SCYGR2

Summary

SCYGR2 (small cysteine and glycine repeat containing 2, HGNC:34220) is a protein-coding gene on chromosome 2q36.3, encoding Small cysteine and glycine repeat-containing protein 2 (A0A286YFB4). In the hair cortex, hair keratin intermediate filaments are embedded in an interfilamentous matrix, consisting of hair keratin-associated proteins (KRTAP), which are essential for the formation of a rigid and resistant hair shaft through their extensive disulfide bond cross-link….

Predicted to be located in intermediate filament.

Source: NCBI Gene 112441435 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 2 total
• MANE Select transcript: NM_001395403

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:34220
Approved symbol	SCYGR2
Name	small cysteine and glycine repeat containing 2
Location	2q36.3
Locus type	gene with protein product
Status	Approved
Aliases	KRTAP28-2
Ensembl gene	ENSG00000284643
Ensembl biotype	protein_coding
Entrez	112441435

Gene structure

Transcript identifiers

Ensembl transcripts: 1 — 1 protein_coding

ENST00000641394

RefSeq mRNA: 1 — MANE Select: NM_001395403 NM_001395403

CCDS: CCDS92953

Canonical transcript exons

ENST00000641394 — 1 exons

Exon	Start	End
ENSE00003812805	227598893	227599255

Expression profiles

Bgee: expression breadth broad, 13 present calls, max score 37.20.

Top tissues by expression

115 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
colonic epithelium	UBERON:0000397	37.20	gold quality
ventricular zone	UBERON:0003053	36.48	gold quality
cortical plate	UBERON:0005343	36.47	gold quality
bone marrow cell	CL:0002092	36.16	gold quality
ganglionic eminence	UBERON:0004023	35.49	gold quality
skeletal muscle tissue	UBERON:0001134	33.38	gold quality
hindlimb stylopod muscle	UBERON:0004252	32.15	gold quality
bone marrow	UBERON:0002371	31.74	gold quality
muscle tissue	UBERON:0002385	31.06	gold quality
sural nerve	UBERON:0015488	30.93	gold quality
stromal cell of endometrium	CL:0002255	29.87	gold quality
skin of abdomen	UBERON:0001416	29.63	gold quality
prefrontal cortex	UBERON:0000451	29.28	gold quality
liver	UBERON:0002107	29.17	gold quality
duodenum	UBERON:0002114	28.14	gold quality
zone of skin	UBERON:0000014	27.85	gold quality
lymph node	UBERON:0000029	27.57	gold quality
blood	UBERON:0000178	27.06	gold quality
tonsil	UBERON:0002372	27.05	gold quality
skin of leg	UBERON:0001511	26.63	gold quality
islet of Langerhans	UBERON:0000006	26.55	gold quality
vermiform appendix	UBERON:0001154	26.42	gold quality
gall bladder	UBERON:0002110	25.98	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	25.89	gold quality
placenta	UBERON:0001987	25.81	gold quality
urinary bladder	UBERON:0001255	25.72	gold quality
leukocyte	CL:0000738	24.80	gold quality
primary visual cortex	UBERON:0002436	24.61	gold quality
monocyte	CL:0000576	24.52	gold quality
frontal cortex	UBERON:0001870	24.17	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	0.20

Regulation

Is transcription factor: no

Cross-species orthologs

0 orthologs

Protein

Protein identifiers

Small cysteine and glycine repeat-containing protein 2 — A0A286YFB4 (reviewed: A0A286YFB4)

Alternative names: Keratin-associated protein 28-2

All UniProt accessions (1): A0A286YFB4

UniProt curated annotations — full annotation on UniProt →

Function. In the hair cortex, hair keratin intermediate filaments are embedded in an interfilamentous matrix, consisting of hair keratin-associated proteins (KRTAP), which are essential for the formation of a rigid and resistant hair shaft through their extensive disulfide bond cross-linking with abundant cysteine residues of hair keratins. The matrix proteins include the high-sulfur and high-glycine-tyrosine keratins.

Miscellaneous. Human have a similar number of genes as other primates despite the relative hairlessness of humans.

Similarity. Belongs to the KRTAP type 28 family.

RefSeq proteins (1): NP_001382332* (*=MANE)

Domains & families (InterPro)

UniProt features (2 total): chain 1, region of interest 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-A0A286YFB4-F1	40.28	0.00

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 5 (showing top): GOCC_INTERMEDIATE_FILAMENT_CYTOSKELETON, GOCC_SUPRAMOLECULAR_COMPLEX, GOCC_POLYMERIC_CYTOSKELETAL_FIBER, GOCC_SUPRAMOLECULAR_POLYMER, chr2q36

GO Biological Process (0):

GO Molecular Function (0):

GO Cellular Component (1): intermediate filament (GO:0005882)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
intermediate filament cytoskeleton	1
polymeric cytoskeletal fiber	1

Protein interactions and networks

STRING

0 interactions, top by confidence (×1000):

IntAct

0 interactions, top by confidence:

ESM2 similar proteins: A0A286YEV6, A0A286YEX9, A0A286YEY9, A0A286YF01, A0A286YF46, A0A286YF60, A0A286YF77, A0A286YFB4, A0A286YFG1, O14633, P02438, P04459, P05687, P05688, P08131, P08175, P0DSO2, P20730, Q01642, Q01643, Q01644, Q01645, Q07627, Q3LI58, Q3LI59, Q3V2C1, Q5T750, Q5T752, Q5T754, Q5TA78, Q5TA79, Q5TA81, Q5TA82, Q5TCM9, Q8IUC1, Q8IUG1, Q9BQ66, Q9BYP8, Q9BYQ5, Q9BYQ6

Diamond homologs: A0A286YEV6, A0A286YEX9, A0A286YEY9, A0A286YF01, A0A286YF60, A0A286YF77, A0A286YFB4, A0A286YFG1, P0DSO2

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

2 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	1
Likely benign	1
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

0 predictions. Top by Δscore:

AlphaMissense

772 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
2:227599144:C:G	C84W	0.954
2:227599142:T:C	C84R	0.952
2:227599162:T:G	C90W	0.947
2:227599160:T:C	C90R	0.945
2:227599079:T:C	C63R	0.943
2:227599142:T:A	C84S	0.943
2:227599143:G:C	C84S	0.943
2:227599143:G:A	C84Y	0.942
2:227599081:C:G	C63W	0.925
2:227599109:T:C	C73R	0.925
2:227599118:T:C	C76R	0.925
2:227599120:C:G	C76W	0.924
2:227599111:C:G	C73W	0.920
2:227599131:G:A	C80Y	0.915
2:227599106:T:C	C72R	0.914
2:227599139:T:C	C83R	0.912
2:227599160:T:A	C90S	0.912
2:227599161:G:C	C90S	0.912
2:227599119:G:A	C76Y	0.909
2:227599161:G:A	C90Y	0.909
2:227599165:C:G	C91W	0.908
2:227599082:T:G	Y64D	0.907
2:227599108:C:G	C72W	0.907
2:227599127:T:C	C79R	0.905
2:227599115:T:C	C75R	0.901
2:227599132:T:G	C80W	0.901
2:227599118:T:A	C76S	0.896
2:227599119:G:C	C76S	0.896
2:227599130:T:C	C80R	0.894
2:227599163:T:C	C91R	0.893

dbSNP variants (sampled 300 via entrez): RS1001650933 (2:227598643 T>C), RS1002540729 (2:227597676 C>T), RS1002655540 (2:227597209 G>T), RS1003874529 (2:227596893 C>T), RS1007221706 (2:227599443 C>A,T), RS1007438379 (2:227599206 A>G), RS1007747121 (2:227599172 C>T), RS1008483126 (2:227598284 T>G), RS1010173134 (2:227597727 C>T), RS1010513879 (2:227599397 A>T), RS1011710978 (2:227599033 CGGTGGTGGCTGT>C,CGGTGGTGGCTGTGGTGGTGGCTGT), RS1012031952 (2:227598947 T>C), RS1014256775 (2:227597285 A>G), RS1014414185 (2:227599135 A>G), RS1014943109 (2:227598983 T>C)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.