyl)ethyl]propoxy]phosphonic acid	KI	2.1 nM
1-({4-[5-(4-cyclobutylphenyl)-1,2,4-oxadiazol-3-yl]phenyl}methyl)azetidine-3-carboxylic acid	IC50	2.2 nM
1-({4-[5-(4-butylphenyl)-1,2,4-oxadiazol-3-yl]phenyl}methyl)azetidine-3-carboxylic acid	IC50	2.9 nM
1-({4-[5-(4-tert-butylphenyl)-1,2,4-oxadiazol-3-yl]phenyl}methyl)azetidine-3-carboxylic acid	IC50	3.8 nM
1-[(4-{5-[4-(2,2-dimethylpropyl)phenyl]-1,2,4-oxadiazol-3-yl}phenyl)methyl]azetidine-3-carboxylic acid	IC50	3.8 nM
{2-amino-3-hydroxy-2-[2-(4-octylphenyl)ethyl]propoxy}phosphonic acid	KI	4.1 nM
1-({4-[5-(4-cyclopropylphenyl)-1,2,4-oxadiazol-3-yl]phenyl}methyl)azetidine-3-carboxylic acid	IC50	4.5 nM
1-({4-[5-(4-ethoxyphenyl)-1,2,4-oxadiazol-3-yl]phenyl}methyl)azetidine-3-carboxylic acid	IC50	5.1 nM
1-{4-[3-(4-tert-butylphenyl)-1,2,4-oxadiazol-5-yl]benzyl}azetidine-3-carboxylic acid	IC50	8.2 nM
1-({4-[5-(4-hexylphenyl)-1,2,4-oxadiazol-3-yl]phenyl}methyl)azetidine-3-carboxylic acid	IC50	29 nM
N-[(S)-(5-bromo-2-pyridinyl)-(3,4-dichlorophenyl)methyl]-3,4-dicyanobenzamide	IC50	99 nM	US-10323029: Sphinogosine-1-phosphate receptor modulators for treatment of cardiopulmonary disorders
1-{4-[5-(4-tert-butylphenyl)-1,3,4-oxadiazol-2-yl]benzyl}azetidine-3-carboxylic acid	IC50	100 nM
N-[2-(benzenecarboximidoylamino)-1-(3-chlorophenyl)-2-oxoethyl]-3,5-dichlorobenzamide	IC50	112 nM	US-10323029: Sphinogosine-1-phosphate receptor modulators for treatment of cardiopulmonary disorders
N-[(S)-(5-bromo-2-pyridinyl)-(3,4-dichlorophenyl)methyl]-3-chloro-4-cyanobenzamide	IC50	141 nM	US-10323029: Sphinogosine-1-phosphate receptor modulators for treatment of cardiopulmonary disorders
N-[(S)-(5-chloro-2-pyridinyl)-(3,4-dichlorophenyl)methyl]-3-cyano-4-fluorobenzamide	IC50	197 nM	US-10323029: Sphinogosine-1-phosphate receptor modulators for treatment of cardiopulmonary disorders
4-bromo-N-[(S)-(5-chloro-2-pyridinyl)-(3,4-dichlorophenyl)methyl]-3-methylbenzamide	IC50	220 nM	US-10323029: Sphinogosine-1-phosphate receptor modulators for treatment of cardiopulmonary disorders
N-[(S)-(5-chloro-2-pyridinyl)-(3,4-dichlorophenyl)methyl]-4-cyano-3-methylbenzamide	IC50	227 nM	US-10323029: Sphinogosine-1-phosphate receptor modulators for treatment of cardiopulmonary disorders
[(2R)-2-amino-3-hydroxy-2-[2-(4-octylphenyl)ethyl]propoxy]phosphonic acid	KI	277 nM
N-[(S)-(5-bromo-2-pyridinyl)-(3,4-dichlorophenyl)methyl]-4-cyano-3-methylbenzamide	IC50	308 nM	US-10323029: Sphinogosine-1-phosphate receptor modulators for treatment of cardiopulmonary disorders
4-chloro-N-[(S)-(5-chloro-3-fluoro-2-pyridinyl)-(4-chlorophenyl)methyl]-3-methylbenzamide	IC50	332 nM	US-10323029: Sphinogosine-1-phosphate receptor modulators for treatment of cardiopulmonary disorders
3-chloro-N-[(S)-(5-chloro-2-pyridinyl)-(3,4-dichlorophenyl)methyl]-4-fluorobenzamide	IC50	347 nM	US-10323029: Sphinogosine-1-phosphate receptor modulators for treatment of cardiopulmonary disorders
methyl N-[2-[[2-[[amino(phenyl)methylidene]amino]-1-(3-chlorophenyl)-2-oxoethyl]amino]-1-(3-chlorophenyl)-2-oxoethyl]carbamate	IC50	390 nM	US-10323029: Sphinogosine-1-phosphate receptor modulators for treatment of cardiopulmonary disorders
N-[2-[[amino(phenyl)methylidene]amino]-1-(3-chlorophenyl)-2-oxoethyl]-3,4-dichlorobenzamide	IC50	392 nM	US-10323029: Sphinogosine-1-phosphate receptor modulators for treatment of cardiopulmonary disorders
N-[2-[[amino(phenyl)methylidene]amino]-1-(3,4-dichlorophenyl)-2-oxoethyl]-3,4-dichlorobenzamide	IC50	426 nM	US-10323029: Sphinogosine-1-phosphate receptor modulators for treatment of cardiopulmonary disorders
N-[(S)-(5-chloro-2-pyridinyl)-(3,4-dichlorophenyl)methyl]-4-cyano-3,5-dimethylbenzamide	IC50	452 nM	US-10323029: Sphinogosine-1-phosphate receptor modulators for treatment of cardiopulmonary disorders
N-[2-[[amino(phenyl)methylidene]amino]-1-(3-chlorophenyl)-2-oxoethyl]-3-chlorobenzamide	IC50	456 nM	US-10323029: Sphinogosine-1-phosphate receptor modulators for treatment of cardiopulmonary disorders
tert-butyl N-[2-[[2-[[amino(phenyl)methylidene]amino]-1-(3-chlorophenyl)-2-oxoethyl]amino]-1-(3-chlorophenyl)-2-oxoethyl]carbamate	IC50	475 nM	US-10323029: Sphinogosine-1-phosphate receptor modulators for treatment of cardiopulmonary disorders
3-chloro-4-cyano-N-[(S)-(3,4-dichlorophenyl)-(5-methyl-2-pyridinyl)methyl]benzamide	IC50	505 nM	US-10323029: Sphinogosine-1-phosphate receptor modulators for treatment of cardiopulmonary disorders
N-[2-[[amino(phenyl)methylidene]amino]-2-oxo-1-phenylethyl]-3-bromobenzamide	IC50	564 nM	US-10323029: Sphinogosine-1-phosphate receptor modulators for treatment of cardiopulmonary disorders
N-[(S)-(5-bromo-2-pyridinyl)-(3,4-dichlorophenyl)methyl]-4-cyano-3-fluorobenzamide	IC50	566 nM	US-10323029: Sphinogosine-1-phosphate receptor modulators for treatment of cardiopulmonary disorders
3-chloro-N-[(S)-(5-chloro-2-pyridinyl)-(4-methylphenyl)methyl]-4-cyanobenzamide	IC50	604 nM	US-10323029: Sphinogosine-1-phosphate receptor modulators for treatment of cardiopulmonary disorders
N-[amino(pyridin-2-yl)methylidene]-2-(3,4-dichloroanilino)-2-phenylacetamide	IC50	700 nM	US-10323029: Sphinogosine-1-phosphate receptor modulators for treatment of cardiopulmonary disorders
N-[(5-bromo-2-pyridinyl)-phenylmethyl]-3,4-dichloroaniline	IC50	772 nM	US-10323029: Sphinogosine-1-phosphate receptor modulators for treatment of cardiopulmonary disorders
3-chloro-N-[(S)-(4-chloro-3-fluorophenyl)-(5-chloro-2-pyridinyl)methyl]-4-cyanobenzamide	IC50	810 nM	US-10323029: Sphinogosine-1-phosphate receptor modulators for treatment of cardiopulmonary disorders
N-[2-[[amino(phenyl)methylidene]amino]-1-(3,4-dichlorophenyl)-2-oxoethyl]-3-chlorobenzamide	IC50	823 nM	US-10323029: Sphinogosine-1-phosphate receptor modulators for treatment of cardiopulmonary disorders
N-[(S)-(5-chloro-3-fluoro-2-pyridinyl)-(4-chlorophenyl)methyl]-4-cyano-3-methylbenzamide	IC50	878 nM	US-10323029: Sphinogosine-1-phosphate receptor modulators for treatment of cardiopulmonary disorders
1-(3,4-dichlorophenyl)-3-[phenyl-(3-phenyl-1,2,4-oxadiazol-5-yl)methyl]urea	IC50	881 nM	US-10323029: Sphinogosine-1-phosphate receptor modulators for treatment of cardiopulmonary disorders
3-chloro-N-[(S)-(5-chloro-2-pyridinyl)-(3,4-dichlorophenyl)methyl]-4-methylbenzamide	IC50	910 nM	US-10323029: Sphinogosine-1-phosphate receptor modulators for treatment of cardiopulmonary disorders
3,4-dichloro-N-[(S)-(5-ethenyl-2-pyridinyl)-phenylmethyl]benzamide	IC50	1000 nM	US-10323029: Sphinogosine-1-phosphate receptor modulators for treatment of cardiopulmonary disorders

ChEMBL bioactivities

617 potent at pChembl≥5 of 770 total, top 50 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
10.05	EC50	0.09	nM	CHEMBL114606
9.52	EC50	0.3	nM	FINGOLIMOD
9.30	EC50	0.5	nM	CHEMBL4458575
9.22	EC50	0.6	nM	FTY720-P
9.15	EC50	0.7	nM	CHEMBL190006
9.04	EC50	0.92	nM	CHEMBL4448752
8.98	IC50	1.04	nM	CHEMBL225155
8.96	IC50	1.1	nM	CHEMBL474689
8.91	IC50	1.23	nM	CHEMBL470511
8.90	EC50	1.259	nM	CHEMBL199791
8.90	EC50	1.259	nM	CHEMBL382739
8.80	EC50	1.6	nM	CHEMBL114606
8.80	EC50	1.6	nM	FTY720-P
8.77	IC50	1.7	nM	CHEMBL432067
8.74	IC50	1.8	nM	CHEMBL474688
8.72	IC50	1.9	nM	CHEMBL473269
8.66	IC50	2.2	nM	FTY720-P
8.62	EC50	2.4	nM	CHEMBL114606
8.62	IC50	2.4	nM	CHEMBL225155
8.54	IC50	2.9	nM	CHEMBL225155
8.47	EC50	3.4	nM	CHEMBL4637401
8.47	IC50	3.4	nM	CHEMBL1093429
8.46	IC50	3.5	nM	CHEMBL515921
8.44	EC50	3.6	nM	CHEMBL3102903
8.44	IC50	3.6	nM	CHEMBL473156
8.40	EC50	4	nM	CHEMBL114606
8.40	IC50	4	nM	CHEMBL475495
8.38	IC50	4.17	nM	CHEMBL475405
8.36	IC50	4.4	nM	CHEMBL1093823
8.34	EC50	4.57	nM	CHEMBL3102904
8.31	IC50	4.9	nM	CHEMBL514170
8.31	IC50	4.87	nM	CHEMBL514170
8.28	IC50	5.24	nM	CHEMBL473238
8.27	EC50	5.39	nM	CHEMBL1091103
8.25	EC50	5.6	nM	CHEMBL4752394
8.24	EC50	5.7	nM	CHEMBL1084929
8.21	IC50	6.15	nM	CHEMBL473563
8.19	IC50	6.5	nM	CHEMBL1090829
8.13	EC50	7.4	nM	CHEMBL393055
8.10	EC50	7.9	nM	CHEMBL225155
8.08	IC50	8.4	nM	CHEMBL184879
8.08	IC50	8.3	nM	CHEMBL473562
8.05	EC50	9	nM	CHEMBL225155
8.00	EC50	10	nM	CHEMBL4786296
8.00	EC50	10	nM	CHEMBL1910654
7.99	IC50	10.3	nM	CHEMBL514302
7.99	IC50	10.3	nM	CHEMBL475405
7.98	EC50	10.5	nM	CHEMBL3806205
7.93	IC50	11.7	nM	CHEMBL515917
7.89	EC50	13	nM	CHEMBL225155

PubChem BioAssay actives

412 with measured affinity, of 782 total; 50 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
[2-amino-2-(hydroxymethyl)-4-(4-octylphenyl)butyl] dihydrogen phosphate	1300069: Agonist activity at human S1P4 receptor by GTPgammaS binding assay	ec50	0.0001	uM
Fingolimod	1054253: Agonist activity at S1P4 receptor (unknown origin)	ec50	0.0003	uM
2-[(3R)-1-[(2S)-2-hydroxy-2-[4-[5-[3-phenyl-4-(trifluoromethyl)-1,2-oxazol-5-yl]-1,2,4-oxadiazol-3-yl]phenyl]ethyl]piperidin-3-yl]acetic acid	1626268: Agonist activity at S1P4 receptor (unknown origin) measured after 45 mins by [35S]GTP-gammaS binding assay	ec50	0.0005	uM
[(2S)-2-amino-2-(hydroxymethyl)-4-(4-octylphenyl)butyl] dihydrogen phosphate	240250: Agonism of human S1P-4 receptor expressed in CHO cells, 90-120 min in pH 7.4 using [35S]GTP-gamma-S as radioligand	ec50	0.0006	uM
[(2R)-2-amino-2-(hydroxymethyl)-4-(4-octylphenyl)butyl] dihydrogen phosphate	466805: Agonist activity at human S1P4 receptor expressed in CHO cells assessed as induction of [S35]GTPgammaS binding	ec50	0.0007	uM
(3S)-1-[(2S)-2-hydroxy-2-[4-[5-[3-phenyl-4-(trifluoromethyl)-1,2-oxazol-5-yl]-1,2,4-oxadiazol-3-yl]phenyl]ethyl]piperidine-3-carboxylic acid	1626268: Agonist activity at S1P4 receptor (unknown origin) measured after 45 mins by [35S]GTP-gammaS binding assay	ec50	0.0009	uM
[(E,2S,3R)-2-amino-3-hydroxyoctadec-4-enyl] dihydrogen phosphate	476459: Displacement of [33P]sphingosine-1-phosphate from human S1P4 receptor expressed in HEK293T cells after 60 mins by scintillation counting	ic50	0.0010	uM
[(2R)-2-amino-2-[5-(4-octoxyphenyl)-1H-imidazol-2-yl]propyl] dihydrogen phosphate	392391: Displacement of [33P]sphingosine-1-phosphate from human S1P4 receptor	ic50	0.0011	uM
[(2R)-2-amino-2-[5-[4-(5-phenylpentoxy)phenyl]-1H-imidazol-2-yl]propyl] dihydrogen phosphate	351686: Displacement of [33P]sphingosine-1-phosphate from human S1P4 receptor	ic50	0.0012	uM
[(2R)-2-amino-4-(4-heptoxyphenyl)-2-methylbutyl] dihydrogen phosphate	258420: Binding potency at human S1P4 receptor by [35S]GTP-gamma-S binding assay	ec50	0.0013	uM
[(E,2S,3R)-2-amino-3-hydroxypentadec-4-enyl] dihydrogen phosphate	258420: Binding potency at human S1P4 receptor by [35S]GTP-gamma-S binding assay	ec50	0.0013	uM
[2-amino-4-(4-octylphenyl)butyl] dihydrogen phosphate	204055: Inhibition of [33P]-S1P binding to human Sphingosine 1-phosphate receptor 4 expressed on CHO cell membranes	ic50	0.0017	uM
[(2S)-2-amino-3-(2-fluoro-4-octoxyanilino)-2-methyl-3-oxopropyl] dihydrogen phosphate	392391: Displacement of [33P]sphingosine-1-phosphate from human S1P4 receptor	ic50	0.0018	uM
[(2R)-2-amino-2-[5-(3-fluoro-4-octoxyphenyl)-1H-imidazol-2-yl]propyl] dihydrogen phosphate	392391: Displacement of [33P]sphingosine-1-phosphate from human S1P4 receptor	ic50	0.0019	uM
[(Z)-2-amino-3-hydroxyoctadec-4-enyl] dihydrogen phosphate	1798300: [32P] S1P Binding Assay from Article 10.1016/j.bmc.2004.10.008: “Asymmetric synthesis and biological evaluation of the enantiomeric isomers of the immunosuppressive FTY720-phosphate.”	ki	0.0027	uM
[(1R,3S)-1-amino-3-[(6S)-6-[2-(2-methoxyphenyl)ethyl]-5,6,7,8-tetrahydronaphthalen-2-yl]cyclopentyl]methyl dihydrogen phosphate	1735827: Agonist activity at human recombinant S1P4 expressed in CHO cell membranes assessed as stimulation of [35S]-GTPgammaS binding measured after 45 mins by liquid scintillation counting assay	ec50	0.0034	uM
[(2S)-2-amino-2-methyl-3-oxo-3-[4-[2-(4-phenylphenyl)ethoxy]-3-(trifluoromethyl)anilino]propyl] dihydrogen phosphate	476459: Displacement of [33P]sphingosine-1-phosphate from human S1P4 receptor expressed in HEK293T cells after 60 mins by scintillation counting	ic50	0.0034	uM
[(2S)-2-amino-3-(3-fluoro-4-octoxyanilino)-2-methyl-3-oxopropyl] dihydrogen phosphate	392391: Displacement of [33P]sphingosine-1-phosphate from human S1P4 receptor	ic50	0.0035	uM
[(2S)-2-amino-2-methyl-3-oxo-3-[4-(5-phenylpentoxy)anilino]propyl] dihydrogen phosphate	351686: Displacement of [33P]sphingosine-1-phosphate from human S1P4 receptor	ic50	0.0036	uM
[(2S)-2-amino-2-[5-[4-octoxy-3-(trifluoromethyl)phenyl]-1,3-thiazol-2-yl]propyl] dihydrogen phosphate	1062163: Agonist activity at human S1P4R expressed in HEK293T cells assessed as [35S]GTPgammaS binding after 30 mins by scintillation counting	ec50	0.0036	uM
[(2S)-2-amino-2-methyl-3-(4-octoxyanilino)-3-oxopropyl] dihydrogen phosphate	392391: Displacement of [33P]sphingosine-1-phosphate from human S1P4 receptor	ic50	0.0040	uM
[(2S)-2-amino-2-methyl-3-oxo-3-[4-[2-(4-phenylphenyl)ethoxy]anilino]propyl] dihydrogen phosphate	351686: Displacement of [33P]sphingosine-1-phosphate from human S1P4 receptor	ic50	0.0042	uM
[(2R)-2-amino-2-[5-[4-[(4-phenylphenyl)methoxy]-3-(trifluoromethyl)phenyl]-1H-imidazol-2-yl]propyl] dihydrogen phosphate	476459: Displacement of [33P]sphingosine-1-phosphate from human S1P4 receptor expressed in HEK293T cells after 60 mins by scintillation counting	ic50	0.0044	uM
[(2S)-2-amino-2-[5-[4-octoxy-3-(trifluoromethyl)phenyl]-1,3,4-thiadiazol-2-yl]propyl] dihydrogen phosphate	1062163: Agonist activity at human S1P4R expressed in HEK293T cells assessed as [35S]GTPgammaS binding after 30 mins by scintillation counting	ec50	0.0046	uM
[(2R)-2-amino-2-[5-[4-[(4-phenylphenyl)methoxy]phenyl]-1H-imidazol-2-yl]propyl] dihydrogen phosphate	351686: Displacement of [33P]sphingosine-1-phosphate from human S1P4 receptor	ic50	0.0049	uM
[(2S)-2-amino-2-methyl-3-oxo-3-[4-[3-(4-phenylphenyl)propoxy]anilino]propyl] dihydrogen phosphate	351686: Displacement of [33P]sphingosine-1-phosphate from human S1P4 receptor	ic50	0.0052	uM
[2-amino-3-hydroxy-2-[(2R)-6-octyl-1,2,3,4-tetrahydronaphthalen-2-yl]propyl] dihydrogen phosphate	473722: Agonist activity at human S1P4 receptor assessed as effect on calcium mobilization by Gq dependent whole cell assay	ec50	0.0054	uM
[(1R,3S)-1-amino-3-[(6R)-6-(5-methoxypentyl)-5,6,7,8-tetrahydronaphthalen-2-yl]cyclopentyl]methyl dihydrogen phosphate	1730779: Agonist activity at recombinant human S1P4 expressed in CHO cell membranes assessed as stimulation of [35S]-GTPgammaS binding measured after 45 mins by liquid scintillation counting method	ec50	0.0056	uM
[(2S)-2-amino-4-(4-heptoxyphenyl)-2-methylbutyl] dihydrogen phosphate	466805: Agonist activity at human S1P4 receptor expressed in CHO cells assessed as induction of [S35]GTPgammaS binding	ec50	0.0057	uM
[(2S)-2-amino-2-methyl-3-oxo-3-[4-[(4-phenylphenyl)methoxy]anilino]propyl] dihydrogen phosphate	351686: Displacement of [33P]sphingosine-1-phosphate from human S1P4 receptor	ic50	0.0062	uM
[(2R)-2-amino-2-[5-[4-[2-(4-phenylphenyl)ethoxy]-3-(trifluoromethyl)phenyl]-1H-imidazol-2-yl]propyl] dihydrogen phosphate	476459: Displacement of [33P]sphingosine-1-phosphate from human S1P4 receptor expressed in HEK293T cells after 60 mins by scintillation counting	ic50	0.0065	uM
[(2R,4R,5S)-5-(hydroxymethyl)-4-(4-octylphenyl)pyrrolidin-2-yl]methyl dihydrogen phosphate	305222: Activity at human recombinant S1P4 receptor expressed in CHO cells assessed as increase in calcium release by FLIPR assay	ec50	0.0074	uM
[(2S)-2-amino-3-[4-(4-cyclohexylbutoxy)anilino]-2-methyl-3-oxopropyl] dihydrogen phosphate	351686: Displacement of [33P]sphingosine-1-phosphate from human S1P4 receptor	ic50	0.0083	uM
2-[5-(4-nonylphenyl)pyrrolidin-2-yl]ethylphosphonic acid	241962: Inhibition of [33P]-S1P binding to human Sphingosine 1-phosphate receptor 4 expressed on CHO cell membranes	ic50	0.0084	uM
(2R)-2-amino-3-[[4-(2-benzylphenyl)-1H-indole-2-carbonyl]amino]propanoic acid	625410: Agonist activity at S1P4 receptor in human U2OS cells expressing VP16-GAL4 transcriptional factor and beta-arrestin/TEV protease fusion protein assessed as migration of VP16-GAL4 into nucleus by FRET based beta lactamase reporter gene assay	ec50	0.0100	uM
[(1R,3S)-1-amino-3-[(6R)-6-(3-ethoxypropyl)-5,6,7,8-tetrahydronaphthalen-2-yl]cyclopentyl]methyl dihydrogen phosphate	1730779: Agonist activity at recombinant human S1P4 expressed in CHO cell membranes assessed as stimulation of [35S]-GTPgammaS binding measured after 45 mins by liquid scintillation counting method	ec50	0.0100	uM
[(2S)-2-amino-2-methyl-3-oxo-3-[4-(4-phenylbutoxy)anilino]propyl] dihydrogen phosphate	351686: Displacement of [33P]sphingosine-1-phosphate from human S1P4 receptor	ic50	0.0103	uM
[(1R,3S)-1-amino-3-[(6R)-6-hexyl-5,6,7,8-tetrahydronaphthalen-2-yl]cyclopentyl]methyl dihydrogen phosphate	1300069: Agonist activity at human S1P4 receptor by GTPgammaS binding assay	ec50	0.0105	uM
[(2R)-2-amino-2-[5-[4-(4-phenylbutoxy)phenyl]-1H-imidazol-2-yl]propyl] dihydrogen phosphate	351686: Displacement of [33P]sphingosine-1-phosphate from human S1P4 receptor	ic50	0.0117	uM
[(2S)-2-amino-2-methyl-3-oxo-3-[4-[3-(4-phenylphenyl)propanoyl]anilino]propyl] dihydrogen phosphate	476459: Displacement of [33P]sphingosine-1-phosphate from human S1P4 receptor expressed in HEK293T cells after 60 mins by scintillation counting	ic50	0.0131	uM
[2-amino-1-hydroxy-4-(4-octylphenyl)butan-2-yl] dihydrogen phosphate	204168: Binding affinity to human sphingosine 1-phosphate receptor 4 expressed in CHO cells was determined by using [33P]-S1P as radioligand	ic50	0.0150	uM
[2-amino-2-(hydroxymethyl)-4-(4-octylphenyl)butoxy]-trihydroxyphosphanium	241962: Inhibition of [33P]-S1P binding to human Sphingosine 1-phosphate receptor 4 expressed on CHO cell membranes	ic50	0.0150	uM
[(1R,3R)-3-amino-1-hydroxy-5-(4-octylphenyl)pentyl]phosphonic acid	204168: Binding affinity to human sphingosine 1-phosphate receptor 4 expressed in CHO cells was determined by using [33P]-S1P as radioligand	ic50	0.0160	uM
[(1S,3R)-3-amino-1-hydroxy-5-(4-octylphenyl)pentyl]phosphonic acid	204055: Inhibition of [33P]-S1P binding to human Sphingosine 1-phosphate receptor 4 expressed on CHO cell membranes	ic50	0.0160	uM
[(2R)-2-amino-2-[(2S)-6-octyl-1,2,3,4-tetrahydronaphthalen-2-yl]propyl] dihydrogen phosphate	473722: Agonist activity at human S1P4 receptor assessed as effect on calcium mobilization by Gq dependent whole cell assay	ec50	0.0160	uM
[(2S,4S,5R)-5-(hydroxymethyl)-4-(4-octylphenyl)pyrrolidin-2-yl]methyl dihydrogen phosphate	305222: Activity at human recombinant S1P4 receptor expressed in CHO cells assessed as increase in calcium release by FLIPR assay	ec50	0.0168	uM
[(3S)-3-amino-5-(4-heptoxyphenyl)-3-methylpentyl]phosphonic acid	466805: Agonist activity at human S1P4 receptor expressed in CHO cells assessed as induction of [S35]GTPgammaS binding	ec50	0.0190	uM
[(2R)-2-amino-2-methyl-4-[4-[8-[(4-nitro-2,1,3-benzoxadiazol-7-yl)amino]octoxy]phenyl]butyl] dihydrogen phosphate	258420: Binding potency at human S1P4 receptor by [35S]GTP-gamma-S binding assay	ec50	0.0199	uM
5-(2,5-dichlorophenyl)-N-[4-(hydroxymethyl)-2,6-dimethylphenyl]furan-2-carboxamide	599087: Antagonist activity at S1P4 receptor in human U2OS cells expressing EDG6-linked GAL4-VP16 transcription factor via TEV protease site/beta-arrestin/TEV protease fusion protein and beta-lactamase reporter gene assessed as beta-lactamase expression by FRET assay	ic50	0.0210	uM
[3-amino-1-hydroxy-5-(4-octylphenyl)pentyl]phosphonic acid	204055: Inhibition of [33P]-S1P binding to human Sphingosine 1-phosphate receptor 4 expressed on CHO cell membranes	ic50	0.0230	uM

CTD chemical–gene interactions

14 total (human), top 14 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Benzo(a)pyrene	increases expression	2
Aflatoxin B1	increases expression	2
GSK-J4	decreases expression	1
afuresertib	increases expression	1
triphenyl phosphate	affects expression	1
di-n-butylphosphoric acid	affects expression	1
jinfukang	affects cotreatment, increases expression	1
Acetaminophen	increases expression	1
Arsenic	affects expression	1
Cisplatin	affects cotreatment, increases expression	1
Dronabinol	increases expression	1
Valproic Acid	increases methylation	1
Vanadium	increases expression	1
Antirheumatic Agents	decreases expression	1

ChEMBL screening assays

132 unique, capped per target: 75 functional, 57 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1029037	Binding	Displacement of [33P]sphingosine-1-phosphate from human S1P4 receptor	Synthesis and evaluation of alkoxy-phenylamides and alkoxy-phenylimidazoles as potent sphingosine-1-phosphate receptor subtype-1 agonists. — Bioorg Med Chem Lett
CHEMBL1051872	Functional	Ratio of agonistic EC50 for S1P to compound for human S1P4 receptor by [35S]GTPgammaS binding assay	Synthesis and biological evaluation of sphingosine kinase substrates as sphingosine-1-phosphate receptor prodrugs. — Bioorg Med Chem

Cellosaurus cell lines

3 cell lines: 2 cancer cell line, 1 spontaneously immortalized cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_H522	RH7777/EDG6	Cancer cell line	Female
CVCL_KW97	PathHunter CHO-K1 EDG6 beta-arrestin	Spontaneously immortalized cell line	Female
CVCL_ZK30	Tango EDG6-bla U2OS	Cancer cell line	Female

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.