SDHA

Summary

SDHA (succinate dehydrogenase complex flavoprotein subunit A, HGNC:10680) is a protein-coding gene on chromosome 5p15.33, encoding Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial (P31040). Flavoprotein (FP) subunit of succinate dehydrogenase (SDH) that is involved in complex II of the mitochondrial electron transport chain and is responsible for transferring electrons from succinate to ubiquinone (coenzyme Q). It is a selective cancer dependency (DepMap: 24.6% of cell lines).

This gene encodes a major catalytic subunit of succinate-ubiquinone oxidoreductase, a complex of the mitochondrial respiratory chain. The complex is composed of four nuclear-encoded subunits and is localized in the mitochondrial inner membrane. Mutations in this gene have been associated with a form of mitochondrial respiratory chain deficiency known as Leigh Syndrome. A pseudogene has been identified on chromosome 3q29. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Source: NCBI Gene 6389 — RefSeq curated summary.

At a glance

• Gene–disease (curated): hereditary pheochromocytoma-paraganglioma (Definitive, ClinGen) — +9 more curated relationships
• GWAS associations: 2
• Clinical variants (ClinVar): 3,368 total — 190 pathogenic, 100 likely-pathogenic (top 1% of genes corpus-wide)
• GTEx eGene: eQTL in 44 tissues, sQTL in 38 (q < 0.05)
• Phenotypes (HPO): 195
• ChEMBL bioactivity: 1 clinical-phase molecule tested; no curated mechanism-of-action drug
• Cancer driver (intOGen): activating (oncogene-like) across 3 cancer types (inferred from mutation patterns)
• Cancer dependency (DepMap): dependent in 24.6% of screened cell lines
• Constraint (gnomAD): pLI 0.00 (LoF-tolerant), LOEUF 0.79 (unconstrained)
• MANE Select transcript: NM_004168
• Interaction hub: 4,474 STRING partners (top 1% of genes corpus-wide)

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:10680
Approved symbol	SDHA
Name	succinate dehydrogenase complex flavoprotein subunit A
Location	5p15.33
Locus type	gene with protein product
Status	Approved
Aliases	FP, SDHF
Ensembl gene	ENSG00000073578
Ensembl biotype	protein_coding
OMIM	600857
Entrez	6389

Gene structure

Transcript identifiers

Ensembl transcripts: 109 — 71 protein_coding, 25 nonsense_mediated_decay, 10 retained_intron, 3 protein_coding_CDS_not_defined

MANE Select: ENST00000264932

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 1, TSL 2: 8, TSL 3: 3, TSL 4: 2, TSL 5: 5

ENST00000264932, ENST00000502379, ENST00000503674, ENST00000504309, ENST00000504824, ENST00000505555, ENST00000507266, ENST00000507522, ENST00000509082, ENST00000509420, ENST00000509564, ENST00000509632, ENST00000510361, ENST00000511810, ENST00000512962, ENST00000514027, ENST00000514233, ENST00000515752, ENST00000515815, ENST00000874233, ENST00000874234, ENST00000874235, ENST00000874236, ENST00000874237, ENST00000874238, ENST00000874239, ENST00000874240, ENST00000874241, ENST00000874242, ENST00000874243, ENST00000874244, ENST00000874245, ENST00000874246, ENST00000874247, ENST00000874248, ENST00000925263, ENST00000952707, ENST00000952708, ENST00000952709, ENST00000952710, ENST00000952711, ENST00000952712, ENST00000952713, ENST00000952714, ENST00000952715, ENST00000952716, ENST00001005961, ENST00001005962, ENST00001005963, ENST00001005964, ENST00001005966, ENST00001005967, ENST00001033132, ENST00001033134, ENST00001033137, ENST00001033139, ENST00001033151, ENST00001033152, ENST00001033153, ENST00001033155, ENST00001033157, ENST00001033167, ENST00001033169, ENST00001033170, ENST00001033171, ENST00001033175, ENST00001033177, ENST00001096609, ENST00001096610, ENST00001096611, ENST00001096612, ENST00001096613, ENST00001096614, ENST00001096615, ENST00001096616, ENST00001096617, ENST00001096618, ENST00001096619, ENST00001096620, ENST00001096621, ENST00001096622, ENST00001096623, ENST00001096624, ENST00001096625, ENST00001096626, ENST00001096627, ENST00001096628, ENST00001096629, ENST00001096630, ENST00001096631, ENST00001096632, ENST00001096633, ENST00001096634, ENST00001110867, ENST00001122134, ENST00001122135, ENST00001122136, ENST00001122137, ENST00001127763, ENST00001127764, ENST00001127765, ENST00001127766, ENST00001127767, ENST00001127768, ENST00001127769, ENST00001127770, ENST00001127771, ENST00001127772, ENST00001133626

RefSeq mRNA: 3 — MANE Select: NM_004168 NM_001294332, NM_001330758, NM_004168

CCDS: CCDS3853, CCDS77992, CCDS82985

Canonical transcript exons

ENST00000264932 — 15 exons

Exon	Start	End
ENSE00001742892	256334	257082
ENSE00003483620	250992	251103
ENSE00003487513	230876	231000
ENSE00003509516	240358	240476
ENSE00003524126	251338	251468
ENSE00003576167	235144	235339
ENSE00003590655	223482	223568
ENSE00003593538	236428	236599
ENSE00003597004	228185	228333
ENSE00003609834	233477	233645
ENSE00003626939	225883	226047
ENSE00003655301	224360	224521
ENSE00003686438	254393	254506
ENSE00003687557	225419	225562
ENSE00003845083	218320	218418

Expression profiles

Bgee: expression breadth ubiquitous, 143 present calls, max score 99.47.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 50.5767 / max 399.4308, expressed in 1825 samples.

Highest expression (Bgee): apex of heart, heart left ventricle, mucosa of transverse colon, atrium auricular region, skeletal muscle tissue.

Genetic regulation across tissues (GTEx eQTL / sQTL)

SDHA is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 44 tissues and its splicing (sQTL) in 38 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 82 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Cells Cultured fibroblasts	eqtl	5.6e-44	+0.41	5:225213:A:AG
Whole Blood	eqtl	3.1e-38	-0.29	5:263398:T:C
Testis	eqtl	1.4e-35	-0.59	5:202167:C:T
Artery Tibial	sqtl	7.4e-29	+0.87	5:230178:C:T
Heart Atrial Appendage	eqtl	1.5e-28	-0.56	5:202254:C:T
Artery Tibial	eqtl	2.7e-23	-0.57	5:205205:G:A
Nerve Tibial	sqtl	1.7e-20	+0.80	5:296882:G:A
Adipose Subcutaneous	eqtl	3.4e-20	+0.33	5:271742:CCCGGCCCTGGGG:C
Adipose Subcutaneous	sqtl	2.9e-19	-0.75	5:270963:T:C
Esophagus Mucosa	eqtl	4.8e-19	-0.40	5:296882:G:A
Cells Cultured fibroblasts	sqtl	1.4e-17	+0.67	5:232522:G:A
Skin Not Sun Exposed Suprapubic	sqtl	2.6e-17	-0.75	5:246445:G:A
Heart Left Ventricle	eqtl	1.3e-16	-0.44	5:322932:C:T
Thyroid	sqtl	2.0e-16	+1.06	5:236071:C:G
Muscle Skeletal	eqtl	1.2e-15	-0.34	5:279598:G:C
Colon Transverse	sqtl	5.6e-15	+0.69	5:244251:A:G
Artery Aorta	eqtl	1.0e-14	-0.65	5:205205:G:A
Lung	sqtl	5.9e-14	+0.60	5:239224:T:TAA
Testis	sqtl	3.4e-13	+0.76	5:294490:A:G
Spleen	sqtl	3.4e-13	-0.94	5:265991:ATTCAGTCCTGGGGGAACCCCACCCCAGACCTTCCGATTCAGTCCTGGAGGGACCCTACCCCAGATCTTCCGG:A

FANTOM5 promoters

2 alternative TSS:

Promoter ID	TPM avg	Samples expressed
55459	48.4006	1825
55460	2.1760	1303

Top tissues by expression

showing 100 of 143 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
apex of heart	UBERON:0002098	99.47	gold quality
heart left ventricle	UBERON:0002084	99.33	gold quality
mucosa of transverse colon	UBERON:0004991	99.04	gold quality
right atrium auricular region	UBERON:0006631	99.03	gold quality
skeletal muscle tissue	UBERON:0001134	99.00	gold quality
hindlimb stylopod muscle	UBERON:0004252	98.89	gold quality
heart	UBERON:0000948	98.75	gold quality
gastrocnemius	UBERON:0001388	98.71	gold quality
duodenum	UBERON:0002114	98.71	gold quality
right lobe of liver	UBERON:0001114	98.65	gold quality
muscle organ	UBERON:0001630	98.60	gold quality
skeletal muscle organ	UBERON:0014892	98.60	gold quality
muscle of leg	UBERON:0001383	98.58	gold quality
right adrenal gland cortex	UBERON:0035827	98.53	gold quality
adult mammalian kidney	UBERON:0000082	98.49	gold quality
liver	UBERON:0002107	98.47	gold quality
right adrenal gland	UBERON:0001233	98.44	gold quality
primary visual cortex	UBERON:0002436	98.44	gold quality
cortex of kidney	UBERON:0001225	98.35	gold quality
left adrenal gland	UBERON:0001234	98.34	gold quality
left adrenal gland cortex	UBERON:0035825	98.33	gold quality
metanephros cortex	UBERON:0010533	98.31	gold quality
colonic epithelium	UBERON:0000397	98.19	gold quality
transverse colon	UBERON:0001157	98.18	gold quality
adrenal gland	UBERON:0002369	98.10	gold quality
muscle tissue	UBERON:0002385	98.08	gold quality
kidney	UBERON:0002113	97.90	gold quality
lower esophagus mucosa	UBERON:0035834	97.76	gold quality
right frontal lobe	UBERON:0002810	97.75	gold quality
colon	UBERON:0001155	97.71	gold quality
adrenal tissue	UBERON:0018303	97.69	gold quality
small intestine Peyer’s patch	UBERON:0003454	97.68	gold quality
fundus of stomach	UBERON:0001160	97.67	gold quality
frontal cortex	UBERON:0001870	97.65	gold quality
small intestine	UBERON:0002108	97.63	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	97.63	gold quality
intestine	UBERON:0000160	97.62	gold quality
body of stomach	UBERON:0001161	97.61	gold quality
superior frontal gyrus	UBERON:0002661	97.61	gold quality
Brodmann (1909) area 9	UBERON:0013540	97.59	gold quality
right hemisphere of cerebellum	UBERON:0014890	97.59	gold quality
prefrontal cortex	UBERON:0000451	97.56	gold quality
cerebellum	UBERON:0002037	97.55	gold quality
cerebellar cortex	UBERON:0002129	97.54	gold quality
lower esophagus	UBERON:0013473	97.53	gold quality
lower esophagus muscularis layer	UBERON:0035833	97.53	gold quality
cerebellar hemisphere	UBERON:0002245	97.52	gold quality
cerebral cortex	UBERON:0000956	97.47	gold quality
rectum	UBERON:0001052	97.47	gold quality
substantia nigra	UBERON:0002038	97.47	gold quality
muscle layer of sigmoid colon	UBERON:0035805	97.34	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	97.24	gold quality
stomach	UBERON:0000945	97.22	gold quality
anterior cingulate cortex	UBERON:0009835	97.21	gold quality
hypothalamus	UBERON:0001898	97.16	gold quality
brain	UBERON:0000955	97.12	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	97.12	gold quality
ventricular zone	UBERON:0003053	97.11	gold quality
Ammon’s horn	UBERON:0001954	97.04	gold quality
left ovary	UBERON:0002119	96.96	gold quality
ovary	UBERON:0000992	96.88	gold quality
bone marrow cell	CL:0002092	96.86	gold quality
temporal lobe	UBERON:0001871	96.86	gold quality
putamen	UBERON:0001874	96.85	gold quality
amygdala	UBERON:0001876	96.84	gold quality
right uterine tube	UBERON:0001302	96.75	gold quality
right ovary	UBERON:0002118	96.73	gold quality
esophagus	UBERON:0001043	96.68	gold quality
subcutaneous adipose tissue	UBERON:0002190	96.64	gold quality
mucosa of stomach	UBERON:0001199	96.61	gold quality
material anatomical entity	UBERON:0000465	96.58	gold quality
multicellular organism	UBERON:0000468	96.58	gold quality
nerve	UBERON:0001021	96.58	gold quality
tibial nerve	UBERON:0001323	96.58	gold quality
anatomical system	UBERON:0000467	96.57	gold quality
caudate nucleus	UBERON:0001873	96.57	gold quality
spleen	UBERON:0002106	96.56	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	96.56	gold quality
right lung	UBERON:0002167	96.54	gold quality
mammary gland	UBERON:0001911	96.49	gold quality
thoracic mammary gland	UBERON:0005200	96.49	gold quality
urinary bladder	UBERON:0001255	96.44	gold quality
adipose tissue	UBERON:0001013	96.43	gold quality
left testis	UBERON:0004533	96.40	gold quality
stromal cell of endometrium	CL:0002255	96.37	gold quality
nucleus accumbens	UBERON:0001882	96.34	gold quality
body of pancreas	UBERON:0001150	96.31	gold quality
left lobe of thyroid gland	UBERON:0001120	96.27	gold quality
right testis	UBERON:0004534	96.24	gold quality
saliva-secreting gland	UBERON:0001044	96.23	gold quality
minor salivary gland	UBERON:0001830	96.20	gold quality
adenohypophysis	UBERON:0002196	96.20	gold quality
vagina	UBERON:0000996	96.19	gold quality
tonsil	UBERON:0002372	96.18	gold quality
omental fat pad	UBERON:0010414	96.18	gold quality
pituitary gland	UBERON:0000007	96.09	gold quality
prostate gland	UBERON:0002367	96.09	gold quality
body of uterus	UBERON:0009853	96.09	gold quality
thyroid gland	UBERON:0002046	96.07	gold quality
right lobe of thyroid gland	UBERON:0001119	96.06	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	9.25
E-MTAB-7606	no	547.34

HPA expression

RNA tissue specificity: Tissue enhanced

showing 60 of 80 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Skeletal muscle	tissue	446.5	medium
Heart muscle	tissue	331.6	high
Caudate putamen	tissue	306.5
Frontal cortex	tissue	274.2
Tongue	tissue	217.3
Liver	tissue	186.2	high
Thalamus	tissue	168.8
Superior colliculi	tissue	164.5
Pons	tissue	159.1
Cerebral cortex	tissue	151.8	medium
Somatosensory cortex	tissue	151.8
Midbrain	tissue	143.3
Duodenum	tissue	142.4	high
Medulla oblongata	tissue	141.5
Spinal cord	tissue	141.1
Motor cortex	tissue	138.3
Occipital cortex	tissue	134.5
Substantia nigra	tissue	130.2
Prefrontal cortex	tissue	126.2
Kidney	tissue	123.6	high
Hippocampal formation	tissue	122.2
Retrosplenial and cingulate cortex	tissue	121.6
Temporal cortex	tissue	120.8
Putamen	tissue	117.6
Entorhinal cortex	tissue	116.8
Parathyroid gland	tissue	116.0	high
Retrosplenial cortex	tissue	115.2
Small intestine	tissue	112.5	high
Ventral forebrain	tissue	109.6
Basal ganglia	tissue	104.7	medium
Septum	tissue	104.5
Insular cortex	tissue	103.7
Periaqueductal gray	tissue	102.8
Hypothalamus	tissue	101.8
Colon	tissue	97.0	medium
Amygdala	tissue	90.6
Adrenal gland	tissue	83.3	high
Cerebellum	tissue	81.5	medium
Olfactory bulb	tissue	80.7
Rectum	tissue	80.2	high
Corpus callosum	tissue	78.0
Stomach 1	tissue	66.3	high
Adipose tissue	tissue	63.1	low
Salivary gland	tissue	55.8	medium
Vagina	tissue	51.8	medium
Choroid plexus	tissue	51.2
Esophagus	tissue	45.2	medium
Postcentral gyrus	tissue	44.7
Pancreas	tissue	44.4	high
Urinary bladder	tissue	44.1	high
Pituitary gland	tissue	42.5
Lymph node	tissue	42.0	medium
Ovary	tissue	41.2	low
Thymus	tissue	39.7
Retina	tissue	38.7
Spleen	tissue	37.2	medium
Bone marrow	tissue	36.6	low
Fallopian tube	tissue	36.0	medium
Tonsil	tissue	35.8	medium
Smooth muscle	tissue	35.1	low

Brain sub-regions (HPA Brain Atlas): detected in 192; highest nTPM — Ventral spinal cord (141.1), Dorsal hippocampus (122.2), Ventral hippocampus (119.0), Subiculum (108.1), Dorsal spinal cord (106.7).

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

Targeting SDHA by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 35 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-371B-5P	99.99	75.34	4759
HSA-MIR-373-5P	99.98	75.36	4753
HSA-MIR-616-5P	99.98	75.58	4775
HSA-MIR-5696	99.98	72.36	4487
HSA-MIR-520D-5P	99.98	73.34	4883
HSA-MIR-524-5P	99.98	73.43	4882
HSA-MIR-3065-5P	99.97	71.56	3281
HSA-MIR-4487	99.96	64.58	1252
HSA-MIR-7845-5P	99.88	64.88	771
HSA-MIR-4729	99.69	72.18	4233
HSA-MIR-1284	99.67	73.56	1353
HSA-MIR-5093	99.67	69.26	2291
HSA-MIR-545-5P	99.66	70.18	2308
HSA-MIR-5003-5P	99.61	69.13	1624
HSA-MIR-1290	99.59	69.90	2079
HSA-MIR-7106-5P	99.53	67.47	3574
HSA-MIR-7159-5P	99.53	72.12	2472
HSA-MIR-6853-3P	99.36	70.79	1558
HSA-MIR-3160-3P	99.07	64.78	955
HSA-MIR-1228-3P	99.00	66.53	857
HSA-MIR-2355-5P	98.83	65.51	1589
HSA-MIR-508-3P	98.66	69.62	887
HSA-MIR-4709-5P	98.51	67.25	1335
HSA-MIR-4782-5P	98.35	69.33	1474
HSA-MIR-5706	98.35	69.33	1463
HSA-MIR-4421	97.99	64.89	701
HSA-MIR-4275	97.96	68.42	1549
HSA-MIR-5699-3P	97.81	65.00	861
HSA-MIR-556-5P	97.75	66.17	473

Functional genomics

gnomAD constraint: pLI 3.37e-08, LOEUF 0.786, missense Z 2.31 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD RMC): no regional variation along ENST00000264932 — one region, missense o/e 0.76. DepMap (CRISPR cell-line fitness): dependent in 24.6% of screened cell lines.

Most-dependent cell lines (DepMap gene-effect, lower = stronger; ≤ −0.5 shown): BC-1 (-1.913), SU-DHL-8 (-1.716), SU-DHL-1 (-1.533), Reh (-1.451), G415 (-1.424), SUP-M2 (-1.352), A-375_SCH772984_R (-1.34), TGBC18TKB (-1.31), NALM-6 (-1.304), AMO-1 (-1.296), HB11;19 (-1.29), NOZ (-1.257), F-36P (-1.254), KCL-22 (-1.252), OVK18 (-1.249).

Literature-anchored findings (GeneRIF, showing 40)

• Review. Succinate dehydrogenase catalyses a step in the Krebs tricarboxylic-acid cycle. Inherited heterozygous mutations in the gene encoding this enzyme causes a predisposition to inherited neoplasia syndromes. (PMID:12612654)
• The SDHA variants that have increased in frequency during human evolution might, by influencing the regulation of cellular oxygen homeostasis, confer protection against certain environmental toxins or pathogens that are prevalent in Africa. (PMID:17376234)
• Phosphorylation of flavoprotein subunit ofsuccinate-ubiquinone reductase might be important for maintaining mitochondrial energy metabolism within the tumor microenvironment. (PMID:19644226)
• Mutations in electron Transport Complex II is associated with Leber hereditary optic neuropathy failing to compensate for impaired oxidative phosphorylation. (PMID:19836344)
• Decreased electron Transport Complex II activity is associated with ulcerative colitis. (PMID:20440543)
• Cells with Complex II defect may undergo a progressive mitochondrial dysfunction, characterized by Dcmit loss, Calcium overload and increased ROS, eventually leading to cell death. (PMID:20489732)
• study presents the association of a mutation in the SDHA gene with recessive neonatal isolated dilated cardiomyopathy in 15 patients of two large consanguineous Bedouin families (PMID:20551992)
• First report describing germline and somatic loss-of-function mutations in SDHA that are linked to the development of sporadic KIT/PDGFRA wild-type GISTs. (PMID:21505157)
• A protein encoded by this locus was found to be differentially expressed in postmortem brains from patients with atypical frontotemporal lobar degeneration. (PMID:22360420)
• Tumor-derived FH and SDH mutations accumulate fumarate and succinate, leading to enzymatic inhibition of multiple alpha-KG-dependent dioxygenases and consequent alterations of genome-wide histone and DNA methylation. (PMID:22677546)
• Loss of SDHA expression in gastrointestinal stromal tumor (GIST) reliably predicts the presence of SDHA mutations, which represent a relatively common cause of SDH-deficient GIST in adults. (PMID:22955521)
• This report represents the first example of SDHB mutation as a cause of inherited mitochondrial respiratory chain disease and extends the SDHA mutation spectrum in patients with isolated complex II deficiency. (PMID:22972948)
• A germline p.Arg31X nonsense SDHA mutation was identified in one of the six wild-type gastrointestinal stromal tumors cases. An additional SDHA missense mutation was identified in the extended KIT/PDGFRA WT GIST patients cohort. (PMID:22974104)
• Studies indicate that the pH change leads to the dissociation of SDHA and SDHB subunits from the remaining membrane-anchored subunits and the consequent block of enzymatic succinate-ubiquinone reductase (SQR) activity. (PMID:23000077)
• Loss of SDHA expression identifies SDHA mutations in succinate dehydrogenase-deficient gastrointestinal stromal tumors. (PMID:23060355)
• Data indicate that SDHB-deficiency was tightly associated with overexpression of IGF1R protein and transcript, and Biallelic inactivation of the SDHA gene was identified in 5 of 11 SDHB-negative gastrointestinal stromal tumors. (PMID:23109135)
• Studies indicate that an array of tumor syndromes caused by complex II-associated mutations in genes SDHA, SDHB, SDHC, SDHD, SDHAF1 and SDHAF2 have been identified over a decade. (PMID:23174333)
• SDHA immunohistochemistry on gastrointestinal stromal tumors can identify the presence of an SDHA germline mutation. (PMID:23174939)
• SDHA-negative gastrointestinal stromal tumors comprise approximately 30% of SDHB-negative/SDH-deficient gastrointestinal stromal tumors, and SDHA loss generally correlates with SDHA mutations. (PMID:23282968)
• Studies indicate that mutations in the mitochondrial complex II structural subunit genes SDHB, SDHC and SDHD and the regulatory subunit gene SDHAF2 in many paraganglioma families. (PMID:23291190)
• Studies indicate that the flavinylation factor Sdh5 (SDHAF2) provided insight into the possible mechanism associated with Sdh1 (SDHA) flavinylation. (PMID:23380393)
• Overall, 9 of the 34 patients with KIT/PDGFRA wild-type GIST carried mutations in one of the four subunits of the SDH complex (six patients in SDHA, two in SDHB, one in SDHC (PMID:23612575)
• In the paraganglioma of the proband, in addition to the germline mutation, a somatic mutation was observed (c.1865G>A, p.Trp622*). (PMID:23633203)
• SDH deficiency may promote tumorigenesis through accumulation of succinate and inhibition of dioxygenase enzymes. Inhibition of TET activity may, in turn, alter global DNA methylation and gene expression in SDH-deficient tumors. (PMID:23743927)
• A significant subset of bladder paragangliomas is SDH deficient (PMID:23797725)
• Electron transport complex-II and manganese superoxide dismutase (MnSOD) enzyme activities were decreased in obese compared with non-obese pregnant women. (PMID:23956348)
• Data indicate that SDH5 is protected from mitochondrial LON protease (LONM)-mediated degradation in mitochondria by its stable interaction with SDHA, a state that is dysregulated in hereditary paraganglioma 2 (PGL2). (PMID:24414418)
• Three novel mutations in SDHA were found in patients presenting Leigh syndrome (LS) and/or leukodystrophy. (PMID:24781757)
• our findings provide further evidence that patients with KIT/PDGFRA wild-type SDH-deficient GIST harboring SDHA mutations experience good survival outcomes (PMID:25188872)
• This study strengthens the etiological association of SDH genes with pituitary neoplasia, renal tumorigenesis, and gastric gastrointestinal stromal tumors. Also, pancreatic neuroendocrine tumor falls within the SDH-related tumor spectrum. (PMID:26259135)
• According to international guidelines, SDHB, SDHC, and SDHD genetic testing were performed in this patient, but not SDHA, which would have been prescribed only after surgery, in case of SDHA negative immunohistochemistry (PMID:26490314)
• As a similar defect of succinate dehydrogenase is apparent in patient cell-derived cardiomyocytes, the authors conclude that these defects represent a molecular basis for the cardiac pathology in Barth syndrome. (PMID:26697888)
• Combined blockade of CDK and SDH, both genetically and pharmaceutically, showed synergy and resulted in inhibited proliferation, migration, invasion and migration in A2780 cells Cyclin E-driven OvCa cells appeared addicted to glucose metabolism via TCA. Combined CDKi with modalities targeting TCA, like SDHA inhibition showed promising effects for this genotype. (PMID:26826064)
• For classification, tumors were characterized by SDHA, B, C, or D (SDHX) mutations and other genetic and epigenetic alterations, including presence of mutations in germline (PMID:27011036)
• FAD interacts noncovalently with SDHA in the absence of SDH5 (PMID:27296776)
• SDH-deficient gastrointestinal stromal tumors (GISTs) account for approximately 8% of gastric GISTs and are associated with a high rate of distant metastasis, regardless of conventional risk category. (PMID:27340750)
• We found that microRNA 31 (miR-31) suppressed succinate dehydrogenase complex subunit A (SDHA) expression, vital for mitochondrial electron transport chain (ETC) complex II (PMID:27346679)
• data show that SDHA flavination is independent of SDHAF2 in breast cancer cells, employing an alternative mechanism. (PMID:27587393)
• This is only the second report supporting the dominant nature of the SDHA c.1351C>T (p.Arg451Cys) mutation being causative for an autosomal dominantly inherited mitochondrial metabolic disorder expanding the phenotypic presentation to an earlier onset of disease with additional cardiac involvement. (PMID:27683074)
• Data suggest that succinate dehydrogenases SDHA and SDHB immunohistochemistry should be interpreted with caution, due to possible false-positive or false-negative results, and ideally in the setting of quality assurance provided by molecular testing. (PMID:28179334)

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio	sdha	ENSDARG00000016721
mus_musculus	Sdha	ENSMUSG00000021577
rattus_norvegicus	Sdha	ENSRNOG00000013331
drosophila_melanogaster	SdhA	FBGN0261439
caenorhabditis_elegans		WBGENE00015391
caenorhabditis_elegans	sdha-2	WBGENE00016392

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:1914195) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 7 distinct phenotype terms.

Mouse phenotype (MP)	Records
increased circulating free fatty acids level	1
abnormal behavior	1
decreased circulating glucose level	1
increased circulating sodium level	1
preweaning lethality, complete penetrance	1
embryonic lethality prior to organogenesis	1
decreased thigmotaxis	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Escherichia coli K-12	P0AC41	100.0%	Diamond
Escherichia coli CFT073	P0AC42	100.0%	Diamond
Escherichia coli O157:H7	P0AC43	100.0%	Diamond
Mycobacterium tuberculosis variant bovis AF2122/97	P64175	100.0%	Diamond
Mycobacterium tuberculosis CDC1551	P9WJJ8	100.0%	Diamond
Mycobacterium tuberculosis H37Rv	P9WJJ9	100.0%	Diamond
Pongo abelii	Q5R616	99.7%	Diamond
Salmonella enterica subsp. enterica serovar Typhi	Q8Z4K0	99.3%	Diamond
Salmonella enterica subsp. enterica serovar Typhimurium str. LT2	Q8ZMX9	99.3%	Diamond
Helicobacter pylori 26695	O06913	99.0%	Diamond
Helicobacter pylori J99	Q9ZMP0	99.0%	Diamond
Macaca fascicularis	Q8HXW3	98.9%	Diamond
Neisseria meningitidis Z2491	Q9JSX4	97.8%	Diamond
Neisseria meningitidis MC58	Q9K107	97.8%	Diamond
Mesocricetus auratus	Q0QF17	97.4%	Diamond
Rickettsia felis Marseille-URRWFXCal2	Q4UJM1	97.3%	Diamond
Rickettsia conorii str. Malish 7	Q92J97	97.3%	Diamond
Rickettsia prowazekii str. Madrid E	P31038	96.5%	Diamond
Rickettsia typhi str. Wilmington	Q68XN9	96.5%	Diamond
Sus scrofa	Q0QF01	95.8%	Diamond
Xenopus laevis	Q6PA58	95.8%	Diamond
Xenopus tropicalis	Q28ED0	95.6%	Diamond
Bos taurus	P31039	95.2%	Diamond
Rickettsia bellii RML369-C	Q1RHB9	94.5%	Diamond
Prodigiosinella confusarubida	G4V4G6	93.4%	Diamond
Nicotiana tabacum	A0A1S3YEG8	92.0%	Diamond
Gallus gallus	Q9YHT1	91.6%	Diamond
Oryza sativa Japonica Group	Q6ZDY8	89.4%	Diamond
Arabidopsis thaliana	O82663	88.8%	Diamond
Proteus vulgaris	P20922	87.5%	Diamond
Ascaris suum	Q8WSR3	85.9%	Diamond
Listeria monocytogenes EGD-e	Q8Y5N4	85.5%	Diamond
Yersinia pestis	Q8ZD80	84.5%	Diamond
Pyrococcus abyssi GE5	Q9V2R0	84.5%	Diamond
Saccharomyces cerevisiae S288C	P47052	84.2%	Diamond
Haemophilus influenzae Rd KW20	P44894	77.2%	Diamond
Mycobacterium leprae TN	Q49617	76.7%	Diamond
Vibrio cholerae O1 biovar El Tor str. N16961	Q9KPA4	76.2%	Diamond
Schizosaccharomyces pombe 972h-	Q9UTJ7	75.3%	Diamond
Dictyostelium discoideum	Q9U3X4	71.3%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
PDCD6-DT	ncRNA	102467073
EXOC3-AS1	ncRNA	116349
PDCD6-AHRR	ncRNA	116412618
AHRR	protein-coding	57491
PDCD6	protein-coding	10016
CCDC127	protein-coding	133957
EXOC3	protein-coding	11336
PLEKHG4B	protein-coding	153478
LRRC14B	protein-coding	389257
LRRC14B-AS1	ncRNA	124900929

Protein

Protein identifiers

Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial — P31040 (reviewed: P31040)

Alternative names: Flavoprotein subunit of complex II, Malate dehydrogenase [quinone] flavoprotein subunit

All UniProt accessions (5): D6REB7, D6RFM5, P31040, H0Y8S2, H0Y8X1

UniProt curated annotations — full annotation on UniProt →

Function. Flavoprotein (FP) subunit of succinate dehydrogenase (SDH) that is involved in complex II of the mitochondrial electron transport chain and is responsible for transferring electrons from succinate to ubiquinone (coenzyme Q). SDH also oxidizes malate to the non-canonical enol form of oxaloacetate, enol-oxaloacetate. Enol-oxaloacetate, which is a potent inhibitor of the succinate dehydrogenase activity, is further isomerized into keto-oxaloacetate. Can act as a tumor suppressor.

Subunit / interactions. Component of complex II composed of four subunits: the flavoprotein (FP) SDHA, iron-sulfur protein (IP) SDHB, and a cytochrome b560 composed of SDHC and SDHD. Interacts with SDHAF2/SDH5; interaction is required for FAD attachment. Interacts with TRAP1. Interacts with LACC1.

Subcellular location. Mitochondrion inner membrane.

Post-translational modifications. Phosphorylation at Tyr-215 is important for efficient electron transfer in complex II and the prevention of ROS generation. Acetylated. Deacetylated by SIRT3.

Disease relevance. Mitochondrial complex II deficiency, nuclear type 1 (MC2DN1) [MIM:252011] A disorder of the mitochondrial respiratory chain with heterogeneous clinical manifestations. Clinical features include psychomotor regression in infants, poor growth with lack of speech development, severe spastic quadriplegia, dystonia, progressive leukoencephalopathy, muscle weakness, exercise intolerance, cardiomyopathy. Some patients manifest Leigh syndrome or Kearns-Sayre syndrome. MC2DN1 inheritance is autosomal recessive. The disease is caused by variants affecting the gene represented in this entry. Leigh syndrome (LS) [MIM:256000] An early-onset progressive neurodegenerative disorder characterized by the presence of focal, bilateral lesions in one or more areas of the central nervous system including the brainstem, thalamus, basal ganglia, cerebellum and spinal cord. Clinical features depend on which areas of the central nervous system are involved and include subacute onset of psychomotor retardation, hypotonia, ataxia, weakness, vision loss, eye movement abnormalities, seizures, and dysphagia. The disease is caused by variants affecting the gene represented in this entry. Cardiomyopathy, dilated, 1GG (CMD1GG) [MIM:613642] A disorder characterized by ventricular dilation and impaired systolic function, resulting in congestive heart failure and arrhythmia. Patients are at risk of premature death. The disease is caused by variants affecting the gene represented in this entry. Pheochromocytoma/paraganglioma syndrome 5 (PPGL5) [MIM:614165] A form of pheochromocytoma/paraganglioma syndrome, a tumor predisposition syndrome characterized by the development of neuroendocrine tumors, usually in adulthood. Pheochromocytomas are catecholamine-producing tumors that arise from chromaffin cells in the adrenal medulla. Paragangliomas develop from sympathetic paraganglia in the thorax, abdomen, and pelvis, as well as from parasympathetic paraganglia in the head and neck. PPGL5 inheritance is autosomal dominant. The disease is caused by variants affecting the gene represented in this entry. Neurodegeneration with ataxia and late-onset optic atrophy (NDAXOA) [MIM:619259] An autosomal dominant disorder characterized by slowly progressive cerebellar and gait ataxia, optic atrophy, and myopathy or myalgia. Additional features can include cardiomyopathy, psychiatric disturbances, and peripheral sensory impairment. Disease onset is usually in mid-adulthood. The disease is caused by variants affecting the gene represented in this entry.

Activity regulation. Enol-oxaloacetate inhibits the succinate dehydrogenase activity.

Pathway. Carbohydrate metabolism; tricarboxylic acid cycle; fumarate from succinate (eukaryal route): step 1/1.

Similarity. Belongs to the FAD-dependent oxidoreductase 2 family. FRD/SDH subfamily.

Isoforms (3)

UniProt ID	Names	Canonical?
P31040-1	1	yes
P31040-2	2
P31040-3	3

RefSeq proteins (3): NP_001281261, NP_001317687, NP_004159* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR003952	FRD_SDH_FAD_BS	Binding_site
IPR003953	FAD-dep_OxRdtase_2_FAD-bd	Domain
IPR011281	Succ_DH_flav_su_fwd	Family
IPR014006	Succ_Dhase_FrdA_Gneg	Family
IPR015939	Fum_Rdtase/Succ_DH_flav-like_C	Domain
IPR027477	Succ_DH/fumarate_Rdtase_cat_sf	Homologous_superfamily
IPR030664	SdhA/FrdA/AprA	Family
IPR036188	FAD/NAD-bd_sf	Homologous_superfamily
IPR037099	Fum_R/Succ_DH_flav-like_C_sf	Homologous_superfamily

Pfam: PF00890, PF02910

Enzyme classification (BRENDA)

• EC 1.3.5.1 — succinate dehydrogenase (BRENDA: 80 organisms, 226 substrates, 192 inhibitors, 145 Km, 115 kcat entries)

Substrate kinetics (BRENDA)

28 substrates with measured Km, best-characterized 15. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
SUCCINATE	0.0015–20	39
UBIQUINONE	0.0005–0.2	26
FUMARATE	0.005–0.455	14
2,3-DIMETHOXY-5-METHYL-6-DECYL-1,4-BENZOQUINONE	0.0034–0.018	9
REDUCED PLUMBAGIN	0.11–0.19	9
UBIQUINONE-2	0.0002–0.0114	9
MENAQUINOL	0.0009–0.0054	8
PHENAZINE METHOSULFATE	0.11–0.48	3
UBIQUINONE-1	0.0016–0.02	3
2,6-DICHLOROPHENOL INDOPHENOL	0.003–0.007	2
CALDARIELLAQUINONE	0.06–0.18	2
MENAQUINONE	0.0018–0.004	2
OXIDIZED 2,6-DICHLOROPHENOLINDOPHENOL	0.0654–0.089	2
2,3-DIMETHOXY-5-METHYL-1,4-BENZOQUINONE	0.003	1
2,3-DIMETHYL-1,4-NAPHTHOHYDROQUINONE	0.12	1

Catalyzed reactions (Rhea)

• a ubiquinone + succinate = a ubiquinol + fumarate (RHEA:13713)
• (R)-malate + a quinone = enol-oxaloacetate + a quinol (RHEA:79827)
• (S)-malate + a quinone = enol-oxaloacetate + a quinol (RHEA:79831)

UniProt features (134 total): modified residue 28, helix 26, strand 26, binding site 17, sequence variant 14, turn 11, sequence conflict 7, splice variant 2, transit peptide 1, chain 1, active site 1

Structure

Experimental structures (PDB)

5 structures by resolution:

PDB	Title	Method	Resolution (Å)
8DYE	Crystal structure of human SDHA-SDHAF4 assembly intermediate	X-RAY DIFFRACTION	1.44
8DYD	Crystal structure of human SDHA-SDHAF2-SDHAF4 assembly intermediate	X-RAY DIFFRACTION	1.52
6VAX	Crystal structure of human SDHA-SDHAF2 assembly intermediate	X-RAY DIFFRACTION	2.59
9KC4	The Cryo-EM structure of human succinate dehydrogenase in complex with Benzovindiflupyr	ELECTRON MICROSCOPY	2.65
8GS8	cryo-EM structure of the human respiratory complex II	ELECTRON MICROSCOPY	2.86

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P31040-F1	94.06	0.92

Human Protein Atlas

Protein class: Enzymes, ENZYME proteins, Oxidoreductases, Metabolic proteins, Transporters, Primary Active Transporters, Predicted intracellular proteins, Plasma proteins, Citric acid cycle related proteins, Cancer-related genes, Disease related genes, FDA approved drug targets, Small molecule drugs, Human disease related genes, Congenital disorders of metabolism

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): mitochondria; plasma membrane

Antibody reliability (HPA): IH enhanced · IF supported

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1)

Position	Role
340	proton acceptor

Ligand- & substrate-binding residues (17)

Position	Role
221	FAD
275	FAD
296	oxaloacetate
340	oxaloacetate
407	oxaloacetate
440	FAD
451	oxaloacetate
454	oxaloacetate
456	FAD
457	FAD
69	FAD
72	FAD
91	FAD
92	FAD
98	FAD
100	FAD
105	FAD

Post-translational modifications (28)

Type	Positions
Tele-8alpha-fad histidine	99
N6-acetyllysine	167, 179, 182, 250, 335, 480, 485, 498, 517, 538, 541, 547, 550, 598, 608, 624, 636, 647
N6-succinyllysine	179, 250, 335, 485, 498, 538, 547, 615
Phosphotyrosine	215

Function

Pathways and Gene Ontology

Reactome pathways

2 curated (TAS) of 5; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

5 pathways:

ID	Pathway	Evidence
R-HSA-71403	Citric acid cycle (TCA cycle)	curated
R-HSA-9854311	Maturation of TCA enzymes and regulation of TCA cycle	curated
R-HSA-1428517	Aerobic respiration and respiratory electron transport	—
R-HSA-1430728	Metabolism	—
R-HSA-611105	Respiratory electron transport	electronic

MSigDB gene sets: 578 (showing top): MORF_MTA1, MODY_HIPPOCAMPUS_POSTNATAL, TGCGCANK_UNKNOWN, GOMF_OXIDOREDUCTASE_ACTIVITY_ACTING_ON_THE_CH_CH_GROUP_OF_DONORS, MORF_HDAC1, MORF_RAD21, GOBP_ORGANOPHOSPHATE_METABOLIC_PROCESS, MORF_HDAC2, GOBP_NUCLEOSIDE_PHOSPHATE_BIOSYNTHETIC_PROCESS, GOBP_ORGANOPHOSPHATE_BIOSYNTHETIC_PROCESS, GOBP_CARBOHYDRATE_DERIVATIVE_METABOLIC_PROCESS, HERNANDEZ_ABERRANT_MITOSIS_BY_DOCETACEL_4NM_DN, GOBP_DICARBOXYLIC_ACID_METABOLIC_PROCESS, GOBP_NUCLEOBASE_CONTAINING_SMALL_MOLECULE_METABOLIC_PROCESS, GOBP_GENERATION_OF_PRECURSOR_METABOLITES_AND_ENERGY

GO Biological Process (7): tricarboxylic acid cycle (GO:0006099), succinate metabolic process (GO:0006105), mitochondrial electron transport, succinate to ubiquinone (GO:0006121), nervous system development (GO:0007399), respiratory electron transport chain (GO:0022904), proton motive force-driven mitochondrial ATP synthesis (GO:0042776), electron transport chain (GO:0022900)

GO Molecular Function (7): succinate dehydrogenase (quinone) activity (GO:0008177), electron transfer activity (GO:0009055), flavin adenine dinucleotide binding (GO:0050660), FAD binding (GO:0071949), protein binding (GO:0005515), oxidoreductase activity (GO:0016491), oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)

GO Cellular Component (4): mitochondrion (GO:0005739), mitochondrial inner membrane (GO:0005743), mitochondrial matrix (GO:0005759), respiratory chain complex II (succinate dehydrogenase) (GO:0045273)

Reactome top-level categories

3 top-level categories:

Category	Pathways
Aerobic respiration and respiratory electron transport	2
Citric acid cycle (TCA cycle)	1
Metabolism	1

GO top-level categories

30 GO namespaces:

Category	Terms
mitochondrion	2
aerobic respiration	1
primary metabolic process	1
dicarboxylic acid metabolic process	1
aerobic electron transport chain	1
mitochondrial ATP synthesis coupled electron transport	1
system development	1
animal gross anatomical part developmental process	1
electron transport chain	1
cellular respiration	1
oxidative phosphorylation	1
proton motive force-driven ATP synthesis	1
generation of precursor metabolites and energy	1
succinate dehydrogenase activity	1
oxidoreductase activity, acting on the CH-CH group of donors, quinone or related compound as acceptor	1
molecular_function	1
nucleotide binding	1
anion binding	1
flavin adenine dinucleotide binding	1
binding	1
catalytic activity	1
oxidoreductase activity	1
cytoplasm	1
intracellular membrane-bounded organelle	1
organelle inner membrane	1
mitochondrial membrane	1
intracellular organelle lumen	1
membrane protein complex	1
respiratory chain complex	1
oxidoreductase complex	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 6 of 18 annotations. The rest are phylogenetic / computational / electronic (IEA).

6 experimentally-supported GO terms:

GO term	NS	Evidence
nervous system development	BP	mutant phenotype
respiratory electron transport chain	BP	direct assay
succinate metabolic process	BP	direct assay
mitochondrion	CC	direct assay
respiratory chain complex II (succinate dehydrogenase)	CC	direct assay
succinate dehydrogenase (quinone) activity	MF	mutant phenotype

Protein interactions and networks

STRING

showing 15 of 4,474 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
SDHA	SDHD	O14521	977
SDHA	SDHB	P21912	973
SDHA	SDHC	Q99643	965
SDHA	SDHAF2	Q9NX18	954
SDHA	SDHAF1	A6NFY7	951
SDHA	F5H5T6	F5H5T6	885
SDHA	UQCRC2	P22695	836
SDHA	ATP5F1B	P06576	833
SDHA	NDUFS1	P28331	820
SDHA	ACO2	Q99798	808
SDHA	NDUFV1	P49821	800
SDHA	NDUFA9	Q16795	795
SDHA	TMEM127	O75204	788
SDHA	NDUFS3	O75489	784
SDHA	MT-CYB	P00156	784

IntAct

Human interaction partners of SDHA in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

showing 30 of 37 partners by confidence:

Partner	Interaction type	MIscore	Records
SDHB	association	0.820	7
CFTR	physical association	0.740	1
SDHAF2	physical association	0.740	1
PTPN3	physical association	0.500	1
AKT1	proximity	0.470	2
BRAF	proximity	0.470	2
CASTOR3P	physical association	0.400	1
CCDC62	physical association	0.400	1
FCHSD2	physical association	0.400	1
FXN	physical association	0.400	1
GOLGA6L2	physical association	0.400	1
HOXB3	physical association	0.400	1
MAGI2	physical association	0.400	1
MXRA5	physical association	0.400	1
NAB1	physical association	0.400	1
OR7A10	physical association	0.400	1
POLR3B	physical association	0.400	1
USF3	physical association	0.400	1
CSNK2B	physical association	0.370	1
LMNA	association	0.350	2
FLOT1	association	0.350	1
HMGB3	association	0.350	1
NME2P1	association	0.350	1
FBXW7	proximity	0.270	4
SMAD4	proximity	0.270	4
SMARCA4	proximity	0.270	4
SPOP	proximity	0.270	4
EGFR	proximity	0.270	1
PTEN	proximity	0.270	1
PTPN11	proximity	0.270	1

BioGRID (544 interactions; top human partners by supporting records): SDHB (Co-fractionation; 14 records), CFTR (Affinity Capture-MS; 3 records), CLPP (Proximity Label-MS; 3 records), CS (Co-fractionation; 3 records), CUL3 (Affinity Capture-MS; 3 records), HOXB3 (Cross-Linking-MS (XL-MS); 3 records), PARK2 (Affinity Capture-MS; 3 records), PDHA1 (Affinity Capture-MS; 3 records), SDHAF2 (Affinity Capture-MS; 3 records), SUCLG2 (Co-fractionation; 3 records), AARS2 (Affinity Capture-MS; 2 records), ACAD9 (Affinity Capture-MS; 2 records), ACN9 (Affinity Capture-MS; 2 records), ATP5F1 (Co-fractionation; 2 records), ATXN3 (Affinity Capture-MS; 2 records)

SIGNOR signaling

showing 3 of 5 signaling interactions:

A	Effect	B	Mechanism
SDHA	“form complex”	“Succinate dehydrogenase-Mitochondrial respiratory chain complex II”	binding
SRC	“up-regulates activity”	SDHA	phosphorylation
FGR	unknown	SDHA	phosphorylation

Protein complexes (CORUM) (1)

Experimentally-characterized complexes this protein is a subunit of (★ = the complex contains a known drug target).

1 complexes by size:

Complex	Subunits	Members
Frataxin complex	7	AFG3L2, ATP5MG, FXN, HSPA9, HSPD1, LYRM4, SDHA

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 37 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

GO biological processes:

GO term	Partners	Fold	FDR
negative regulation of cell population proliferation	6	7.4×	9e-03

Disease & clinical

Cancer significance

From intOGen — cancer-driver classification: activating (oncogene-like) across 3 cancer types — CHRCC, HCC, LGGNOS.

intOGen’s role is a computational inference from cohort mutation patterns and may diverge from the gene’s curated/literature role; read it alongside the evidence above.

Genetic variants

Variant evidence for SDHA: 3,368 ClinVar records (290 pathogenic / likely pathogenic); 2 GWAS associations. Per-variant detail is on Sugi Variant.

ClinVar

3,368 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	190
Likely pathogenic	100
Uncertain significance	1637
Likely benign	752
Benign	68

Top pathogenic / likely-pathogenic (15)

Showing the 15 best-reviewed of 290 pathogenic / likely-pathogenic ClinVar records, ranked by ClinVar review status (expert panel → multiple submitters → single submitter), then by number of submitting labs.

Variant ID	HGVS	Classification	Review	Submitters
480771	NM_004168.4(SDHA):c.553C>T (p.Gln185Ter)	Pathogenic	criteria provided, multiple submitters, no conflicts	7
230877	NM_004168.4(SDHA):c.1151C>G (p.Ser384Ter)	Pathogenic	criteria provided, multiple submitters, no conflicts	6
239634	NM_004168.4(SDHA):c.1054C>T (p.Arg352Ter)	Pathogenic	criteria provided, multiple submitters, no conflicts	6
856810	NM_004168.4(SDHA):c.356G>A (p.Trp119Ter)	Pathogenic	criteria provided, multiple submitters, no conflicts	6
1709506	NM_004168.4(SDHA):c.1283_1298del (p.Gln428fs)	Pathogenic	criteria provided, multiple submitters, no conflicts	6
8744	NM_004168.4(SDHA):c.1A>C (p.Met1Leu)	Pathogenic	criteria provided, multiple submitters, no conflicts	5
280711	NM_004168.4(SDHA):c.990del (p.Arg329_Tyr330insTer)	Pathogenic	criteria provided, multiple submitters, no conflicts	5
575469	NM_004168.4(SDHA):c.995_996del (p.Pro332fs)	Pathogenic	criteria provided, multiple submitters, no conflicts	5
412328	NM_004168.4(SDHA):c.985C>T (p.Arg329Ter)	Pathogenic	criteria provided, multiple submitters, no conflicts	4
539643	NM_004168.4(SDHA):c.1629T>G (p.Tyr543Ter)	Pathogenic	criteria provided, multiple submitters, no conflicts	4
822909	NM_004168.4(SDHA):c.310C>T (p.Gln104Ter)	Pathogenic	criteria provided, multiple submitters, no conflicts	4
962458	NM_004168.4(SDHA):c.160C>T (p.Gln54Ter)	Pathogenic	criteria provided, multiple submitters, no conflicts	4
1070947	NM_004168.4(SDHA):c.1012del (p.Ala338fs)	Pathogenic	criteria provided, multiple submitters, no conflicts	4
1451165	NM_004168.4(SDHA):c.23C>A (p.Ser8Ter)	Pathogenic	criteria provided, multiple submitters, no conflicts	4
2946709	NM_004168.4(SDHA):c.464del (p.Asn155fs)	Pathogenic	criteria provided, multiple submitters, no conflicts	4

Per-variant reference — Sugi Variant

Explore SDHA’s pathogenic and likely-pathogenic variants individually — each with its ClinVar classification and conditions, applied ACMG criteria (ClinGen expert panel, where curated), the calibrated in-silico predictors (AlphaMissense, REVEL, SaProt, conservation), gnomAD frequency, and the predictor-disagreement QC signal — on Sugi Variant.

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 33 predictions of 1,616):

Position(s)	Effect	Δscore	Sites
5:223569–223570	donor_loss	1.0000	5
5:225873	acceptor_gain	1.0000
5:225880	acceptor_gain	1.0000
5:225881–225882	acceptor_loss	1.0000	4
5:226048–226049	donor_loss	1.0000	3
5:228183–228184	acceptor_loss	1.0000	6
5:228334	donor_gain	1.0000
5:233475–233476	acceptor_loss	1.0000	6
5:233643	donor_gain	1.0000
5:233646–233647	donor_loss	1.0000	5

AlphaMissense

2,564 missense substitutions predicted likely pathogenic (of 4,299 scored), across 522 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
M410	9	0.986	0.997
M327	9	0.974	0.998
M519	9	0.903	0.993
D341	8	1.000	1.000
D125	8	0.999	1.000
H407	8	0.999	1.000
D194	8	0.998	1.000
D131	8	0.997	0.999
H296	8	0.997	1.000
H99	8	0.996	0.999
D275	8	0.996	0.999
D289	8	0.996	0.999
H447	8	0.996	0.999
H122	8	0.995	0.999
N559	8	0.994	1.000
D117	8	0.993	0.999
D135	8	0.993	0.998
N450	8	0.993	1.000
H625	8	0.992	0.998
F160	8	0.991	0.999

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

3 prognostic cancer types:

Cancer	Prognostic	p-value
Kidney Renal Papillary Cell Carcinoma (TCGA)	favorable	0.000156
Kidney Renal Clear Cell Carcinoma (TCGA)	favorable	0.000599
Breast Invasive Carcinoma (TCGA)	unfavorable	0.000839

Disease associations

OMIM: gene MIM:600857 | disease phenotypes: MIM:614165, MIM:619259, MIM:252011, MIM:613642, MIM:606764, MIM:256000, MIM:604287, MIM:168000, MIM:171300, MIM:114480

GenCC curated gene-disease

9 curated gene-disease records:

Disease	Classification	Inheritance	Records
mitochondrial complex II deficiency, nuclear type 1	Definitive	Autosomal recessive	4
pheochromocytoma/paraganglioma syndrome 5	Definitive	Autosomal dominant	5
hereditary pheochromocytoma-paraganglioma	Definitive	Autosomal dominant	2
neurodegeneration with ataxia and late-onset optic atrophy	Strong	Autosomal dominant	2
Leigh syndrome	Moderate	Autosomal recessive	2
familial isolated dilated cardiomyopathy	Supportive	Autosomal dominant
mitochondrial complex II deficiency	Supportive	Autosomal recessive
gastrointestinal stromal tumor	Supportive	Autosomal dominant
dilated cardiomyopathy 1GG	Limited	Autosomal recessive

ClinGen Gene-Disease Validity

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

4 validity classifications:

Disease	Classification	Inheritance
hereditary pheochromocytoma-paraganglioma	Definitive	AD
Leigh syndrome	Moderate	AR
mitochondrial disease	Definitive	AR
mitochondrial disease	Limited	AD

Genomics England panels (PanelApp)

Clinical diagnostic gene panels including this gene (25 panels, 18 green/diagnostic-grade). Confidence: green = diagnostic, amber = moderate.

25 panels:

Panel	Rating
Adult solid tumours cancer susceptibility	green
Adult solid tumours for rare disease	green
DDG2P	green
Hypotonic infant	green
Inherited phaeochromocytoma and paraganglioma	green
Inherited phaeochromocytoma and paraganglioma excluding NF1	green
Inherited predisposition to GIST	green
Inherited white matter disorders	green
Intellectual disability	green
Leukodystrophy, childhood onset	green
Likely inborn error of metabolism	green
Mitochondrial disorder with complex II deficiency	green
Mitochondrial disorders	green
Neuroendocrine cancer pertinent cancer susceptibility	green
Possible mitochondrial disorder, nuclear genes	green
Structural basal ganglia disorders	green
Undiagnosed metabolic disorders	green
White matter disorders and cerebral calcification - childhood onset	green
Early onset or syndromic epilepsy	amber
Optic neuropathy	amber
Paediatric disorders	amber
Paediatric or syndromic cardiomyopathy	amber
Sarcoma cancer susceptibility	amber
Sarcoma susceptibility	amber
Unexplained death in infancy and sudden unexplained death in childhood	amber

Mondo (21): pheochromocytoma/paraganglioma syndrome 5 (MONDO:0013602), hereditary neoplastic syndrome (MONDO:0015356), neurodegeneration with ataxia and late-onset optic atrophy (MONDO:0031006), mitochondrial complex II deficiency, nuclear type 1 (MONDO:0100294), dilated cardiomyopathy 1GG (MONDO:0013339), gastrointestinal stromal tumor (MONDO:0011719), intellectual disability (MONDO:0001071), rhabdomyosarcoma (MONDO:0005212), Leigh syndrome (MONDO:0009723), Carney triad (MONDO:0011424), pilocytic astrocytoma (MONDO:0016691), hereditary pheochromocytoma-paraganglioma (MONDO:0017366), paraganglioma (MONDO:0000448), pheochromocytoma (MONDO:0008233), pheochromocytoma/paraganglioma syndrome 1 (MONDO:0008192), hereditary breast carcinoma (MONDO:0016419), opsoclonus-myoclonus syndrome (MONDO:0015247), cardiac rhythm disease (MONDO:0007263), diffuse midline glioma, H3 K27-altered (MONDO:1060171), (MONDO:0015470), (MONDO:0009641)

Orphanet (12): Inherited cancer-predisposing syndrome (Orphanet:140162), Hereditary pheochromocytoma-paraganglioma (Orphanet:29072), Isolated succinate-CoQ reductase deficiency (Orphanet:3208), Familial isolated dilated cardiomyopathy (Orphanet:154), Gastrointestinal stromal tumor (Orphanet:44890), Carney triad (Orphanet:139411), Pilocytic astrocytoma (Orphanet:251612), Leigh syndrome (Orphanet:506), Rhabdomyosarcoma (Orphanet:780), Hereditary breast cancer (Orphanet:227535), Opsoclonus-myoclonus syndrome (Orphanet:1183), NON RARE IN EUROPE: Unexplained intellectual disability (Orphanet:319658)

HPO phenotypes

showing 60 of 195 phenotypes (HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000007	Autosomal recessive inheritance
HP:0000076	Vesicoureteral reflux
HP:0000083	Renal insufficiency
HP:0000093	Proteinuria
HP:0000096	Glomerular sclerosis
HP:0000360	Tinnitus
HP:0000365	Hearing impairment
HP:0000405	Conductive hearing impairment
HP:0000407	Sensorineural hearing impairment
HP:0000478	Abnormality of the eye
HP:0000505	Visual impairment
HP:0000508	Ptosis
HP:0000526	Aniridia
HP:0000544	External ophthalmoplegia
HP:0000580	Pigmentary retinopathy
HP:0000602	Ophthalmoplegia
HP:0000618	Blindness
HP:0000639	Nystagmus
HP:0000640	Gaze-evoked nystagmus
HP:0000648	Optic atrophy
HP:0000651	Diplopia
HP:0000716	Depression
HP:0000726	Dementia
HP:0000737	Irritability
HP:0000740	Episodic paroxysmal anxiety
HP:0000790	Hematuria
HP:0000822	Hypertension
HP:0000969	Edema
HP:0000980	Pallor
HP:0000988	Skin rash
HP:0001069	Episodic hyperhidrosis
HP:0001095	Hypertensive retinopathy
HP:0001250	Seizure
HP:0001251	Ataxia
HP:0001257	Spasticity
HP:0001263	Global developmental delay
HP:0001270	Motor delay
HP:0001272	Cerebellar atrophy
HP:0001278	Orthostatic hypotension
HP:0001279	Syncope
HP:0001285	Spastic tetraparesis
HP:0001288	Gait disturbance
HP:0001290	Generalized hypotonia
HP:0001293	Cranial nerve compression
HP:0001319	Neonatal hypotonia
HP:0001324	Muscle weakness
HP:0001332	Dystonia
HP:0001336	Myoclonus
HP:0001337	Tremor
HP:0001342	Cerebral hemorrhage
HP:0001347	Hyperreflexia
HP:0001371	Flexion contracture
HP:0001392	Abnormality of the liver
HP:0001511	Intrauterine growth retardation
HP:0001541	Ascites
HP:0001605	Vocal cord paralysis
HP:0001618	Dysphonia
HP:0001626	Abnormality of the cardiovascular system
HP:0001635	Congestive heart failure

GWAS associations

2 associations:

Study	Trait	p-value
GCST90020028_719	Hip circumference adjusted for BMI	7e-10
GCST90020028_720	Hip circumference adjusted for BMI	2e-9

EFO canonical traits (from GWAS)

1 canonical traits:

EFO ID	Trait name
EFO:0008039	BMI-adjusted hip circumference

MeSH disease descriptors

11 disease descriptors:

Descriptor	Name	Tree numbers
D046152	Gastrointestinal Stromal Tumors	C04.557.450.565.370; C06.301.371.308; C06.405.249.308
D008607	Intellectual Disability	C10.597.606.360; C23.888.592.604.646; F01.700.687; F03.625.539
D007888	Leigh Disease	C10.228.140.163.100.412; C16.320.565.189.412; C16.320.565.202.810.444; C18.452.132.100.412; C18.452.648.189.412; C18.452.648.202.810.444; C18.452.660.520
D009386	Neoplastic Syndromes, Hereditary	C04.700; C16.320.700
D053578	Opsoclonus-Myoclonus Syndrome	C04.588.614.550.600; C04.730.856.596; C10.228.758.500; C10.292.562.831; C10.574.781.662; C10.597.350.500.500; C11.590.725
D010235	Paraganglioma	C04.557.465.625.650.700; C04.557.580.625.650.700
D010673	Pheochromocytoma	C04.557.465.625.650.700.725; C04.557.580.625.650.700.725
D012208	Rhabdomyosarcoma	C04.557.450.590.550.660; C04.557.450.795.550.660
C562840	Breast Cancer, Familial *(supp.)*
C565803	Carney Triad *(supp.)*
C565375	Mitochondrial Complex II Deficiency *(supp.)*

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL5758 (SINGLE PROTEIN)

Molecules with ChEMBL bioactivity

Phase ≥1, by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 27,677 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

1 molecules by phase:

Molecule	Name	Phase	Patents
CHEMBL126	LINEZOLID	4	27,677

PharmGKB: 1 entry (CPIC guideline: no)

Binding affinities (BindingDB)

2 measured of 4 human assays (5 total across all organisms); most potent 2 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value
CHEMBL5653589	KD	1440 nM
CHEMBL4460889	IC50	30000 nM

ChEMBL bioactivities

5 potent at pChembl≥5 of 6 total, top 5 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
6.92	Kd	119.7	nM	CHEMBL3752910
6.92	ED50	119.7	nM	CHEMBL3752910
5.63	Kd	2365	nM	CHEMBL5653589
5.63	ED50	2365	nM	CHEMBL5653589
5.09	IC50	8190	nM	LINEZOLID

PubChem BioAssay actives

3 with measured affinity, of 8 total; 3 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
4-methyl-3-[(1-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2149357: Binding affinity to human SDHA incubated for 45 mins by Kinobead based pull down assay	kd	0.1197	uM
4-methyl-3-[(2-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2149357: Binding affinity to human SDHA incubated for 45 mins by Kinobead based pull down assay	kd	2.3647	uM
Linezolid	1553386: Inhibition of SDH-A (unknown origin) by ELISA	ic50	8.1900	uM

CTD chemical–gene interactions

77 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
bisphenol A	decreases expression, increases expression, affects expression	3
sodium arsenite	affects expression, decreases expression, decreases reaction, affects reaction, affects response to substance	3
Benzo(a)pyrene	affects cotreatment, decreases expression, increases methylation	3
bisphenol F	increases expression, affects cotreatment, decreases expression	2
Resveratrol	decreases acetylation, decreases reaction, increases expression	2
Acetaminophen	affects cotreatment, affects expression, decreases expression	2
Air Pollutants	decreases expression, increases abundance, affects expression, affects cotreatment	2
Atrazine	increases expression, decreases expression	2
Dexamethasone	decreases expression, affects cotreatment	2
Ozone	affects cotreatment, decreases expression, increases abundance, affects expression	2
1-Methyl-3-isobutylxanthine	affects cotreatment, decreases expression	2
ML-265	decreases expression, decreases reaction	1
bufotalin	increases expression	1
lasiocarpine	decreases expression	1
alpha-pinene	affects cotreatment, decreases expression, increases abundance	1
nobiletin	decreases expression, decreases reaction	1
sodium arsenate	decreases expression, decreases reaction	1
pyrogallol 1,3-dimethyl ether	affects cotreatment, increases expression	1
2,6-dichloro-4-nitrophenol	decreases expression	1
ochratoxin A	decreases expression, decreases reaction	1
benzo(e)pyrene	increases methylation	1
acetyl methyl tetramethyl tetralin	affects cotreatment, decreases expression	1
methacrylaldehyde	affects cotreatment, decreases expression, increases abundance	1
1-methyl-4-phenyl-2,3-dihydropyridinium	decreases expression	1
chromium hexavalent ion	decreases expression	1
U 0126	affects expression, affects reaction	1
K 7174	decreases expression	1
quinoxyfen	affects cotreatment, decreases expression	1
tofacitinib	increases expression	1
bisphenol B	increases expression	1

ChEMBL screening assays

3 unique, capped per target: 3 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL4350890	Binding	Inhibition of SDH-A (unknown origin) by ELISA	Incorporation of a chiral gem-disubstituted nitrogen heterocycle yields an oxazolidinone antibiotic with reduced mitochondrial toxicity. — *Bioorg Med Chem Lett*

Cellosaurus cell lines

1 cell lines: 1 transformed cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B1BF	Abcam HEK293 SDHA KO	Transformed cell line	Female

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

showing 60 of 330 trials:

NCT	Phase	Status	Title
NCT00171977	Phase 4	COMPLETED	Post-Marketing Clinical Study of Postoperative Adjuvant Therapy With Imatinib Mesylate in Patients With Gastrointestinal Stromal Tumors (GIST)
NCT00510354	Phase 4	COMPLETED	Treatment of Patients With Everolimus and Imatinib Mesylate Who Have Progressive Gastro Intestinal Stromal Tumors (GIST) and Are Resistant to Imatinib Mesylate
NCT00756509	Phase 4	COMPLETED	Treatment of Patients With Metastatic or Unresectable Gastrointestinal Stromal Tumors in First Line With Nilotinib
NCT00777504	Phase 4	UNKNOWN	Study to the Optimal Duration of Therapy With Oral Angiogenesis Inhibitors
NCT02800330	Phase 4	COMPLETED	The Effects of the Proton Pump Inhibitor Esomeprazole on the Bioavailability of Regorafenib
NCT04825574	Phase 4	COMPLETED	Study for Patients Previously Treated in Avapritinib Clinical Trials
NCT00009906	Phase 3	TERMINATED	Comparison of Two Different Doses of STI571 in Treating Patients With Metastatic or Unresectable Gastrointestinal Stromal Tumor
NCT00041197	Phase 3	COMPLETED	Imatinib Mesylate in Treating Patients With Primary Gastrointestinal Stromal Tumor That Has Been Completely Removed By Surgery
NCT00075218	Phase 3	COMPLETED	A Study To Assess The Safety And Efficacy Of SU11248 In Patients With Gastrointestinal Stromal Tumor(GIST)
NCT00103168	Phase 3	COMPLETED	Imatinib Mesylate or Observation Only in Treating Patients Who Have Undergone Surgery for Localized Gastrointestinal Stromal Tumor
NCT00293124	Phase 3	COMPLETED	Open-label Trial of GlivecWith Unresectable or Metastatic Malignant Gastrointestinal Stromal Tumors
NCT00324987	Phase 3	TERMINATED	Imatinib Mesylate With or Without Bevacizumab in Treating Patients With Metastatic or Unresectable Gastrointestinal Stromal Tumor
NCT00372567	Phase 3	TERMINATED	Safety And Effectiveness Of Daily Dosing With Sunitinib Or Imatinib In Patients With Gastrointestinal Stromal Tumors
NCT00471328	Phase 3	COMPLETED	Efficacy and Safety of Nilotinib (AMN107) Compared With Current Treatment Options in Patients With GIST Who Have Failed Both Imatinib and Sunitinib
NCT00685828	Phase 3	UNKNOWN	Imatinib Mesylate in Treating Patients With Unresectable or Metastatic Gastrointestinal Stromal Tumor
NCT00688766	Phase 3	TERMINATED	Study Evaluating IPI-504 in Patients With Gastrointestinal Stromal Tumors (GIST) Following Failure of at Least Imatinib and Sunitinib
NCT00751036	Phase 3	TERMINATED	Nilotinib 800 Mg And Imatinib 800 Mg For The Treatment Of Patients With Gastrointestinal Stromal Tumors (Gist) Refractory To Imatinib 400 Mg
NCT00785785	Phase 3	COMPLETED	A Study of Nilotinib Versus Imatinib in GIST Patients
NCT00812240	Phase 3	TERMINATED	Masitinib in First Line Treatment of Gastro-Intestinal Stromal Tumor (GIST)
NCT00956072	Phase 3	TERMINATED	Imatinib Mesylate With or Without Surgery in Treating Patients With Metastatic Gastrointestinal Stromal Tumor That is Responding to Imatinib Mesylate
NCT01031628	Phase 3	TERMINATED	Study of Dose Escalation Versus no Dose Escalation of Imatinib in Metastatic Gastrointestinal Stromal Tumors (GIST) Patients
NCT01151852	Phase 3	COMPLETED	Rechallenge of Imatinib in GIST Having no Effective Treatment: RIGHT
NCT01265810	Phase 3	COMPLETED	Caphosol in Oral Mucositis Due to Targeted Therapy
NCT01271712	Phase 3	COMPLETED	Study of Regorafenib as a 3rd-line or Beyond Treatment for Gastrointestinal Stromal Tumors (GIST)
NCT01289028	Phase 3	COMPLETED	Efficacy of Nilotinib in Adult Patients With Gastrointestinal Stromal Tumors Resistant to Imatinib and Sunitinib.
NCT01462994	Phase 3	COMPLETED	Detection of CF-DNA in Patients With Gastrointestinal Stromal Tumors (GIST)
NCT01694277	Phase 3	COMPLETED	Masitinib in Patients With Gastrointestinal Stromal Tumour After Progression With Imatinib
NCT02260505	Phase 3	COMPLETED	Efficiency of Imatinib Treatment Maintenance or Interruption After 3 Years of Adjuvant Treatment in Patients With Gastrointestinal Stromal Tumours (GIST)
NCT02576080	Phase 3	UNKNOWN	Efficacy of Imatinib in Patients With Intermediate-risk Gastrointestinal Stromal Tumor With a High-risk Genomic Grade Index
NCT02866045	Phase 3	UNKNOWN	EUS-FNB vs. Single-incision Needle-knife (SINK) Biopsy for Gastrointestinal SELs
NCT03353753	Phase 3	COMPLETED	Phase 3 Study of DCC-2618 vs Placebo in Advanced GIST Patients Who Have Been Treated With Prior Anticancer Therapies
NCT03426722	Phase 3	COMPLETED	L-carnitine vs Placebo for the Treatment of Muscle Cramps After Imatinib in Gastrointestinal Stromal Tumors
NCT03465722	Phase 3	COMPLETED	(VOYAGER) Study of Avapritinib vs Regorafenib in Patients With Locally Advanced Unresectable or Metastatic GIST
NCT03673501	Phase 3	ACTIVE_NOT_RECRUITING	A Study of Ripretinib vs Sunitinib in Advanced GIST Patients After Treatment With Imatinib
NCT04409223	Phase 3	TERMINATED	Efficacy and Safety of Famitinib Versus Sunitinib in the Treatment of Advanced Gastrointestinal Stromal Tumour Patients After Failure of Imatinib
NCT05208047	Phase 3	RECRUITING	(Peak) A Phase 3 Randomized Trial of CGT9486+Sunitinib vs. Sunitinib in Subjects With Gastrointestinal Stromal Tumors
NCT05734105	Phase 3	ACTIVE_NOT_RECRUITING	A Study of Ripretinib vs Sunitinib in Patients With Advanced GIST With Specific KIT Exon Mutations Who Were Previously Treated With Imatinib
NCT06640361	Phase 3	RECRUITING	A Study of Olverembatinib in SDH-deficient GIST.
NCT07585266	Phase 3	RECRUITING	A Study to Investigate Velzatinib Compared With Imatinib in Adult Participants With Previously Untreated Metastatic and/or Unresectable Gastrointestinal Stromal Tumors (StrateGIST Frontline)
NCT01721733	Phase 2	COMPLETED	Safety and Efficacy Study of EPI-743 in Children With Leigh Syndrome
NCT02352896	Phase 2	COMPLETED	Long-Term Safety and Efficacy Evaluation of EPI-743 in Children With Leigh Syndrome
NCT03747328	Phase 2	WITHDRAWN	ABI-009 (Nab-sirolimus) in Patients With Genetically-confirmed Leigh or Leigh-like Syndrome
NCT06843811	Phase 2	ENROLLING_BY_INVITATION	Sirolimus for Leigh Syndrome
NCT06990984	Phase 2	NOT_YET_RECRUITING	A Dose-ranging Study of TTI-0102 in Adults and Children With Leigh Syndrome Spectrum (LSS)
NCT00003939	Phase 2	COMPLETED	Ecteinascidin 743 in Treating Patients With Advanced Soft Tissue Sarcoma
NCT00004895	Phase 2	COMPLETED	Octreotide as Palliative Therapy for Cancer-Related Bowel Obstruction That Cannot Be Removed by Surgery
NCT00005049	Phase 2	COMPLETED	Combination Chemotherapy in Treating Patients With Stage III Ovarian Epithelial Cancer or Gastrointestinal Cancer
NCT00005597	Phase 2	COMPLETED	S9926 Temozolomide in Patients With Unresectable/Metastatic Gastrointestinal Stromal Tumors
NCT00005862	Phase 2	COMPLETED	SU5416 in Treating Patients With Advanced, Metastatic, or Recurrent Soft Tissue Sarcomas
NCT00005874	Phase 2	COMPLETED	Nitrocamptothecin in Treating Patients With Soft Tissue Sarcomas
NCT00025246	Phase 2	COMPLETED	Imatinib Mesylate in Treating Patients With Gastrointestinal Stromal Tumor That Has Been Completely Removed During Surgery
NCT00028002	Phase 2	COMPLETED	Neoadjuvant and Adjuvant Imatinib Mesylate in Treating Patients With Primary or Recurrent Malignant Gastrointestinal Stromal Tumor
NCT00030667	Phase 2	COMPLETED	Imatinib Mesylate in Treating Patients With Relapsed or Refractory Solid Tumors of Childhood
NCT00041249	Phase 2	COMPLETED	Brostallicin in Treating Patients With Locally Advanced or Metastatic Soft Tissue Sarcoma
NCT00087074	Phase 2	COMPLETED	CCI-779 in Treating Patients With Soft Tissue Sarcoma or Gastrointestinal Stromal Tumor
NCT00091078	Phase 2	TERMINATED	Oblimersen and Imatinib Mesylate in Treating Patients With Advanced Gastrointestinal Stromal Tumors That Cannot Be Removed By Surgery
NCT00112463	Phase 2	COMPLETED	Depsipeptide (Romidepsin) in Treating Patients With Metastatic or Unresectable Soft Tissue Sarcoma
NCT00112632	Phase 2	COMPLETED	Imatinib Mesylate in Treating Patients With Locally Advanced Gastrointestinal Stromal Tumor
NCT00137449	Phase 2	COMPLETED	Study Of SU011248 Administered On A Continuous Daily Dosing Schedule In Patients With Gastrointestinal Stromal Tumor
NCT00237172	Phase 2	COMPLETED	Phase II Clinical Study of Imatinib Mesylate in Patients With Malignant Gastrointestinal Stromal Tumors (Extension Study)

Predicted chemistry — Sugi Predict

The predicted patent-compound landscape for SDHA across ~30M SureChEMBL compounds — explore on Sugi Predict.