SCRN1

Summary

SCRN1 (secernin 1, HGNC:22192) is a protein-coding gene on chromosome 7p14.3, encoding Secernin-1 (Q12765). Regulates exocytosis in mast cells.

This gene likely encodes a member of the secernin family of proteins. A similar protein in rat functions in regulation of exocytosis in mast cells. Alternatively spliced transcript variants have been described.

Source: NCBI Gene 9805 — RefSeq curated summary.

At a glance

• GWAS associations: 2
• Clinical variants (ClinVar): 71 total
• MANE Select transcript: NM_014766

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:22192
Approved symbol	SCRN1
Name	secernin 1
Location	7p14.3
Locus type	gene with protein product
Status	Approved
Aliases	KIAA0193
Ensembl gene	ENSG00000136193
Ensembl biotype	protein_coding
OMIM	614965
Entrez	9805

Gene structure

Transcript identifiers

Ensembl transcripts: 18 — 17 protein_coding, 1 protein_coding_CDS_not_defined

ENST00000242059, ENST00000409497, ENST00000409570, ENST00000421434, ENST00000425819, ENST00000426154, ENST00000434476, ENST00000438497, ENST00000494620, ENST00000631335, ENST00000866205, ENST00000866206, ENST00000866207, ENST00000866208, ENST00000866209, ENST00000866210, ENST00000866211, ENST00000955921

RefSeq mRNA: 4 — MANE Select: NM_014766 NM_001145513, NM_001145514, NM_001145515, NM_014766

CCDS: CCDS47567, CCDS47568, CCDS5422

Canonical transcript exons

ENST00000242059 — 8 exons

Exon	Start	End
ENSE00001623519	29936556	29936721
ENSE00001686868	29940682	29940876
ENSE00001696704	29943977	29944179
ENSE00001731841	29926452	29926632
ENSE00001835098	29989642	29989801
ENSE00001916752	29920109	29924115
ENSE00003478634	29955179	29955360
ENSE00003668151	29968909	29969068

Expression profiles

Bgee: expression breadth ubiquitous, 283 present calls, max score 99.57.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 24.9801 / max 255.3586, expressed in 1636 samples.

FANTOM5 promoters (9 alternative TSS)

Promoter ID	TPM avg	Samples expressed
83417	21.3065	1620
83418	1.7375	991
83416	1.0973	636
83419	0.4041	207
204403	0.1471	52
83415	0.1113	52
83413	0.0859	42
83414	0.0740	27
83420	0.0165	8

Top tissues by expression

294 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
trigeminal ganglion	UBERON:0001675	99.57	gold quality
cerebellar vermis	UBERON:0004720	99.55	gold quality
ventricular zone	UBERON:0003053	99.50	gold quality
pons	UBERON:0000988	99.48	gold quality
substantia nigra pars reticulata	UBERON:0001966	99.47	gold quality
superior vestibular nucleus	UBERON:0007227	99.42	gold quality
olfactory bulb	UBERON:0002264	99.36	gold quality
substantia nigra pars compacta	UBERON:0001965	99.34	gold quality
paraflocculus	UBERON:0005351	99.31	gold quality
dorsal root ganglion	UBERON:0000044	99.26	gold quality
ventral tegmental area	UBERON:0002691	99.24	gold quality
inferior vagus X ganglion	UBERON:0005363	99.19	gold quality
medulla oblongata	UBERON:0001896	99.18	gold quality
subthalamic nucleus	UBERON:0001906	99.08	gold quality
ganglionic eminence	UBERON:0004023	98.98	gold quality
dorsal plus ventral thalamus	UBERON:0001897	98.89	gold quality
cranial nerve II	UBERON:0000941	98.77	gold quality
lateral nuclear group of thalamus	UBERON:0002736	98.65	gold quality
lateral globus pallidus	UBERON:0002476	98.60	gold quality
parietal lobe	UBERON:0001872	98.57	gold quality
cerebellum	UBERON:0002037	98.56	gold quality
frontal pole	UBERON:0002795	98.52	gold quality
cerebellar cortex	UBERON:0002129	98.46	gold quality
cerebellar hemisphere	UBERON:0002245	98.43	gold quality
postcentral gyrus	UBERON:0002581	98.42	gold quality
corpus callosum	UBERON:0002336	98.41	gold quality
superior frontal gyrus	UBERON:0002661	98.32	gold quality
midbrain	UBERON:0001891	98.27	gold quality
inferior olivary complex	UBERON:0002127	98.25	gold quality
right hemisphere of cerebellum	UBERON:0014890	98.25	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-HCAD-13	yes	8.46
E-ANND-3	yes	4.78

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

82 targeting SCRN1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4747-5P	100.00	67.90	2681
HSA-MIR-5196-5P	100.00	67.98	2761
HSA-MIR-4795-3P	100.00	74.62	4024
HSA-MIR-4668-3P	100.00	68.74	2635
HSA-MIR-4476	100.00	68.18	2030
HSA-MIR-6876-5P	100.00	67.68	2126
HSA-MIR-188-3P	100.00	68.76	1240
HSA-MIR-499A-5P	99.98	70.79	1323
HSA-MIR-493-5P	99.96	72.47	2382
HSA-LET-7C-3P	99.95	73.42	2862
HSA-MIR-6835-3P	99.93	70.49	2904
HSA-MIR-5680	99.91	69.83	3421
HSA-MIR-8063	99.91	69.76	3146
HSA-MIR-8087	99.90	69.55	1351
HSA-MIR-4447	99.85	67.81	2900
HSA-MIR-3156-3P	99.76	66.72	939
HSA-MIR-6752-3P	99.72	66.71	1587
HSA-MIR-4306	99.72	70.50	3630
HSA-MIR-646	99.68	67.84	1645
HSA-MIR-10394-5P	99.65	66.83	1852
HSA-MIR-1205	99.65	66.76	1826
HSA-MIR-6516-3P	99.65	68.57	1238
HSA-MIR-1303	99.65	69.77	1662
HSA-MIR-1251-3P	99.64	67.21	1408
HSA-MIR-7150	99.62	66.80	1322
HSA-MIR-1260A	99.61	66.67	1098
HSA-MIR-1260B	99.61	66.67	1098
HSA-MIR-4261	99.59	70.30	3415
HSA-MIR-4328	99.57	71.06	4094
HSA-MIR-2053	99.57	69.15	1635

Literature-anchored findings (GeneRIF, showing 10)

• Purified and identified bovine secernin, in addition to bioinformatics analysis of similar proteins in mouse, rat and human. (PMID:12221138)
• SCRN1 expression is a prognostic factor in colorectal cancer patients (PMID:20039278)
• This protein has been found differentially expressed in the anterior cingulate cortex from patients with schizophrenia (PMID:20381070)
• in synovial sarcoma, metastasis-free survival was significantly higher in the group with high secernin-1 expression compared to low expression; results indicate secernin-1 may be used as a biomarker to predict overall and metastasis-free survival (PMID:21385630)
• A protein encoded by this locus was found to be differentially expressed in postmortem brains from patients with atypical frontotemporal lobar degeneration. (PMID:22360420)
• Luciferase report assay showed that the rs6976789 variant T allele influenced the binding ability of miR-148a. Our results suggested that the SCRN1 rs6976789 polymorphism may play an important role in the GC development and progression (PMID:25399950)
• Upregulation of SCRN1 is associated with acquired resistance to erlotinib in non-small cell lung cancer. (PMID:26883194)
• Secernin-1 is a novel phosphorylated tau binding protein that accumulates in Alzheimer’s disease and not in other tauopathies. (PMID:31796108)
• SCRN1: A cerebrospinal fluid biomarker correlating with tau in Alzheimer’s disease. (PMID:36946611)
• Knockdown of Secernin 1 inhibit cell invasion and migration by activating the TGF-beta/Smad3 pathway in oral squamous cell carcinomas. (PMID:37691034)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
mus_musculus	Scrn1	ENSMUSG00000019124
rattus_norvegicus	Scrn1	ENSRNOG00000009636
drosophila_melanogaster	CG10098	FBGN0037472

Paralogs (2): SCRN2 (ENSG00000141295), SCRN3 (ENSG00000144306)

Protein

Protein identifiers

Secernin-1 — Q12765 (reviewed: Q12765)

All UniProt accessions (5): A0A090N7T9, B8ZZP4, C9J7U9, C9K052, Q12765

UniProt curated annotations — full annotation on UniProt →

Function. Regulates exocytosis in mast cells. Increases both the extent of secretion and the sensitivity of mast cells to stimulation with calcium.

Subcellular location. Cytoplasm.

Miscellaneous. ‘Secern’ is an archaic English term meaning ‘secrete’.

Similarity. Belongs to the peptidase C69 family. Secernin subfamily.

Isoforms (3)

UniProt ID	Names	Canonical?
Q12765-1	1	yes
Q12765-2	2
Q12765-3	3

RefSeq proteins (4): NP_001138985, NP_001138986, NP_001138987, NP_055581* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR005322	Peptidase_C69	Family

Pfam: PF03577

UniProt features (10 total): splice variant 2, sequence variant 2, sequence conflict 2, initiator methionine 1, chain 1, active site 1, modified residue 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q12765-F1	94.17	0.86

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1): 9

Post-translational modifications (1): 2

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 174 (showing top): GSE45365_CTRL_VS_MCMV_INFECTION_NK_CELL_DN, VERHAAK_AML_WITH_NPM1_MUTATED_DN, GOZGIT_ESR1_TARGETS_DN, RACCACAR_AML_Q6, GOBP_VESICLE_MEDIATED_TRANSPORT, TOMLINS_PROSTATE_CANCER_DN, CAGCTG_AP4_Q5, GOBP_REGULATION_OF_VESICLE_MEDIATED_TRANSPORT, MODULE_66, MARTORIATI_MDM4_TARGETS_NEUROEPITHELIUM_DN, GOBP_EXOCYTOSIS, AML_Q6, SHEDDEN_LUNG_CANCER_GOOD_SURVIVAL_A4, YY1_02, GOMF_CYSTEINE_TYPE_PEPTIDASE_ACTIVITY

GO Biological Process (3): proteolysis (GO:0006508), exocytosis (GO:0006887), regulation of synaptic vesicle cycle (GO:0098693)

GO Molecular Function (3): dipeptidase activity (GO:0016805), cysteine-type exopeptidase activity (GO:0070004), protein binding (GO:0005515)

GO Cellular Component (4): nucleus (GO:0005634), cytoplasm (GO:0005737), nuclear membrane (GO:0031965), presynapse (GO:0098793)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
exopeptidase activity	2
cellular anatomical structure	2
protein metabolic process	1
vesicle-mediated transport	1
secretion by cell	1
vesicle fusion to plasma membrane	1
regulation of vesicle-mediated transport	1
synaptic vesicle cycle	1
cysteine-type peptidase activity	1
binding	1
intracellular membrane-bounded organelle	1
intracellular anatomical structure	1
nucleus	1
nuclear envelope	1
organelle membrane	1
synapse	1

Protein interactions and networks

STRING

684 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
SCRN1	VAPA	Q9P0L0	606
SCRN1	VWA8	A3KMH1	547
SCRN1	CIBAR1	A1XBS5	544
SCRN1	FSD1	Q9BTV5	521
SCRN1	CLHC1	Q8NHS4	521
SCRN1	NAA30	Q147X3	423
SCRN1	ENKD1	Q9H0I2	417
SCRN1	RHOC	P08134	388
SCRN1	CD34	P28906	388
SCRN1	BCL7A	Q4VC05	370
SCRN1	MARK1	Q9P0L2	370
SCRN1	GUF1	Q8N442	357
SCRN1	OR4F21	O95013	325
SCRN1	ZNF487	B1APH4	321
SCRN1	GARIN5A	Q6IPT2	310

IntAct

34 interactions, top by confidence:

A	B	Type	Score
SCRN1	MAPT	psi-mi:“MI:0915”(physical association)	0.620
POPDC3	SCRN1	psi-mi:“MI:0915”(physical association)	0.590
SCRN1	GORASP1	psi-mi:“MI:0915”(physical association)	0.560
GORASP1	SCRN1	psi-mi:“MI:0915”(physical association)	0.560
SCRN1	CCDC85C	psi-mi:“MI:0914”(association)	0.530
CCDC121	SCRN1	psi-mi:“MI:0914”(association)	0.530
SNRNP27	UBA6	psi-mi:“MI:0914”(association)	0.530
ARL6IP6	YKT6	psi-mi:“MI:0914”(association)	0.530
CDK5R1	DENR	psi-mi:“MI:0914”(association)	0.530
CTSZ	SCRN1	psi-mi:“MI:0915”(physical association)	0.400
FGB	NME2	psi-mi:“MI:0914”(association)	0.350
CUL4B	GGTLC3	psi-mi:“MI:0914”(association)	0.350
MAPT	SEPTIN8	psi-mi:“MI:0914”(association)	0.350
MAPT	SHTN1	psi-mi:“MI:0914”(association)	0.350
SHANK3	IGKV3D-15	psi-mi:“MI:0914”(association)	0.350
DYRK1A	TEX13D	psi-mi:“MI:0914”(association)	0.350
MBD5	NME2P1	psi-mi:“MI:0914”(association)	0.350
FCGR2A	STAMBP	psi-mi:“MI:0914”(association)	0.350
FBXO25	ARHGAP1	psi-mi:“MI:0914”(association)	0.350
MFI	SCRN1	psi-mi:“MI:0914”(association)	0.350
DNAJB6	SCAMP1	psi-mi:“MI:0914”(association)	0.350
SCRN2	IFI30	psi-mi:“MI:0914”(association)	0.350
COX10	SUOX	psi-mi:“MI:0914”(association)	0.350
TNFRSF11B	SCRN1	psi-mi:“MI:0914”(association)	0.350

BioGRID (72): GORASP1 (Two-hybrid), TAB2 (Affinity Capture-MS), TAB1 (Affinity Capture-MS), CD3EAP (Affinity Capture-MS), MAP3K7 (Affinity Capture-MS), CCDC85C (Affinity Capture-MS), DENND4A (Affinity Capture-MS), CTU1 (Affinity Capture-MS), SCRN1 (Affinity Capture-MS), SCRN1 (Affinity Capture-MS), VAPA (Affinity Capture-MS), SCRN1 (Affinity Capture-MS), SCRN1 (Affinity Capture-MS), SCRN1 (Two-hybrid), ZNF25 (Two-hybrid)

ESM2 similar proteins: A2AV36, A2VD33, A4IG42, A4IG53, A5PJN5, A6QLU7, E9PYK3, F4JVN6, G1T7U7, H0VCJ6, O95050, O95497, P42700, P42898, P51687, P79106, P83006, P83939, Q02083, Q0V984, Q0VDG4, Q0ZHH6, Q12765, Q17QS0, Q1LWG4, Q3TMH2, Q58CQ9, Q5KTC7, Q5R8R3, Q5TYS5, Q5XH17, Q60HE5, Q6AY84, Q6DD88, Q7Z3D6, Q803W1, Q84VX0, Q8BNE1, Q8R086, Q8VDG7

Diamond homologs: P83939, Q0V984, Q0VDG4, Q12765, Q17QS0, Q3TMH2, Q5TYS5, Q5XH17, Q6AY84, Q6AYR8, Q803W1, Q8VCA8, Q96FV2, Q9CZC8

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

71 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	54
Likely benign	3
Benign	1

Top pathogenic / likely-pathogenic (0)

SpliceAI

1637 predictions. Top by Δscore:

Variant	Effect	Δscore
7:29923954:A:AC	donor_gain	1.0000
7:29923954:ACTT:A	donor_gain	1.0000
7:29923955:C:CT	donor_gain	1.0000
7:29923955:CTT:C	donor_gain	1.0000
7:29923955:CTTC:C	donor_gain	1.0000
7:29923955:CTTCA:C	donor_gain	1.0000
7:29923957:T:TA	donor_gain	1.0000
7:29923963:A:AC	donor_gain	1.0000
7:29923972:A:AC	donor_gain	1.0000
7:29923972:AAT:A	donor_gain	1.0000
7:29923972:AATCT:A	donor_gain	1.0000
7:29924012:T:TA	donor_gain	1.0000
7:29924013:C:A	donor_gain	1.0000
7:29926448:TCA:T	donor_loss	1.0000
7:29926450:ACCTG:A	donor_loss	1.0000
7:29926451:C:CG	donor_loss	1.0000
7:29926451:CCTGG:C	donor_gain	1.0000
7:29943973:TCACC:T	donor_loss	1.0000
7:29943974:CA:C	donor_loss	1.0000
7:29943976:C:CT	donor_loss	1.0000
7:29944004:T:TA	donor_gain	1.0000
7:29944005:C:A	donor_gain	1.0000
7:29955356:GTGCA:G	acceptor_gain	1.0000
7:29955357:TGCA:T	acceptor_gain	1.0000
7:29955358:GCA:G	acceptor_gain	1.0000
7:29955358:GCAC:G	acceptor_loss	1.0000
7:29955359:CA:C	acceptor_gain	1.0000
7:29955359:CAC:C	acceptor_gain	1.0000
7:29955361:C:CC	acceptor_gain	1.0000
7:29955362:T:G	acceptor_loss	1.0000

AlphaMissense

2753 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
7:29926620:C:A	K306N	0.997
7:29926620:C:G	K306N	0.997
7:29936630:A:C	S277R	0.996
7:29936630:A:T	S277R	0.996
7:29936632:T:G	S277R	0.996
7:29923985:A:T	V406D	0.994
7:29926631:A:G	S303P	0.993
7:29936685:C:G	R259P	0.992
7:29955297:A:G	W75R	0.991
7:29955297:A:T	W75R	0.991
7:29955189:C:G	D111H	0.990
7:29926622:T:C	K306E	0.989
7:29955288:C:G	G78R	0.989
7:29955288:C:T	G78R	0.989
7:29926623:G:C	F305L	0.988
7:29926623:G:T	F305L	0.988
7:29926625:A:G	F305L	0.988
7:29955287:C:T	G78E	0.987
7:29955307:G:C	S71R	0.987
7:29955307:G:T	S71R	0.987
7:29955309:T:G	S71R	0.987
7:29968994:C:T	G25E	0.987
7:29969036:A:T	V11D	0.987
7:29926624:A:G	F305S	0.986
7:29944179:C:A	R114S	0.986
7:29944179:C:G	R114S	0.986
7:29955268:A:C	N84K	0.986
7:29955268:A:T	N84K	0.986
7:29926614:G:C	F308L	0.985
7:29926614:G:T	F308L	0.985

dbSNP variants (sampled 300 via entrez): RS1000114990 (7:29979831 A>G), RS1000136056 (7:29980813 A>G), RS1000155865 (7:29990833 C>G,T), RS1000182312 (7:29930305 C>T), RS1000233207 (7:29974487 A>G), RS1000236999 (7:29960703 TACACACACACACATCC>T,TACACACACACACATCCACACACACACACATCC), RS1000275506 (7:29941240 C>T), RS1000328144 (7:29985847 T>C), RS1000337749 (7:29953430 C>T), RS1000346586 (7:29986046 C>T), RS1000384677 (7:29991528 G>C), RS1000439120 (7:29967748 C>A,T), RS1000468352 (7:29919806 C>G), RS1000560717 (7:29947782 G>T), RS1000696349 (7:29968170 T>C)

Disease associations

OMIM: gene MIM:614965 | disease phenotypes:

GenCC curated gene-disease

Mondo (1): prostate cancer (MONDO:0008315)

Orphanet (1): Familial prostate cancer (Orphanet:1331)

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST001762_941	Obesity-related traits	9.000000e-06
GCST008479_24	Psoriasis	4.000000e-53

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0005189	respiratory quotient

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D011471	Prostatic Neoplasms	C04.588.945.440.770; C12.100.500.260.750; C12.100.500.565.625; C12.200.294.260.750; C12.200.294.565.625; C12.200.758.409.750; C12.900.619.750

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

47 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	increases expression, affects expression, decreases expression	4
Aflatoxin B1	increases expression	3
bisphenol A	increases expression	2
Decitabine	affects expression, increases expression	2
Air Pollutants	affects expression, increases abundance, decreases expression	2
Benzo(a)pyrene	affects methylation, decreases methylation, increases expression	2
Cisplatin	affects expression, affects response to substance	2
Cyclosporine	decreases expression, increases expression	2
aristolochic acid I	increases expression	1
methyleugenol	increases expression	1
triphenyl phosphate	affects expression	1
arsenite	affects binding, decreases reaction	1
cobaltous chloride	decreases expression	1
butyraldehyde	decreases expression	1
ochratoxin A	increases expression	1
azoxystrobin	decreases expression	1
deguelin	decreases expression	1
entinostat	increases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
pyrimidifen	decreases expression	1
ICG 001	increases expression	1
bisphenol B	increases expression	1
abrine	increases expression	1
LDN 193189	affects cotreatment, increases expression	1
picoxystrobin	decreases expression	1
bisphenol AF	increases expression	1
Resveratrol	affects cotreatment, increases expression	1
Vorinostat	decreases expression	1
Acetaminophen	increases expression	1
Atrazine	increases expression	1

Clinical trials (associated diseases)

300 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00029224	PHASE4	COMPLETED	Treatment With Zoledronic Acid in Patients With Breast Cancer, Multiple Myeloma, and Prostate Cancer With Cancer Related Bone Lesions
NCT00035997	PHASE4	COMPLETED	Open-label Trial on the Effect of I.V. Zoledronic Acid 4 mg on Bone Density in Hormone Sensitive Prostate Cancer Patients With Bone Metastasis
NCT00063609	PHASE4	COMPLETED	The Effect of Zoledronic Acid on Bone Loss in Prostate Cancer Patients Undergoing Androgen Deprivation Therapy
NCT00103623	PHASE4	SUSPENDED	The Plenaxis® Experience Study
NCT00106392	PHASE4	COMPLETED	A Safety and Efficacy Study of Prograf in the Prevention of Erectile Dysfunction After Radical Prostatectomy
NCT00185029	PHASE4	UNKNOWN	MR-Lymphography and Lymph Node Staging in Prostate Cancer
NCT00199485	PHASE4	COMPLETED	Angelica Sinensis for the Treatment of Hot Flashes in Men Undergoing LHRH Therapy for Prostate Cancer
NCT00219219	PHASE4	COMPLETED	Zoledronic Acid in the Prevention of Skeletal-related Events in Hormone Refractory and Hormone-sensitive Prostate Cancer Patients With Bone Metastases
NCT00219271	PHASE4	COMPLETED	Effect Of Zoledronic Acid On Circulating And Bone Marrow-Residing Prostate Cancer Cells In Patients With Clinically Localized Prostate Cancer
NCT00237146	PHASE4	COMPLETED	Study to Evaluate Zoledronic Acid on Quality of Life and Skeletal-related Events as Adjuvant Treatment in Patients With Hormone-naïve Prostate Cancer and Bone Metastasis Who Have Undergone Orchiectomy
NCT00242554	PHASE4	COMPLETED	Open-label Phase IV Clinical Trial to Evaluate the Safety and Tolerability of Zoledronic Acid in Patients With Prostate Cancer and Bone Metastases
NCT00280098	PHASE4	COMPLETED	Docetaxel in the Treatment of Hormone Refractory Prostate Cancer
NCT00293696	PHASE4	COMPLETED	Casodex/Zoladex Biomarkers in Localised Prostate Cancer
NCT00334139	PHASE4	COMPLETED	Effect of Zoledronic Acid on Bone Metabolism in Patients With Bone Metastasis and Prostate or Breast Cancer
NCT00375765	PHASE4	COMPLETED	Effects On Dihydrotestosterone Regulated Gene Expression In Benign Prostatic Hyperplasia Or Prostate Cancer
NCT00391690	PHASE4	COMPLETED	Evaluation of Bone Markers as Diagnostic Tools for Early Detection of Bone Metastases in Patients With High Risk Prostate Cancer
NCT00422708	PHASE4	COMPLETED	Local Anesthesia for Prostate Biopsy
NCT00526331	PHASE4	COMPLETED	Evaluation of Arterial Pressure Based Cardiac Output for Goal-Directed Perioperative Therapy
NCT00590213	PHASE4	COMPLETED	Compare the Value of Prophylactic Versus Therapeutic Breast Radiotherapy in CASODEX
NCT00629330	PHASE4	TERMINATED	Dissemination of Prostate Cancer Screening to PCP’s in African American Communities
NCT00771966	PHASE4	COMPLETED	Radical Prostatectomy and Perioperative Fluid Therapy
NCT00805701	PHASE4	COMPLETED	Study Assessing The Efficacy And Safety Of Avodart (Dutasteride) At Improving Urinary Symptoms In Men With Prostate Cancer Who Are Undergoing Seed Implantation
NCT00859027	PHASE4	COMPLETED	Effect Of Risedronate On Bone Mass In Older Men Receiving Neoadjuvant Therapy For Prostate Cancer
NCT00906269	PHASE4	UNKNOWN	Can Hyperbaric Oxygen Improve Erectile Function Following Surgery for Prostate Cancer
NCT00953277	PHASE4	COMPLETED	Study of Nerve Reconstruction Using AVANCE in Subjects Who Undergo Robotic Assisted Prostatectomy for Treatment of Prostate Cancer
NCT00982800	PHASE4	COMPLETED	Does Postoperative Gabapentin Reduce Pain, Opioid Consumption and Anxiety and Have a Positive Effect on Health Related Quality of Life After Radical Prostatectomy?
NCT01083199	PHASE4	COMPLETED	Global Performance Evaluation of the AMS CONTINUUM™ Device
NCT01136226	PHASE4	COMPLETED	Evaluate Recovery of Testosterone for Patients Using Eligard
NCT01161563	PHASE4	COMPLETED	Randomized Crossover Trial to Assess the Tolerability of Gonadotropin Releasing Hormone (GnRH) Analogue Administration
NCT01230905	PHASE4	COMPLETED	Study to Monitor the Effects of Androgen Suppression Treatment on the Heart
NCT01296672	PHASE4	COMPLETED	3 Month Finasteride Challenge Test Can Significantly Improve the Performance of Screening for Prostate Cancer
NCT01365143	PHASE4	TERMINATED	Prospective Randomized Trial Comparing Robotic Versus Open Radical Prostatectomy
NCT01379742	PHASE4	UNKNOWN	Comparison of Between ThinSeed™ and OncoSeed™ for Permanent Prostate Brachytherapy
NCT01486563	PHASE4	COMPLETED	Hydroxyethyl Starch and Renal Function After Radical Prostatectomy
NCT01511874	PHASE4	COMPLETED	Efficacy and Safety Study of ELIGARD 22.5mg With Prostate Cancer
NCT01512472	PHASE4	TERMINATED	Firmagon (Degarelix) Intermittent Therapy
NCT01547416	PHASE4	COMPLETED	The Effect of Combined General/Epidural Anesthesia Versus General Anesthesia on Diaphragmatic Function
NCT01571544	PHASE4	COMPLETED	The Use of Thermal Suits as Preventing Hypothermia During Surgery
NCT01581749	PHASE4	UNKNOWN	Evaluation of Truebeam for Low-Intermediate Risk Prostate Cancer
NCT01649635	PHASE4	COMPLETED	Study of Cabazitaxel Combined With Prednisone and Prophylaxis of Neutropenia Complications in the Treatment of Patients With Metastatic Castration-resistant Prostate Cancer