SELENON

Summary

SELENON (selenoprotein N, HGNC:15999) is a protein-coding gene on chromosome 1p36.11, encoding Selenoprotein N (Q9NZV5). Plays an important role in cell protection against oxidative stress and in the regulation of redox-related calcium homeostasis.

This gene encodes a glycoprotein that is localized in the endoplasmic reticulum. It plays an important role in cell protection against oxidative stress, and in the regulation of redox-related calcium homeostasis. Mutations in this gene are associated with early onset muscle disorders, referred to as SEPN1-related myopathy. SEPN1-related myopathy consists of 4 autosomal recessive disorders, originally thought to be separate entities: rigid spine muscular dystrophy (RSMD1), the classical form of multiminicore disease, desmin related myopathy with Mallory-body like inclusions, and congenital fiber-type disproportion (CFTD). This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3’ UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. A second stop-codon redefinition element (SRE) adjacent to the UGA codon has been identified in this gene (PMID:15791204). SRE is a phylogenetically conserved stem-loop structure that stimulates readthrough at the UGA codon, and augments the Sec insertion efficiency by SECIS. Alternatively spliced transcript variants have been found for this gene.

Source: NCBI Gene 57190 — RefSeq curated summary.

At a glance

• Gene–disease (curated): SELENON-related myopathy (Definitive, ClinGen) — +5 more curated relationships
• GWAS associations: 2
• Clinical variants (ClinVar): 817 total — 62 pathogenic, 20 likely-pathogenic
• Phenotypes (HPO): 114
• MANE Select transcript: NM_206926

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:15999
Approved symbol	SELENON
Name	selenoprotein N
Location	1p36.11
Locus type	gene with protein product
Status	Approved
Aliases	SELN, RSS
Ensembl gene	ENSG00000162430
Ensembl biotype	protein_coding
OMIM	606210
Entrez	57190

Gene structure

Transcript identifiers

Ensembl transcripts: 4 — 3 protein_coding, 1 nonsense_mediated_decay

ENST00000354177, ENST00000361547, ENST00000374315, ENST00000494537

RefSeq mRNA: 2 — MANE Select: NM_206926 NM_020451, NM_206926

CCDS: CCDS41282, CCDS41283

Canonical transcript exons

ENST00000374315 — 12 exons

Exon	Start	End
ENSE00001399175	25800193	25800413
ENSE00001463120	25815548	25818221
ENSE00001508522	25812687	25812792
ENSE00001508524	25811454	25811535
ENSE00001508525	25809683	25809820
ENSE00001508526	25809026	25809150
ENSE00001508527	25808580	25808789
ENSE00001508528	25805142	25805275
ENSE00001508530	25801043	25801160
ENSE00003605352	25813881	25813993
ENSE00003605355	25814077	25814178
ENSE00003613171	25811691	25811879

Expression profiles

Bgee: expression breadth ubiquitous, 244 present calls, max score 97.39.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 75.9033 / max 625.5423, expressed in 1813 samples.

FANTOM5 promoters (4 alternative TSS)

Promoter ID	TPM avg	Samples expressed
1539	74.3630	1812
1542	0.6123	351
1543	0.4843	291
1540	0.4437	258

Top tissues by expression

253 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
stromal cell of endometrium	CL:0002255	97.39	gold quality
ventricular zone	UBERON:0003053	96.87	gold quality
ganglionic eminence	UBERON:0004023	96.42	gold quality
apex of heart	UBERON:0002098	95.25	gold quality
smooth muscle tissue	UBERON:0001135	95.20	gold quality
right lobe of thyroid gland	UBERON:0001119	94.70	gold quality
mucosa of stomach	UBERON:0001199	94.37	gold quality
omental fat pad	UBERON:0010414	94.31	gold quality
peritoneum	UBERON:0002358	94.26	gold quality
left lobe of thyroid gland	UBERON:0001120	93.90	gold quality
lower esophagus	UBERON:0013473	93.90	gold quality
lower esophagus muscularis layer	UBERON:0035833	93.90	gold quality
adipose tissue of abdominal region	UBERON:0007808	93.67	gold quality
right ovary	UBERON:0002118	93.66	gold quality
upper lobe of left lung	UBERON:0008952	93.55	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	93.49	gold quality
thyroid gland	UBERON:0002046	93.46	gold quality
left uterine tube	UBERON:0001303	93.41	gold quality
body of pancreas	UBERON:0001150	93.34	gold quality
body of uterus	UBERON:0009853	93.20	gold quality
left ovary	UBERON:0002119	93.10	gold quality
right coronary artery	UBERON:0001625	93.09	gold quality
left adrenal gland cortex	UBERON:0035825	93.09	gold quality
upper lobe of lung	UBERON:0008948	93.07	gold quality
endocervix	UBERON:0000458	93.05	gold quality
prostate gland	UBERON:0002367	92.93	gold quality
left coronary artery	UBERON:0001626	92.89	gold quality
left adrenal gland	UBERON:0001234	92.85	gold quality
gall bladder	UBERON:0002110	92.78	gold quality
vermiform appendix	UBERON:0001154	92.69	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	10.51

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

132 targeting SELENON, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-513A-5P	100.00	69.77	2465
HSA-MIR-6851-5P	100.00	65.63	1294
HSA-MIR-6870-5P	99.99	68.55	2115
HSA-MIR-12136	99.98	72.81	5713
HSA-MIR-27A-3P	99.98	72.13	2955
HSA-MIR-27B-3P	99.98	72.13	2955
HSA-MIR-9985	99.98	72.11	2939
HSA-MIR-4775	99.98	75.00	6394
HSA-MIR-7111-5P	99.97	68.48	2062
HSA-MIR-4723-5P	99.97	68.70	2034
HSA-MIR-5698	99.97	68.49	2029
HSA-MIR-590-3P	99.96	74.34	6478
HSA-MIR-2110	99.96	66.68	1930
HSA-MIR-6825-5P	99.96	69.81	3431
HSA-MIR-6780B-5P	99.96	69.60	2562
HSA-MIR-4725-3P	99.96	69.53	2520
HSA-MIR-4525	99.94	64.38	675
HSA-MIR-5010-5P	99.94	64.11	705
HSA-MIR-539-5P	99.93	70.30	2855
HSA-MIR-4731-5P	99.89	67.23	2537
HSA-MIR-7162-3P	99.89	68.16	1682
HSA-MIR-4492	99.87	68.25	3611
HSA-MIR-6857-5P	99.87	65.32	985
HSA-MIR-4728-5P	99.85	69.39	4718
HSA-MIR-4447	99.85	67.81	2900
HSA-MIR-6785-5P	99.82	68.68	4428
HSA-MIR-6875-3P	99.82	70.26	2983
HSA-MIR-4319	99.76	69.83	2586
HSA-MIR-6763-5P	99.76	64.68	1767
HSA-MIR-3913-3P	99.74	66.53	938

Literature-anchored findings (GeneRIF, showing 25)

• Mutations of the selenoprotein N gene, which is implicated in rigid spine muscular dystrophy, cause the classical phenotype of multiminicore disease (PMID:12192640)
• A new SEPN1 point mutation, 943g->A causing G315S was found in a rigid spine muscular dystrophy patient with cor pulmonale. (PMID:15668457)
• SEPN1 mutation analysis revealed that the patient was a compound heterozygote: a previously described insertion (713-714 insA), and a novel nonsense mutation (R439stop). (PMID:15792869)
• Two patients with ‘Dropped head syndrome’ due to mutations in SEPN1 genes. (PMID:15961312)
• SEPN1 is the second genetic cause of CFTD and the first cause of autosomal recessive CFTD to be identified to our knowledge. CFTD is the fourth clinicopathological presentation that can be associated with mutations in SEPN1. (PMID:16365872)
• identification of this mutation affecting a conserved base in the selenocysteine insertion sequence functional motif thereby reveals the structural basis for a novel pathological mechanism leading to SEPN1-related myopathy (PMID:16498447)
• We report on the possible molecular mechanism behind these mutations in SEPN1. Our study clarifies molecular mechanisms of this muscular disorder. (PMID:16779558)
• SEPN1 and RYR1 are required for the same cellular differentiation events and are needed for normal calcium fluxes (PMID:18713863)
• The Alu-derived exon 3 of human SEPN1 acquired its muscle-specific splicing activity after the divergence of humans and chimpanzees, suggesting its potential role in human evolution. (PMID:18841251)
• Data highlights the importance of the SRE element during SelN expression and illustrates a novel molecular mechanism by which point mutations may lead to SEPN1-related myopathy. (PMID:19067361)
• SelN plays a key role in redox homeostasis and human cell protection against oxidative stress. (PMID:19557870)
• this series of patients illustrates the clinical, histopathological and MRI findings of SEPN1-related myopathy. It also adds new mutations to the limited number of fully described pathogenic SEPN1 variants. (PMID:20937510)
• Data show that Argonaute 2 expression is critical for stem cells to escape senescence by downregulating miR10b and miR23b, and that selenoprotein N1 is also involved in ATSC survival and self-renewal through ROS-mediated p38 MAPK inactivation. (PMID:21241449)
• Data show that the spectrum of severity of SEPN1-related myopathiesis wider than previously reported. (PMID:21670436)
• The physiological function of SelN in muscle tissue and the pathogenesis leading to SEPN1-related myopathies. [Review] (PMID:22527882)
• We report two previously undescribed mutations in SEPN1. Our study adds two novel homozygous mutations to the number of reported pathogenic SEPN1 variants. (PMID:26780752)
• Case Report: rigid spine muscular dystrophy 1 in a compound heterozygote with two novel mutations in SEPN1 gene; a novel missense mutation (c.1384T>C; p.Sec462Arg) and a novel nonsense mutation (c.1525C>T; p.Gln509Ter), inherited from his father and mother respectively. (PMID:27863379)
• significantly down-regulated in mesangial cells exposed to high glucose or TGF-beta1 (PMID:31880214)
• Defective endoplasmic reticulum-mitochondria contacts and bioenergetics in SEPN1-related myopathy. (PMID:32661288)
• The clinical, histologic, and genotypic spectrum of SEPN1-related myopathy: A case series. (PMID:32796131)
• Selenoprotein N is an endoplasmic reticulum calcium sensor that links luminal calcium levels to a redox activity. (PMID:32817544)
• The first report of two homozygous sequence variants in FKRP and SELENON genes associated with syndromic congenital muscular dystrophy in Iran: Further expansion of the clinical phenotypes. (PMID:32864802)
• Selenoprotein N-related myopathy: a retrospective natural history study to guide clinical trials. (PMID:33037864)
• [Selenoprotein-related myopathy in a patient with old-age-onset type 2 respiratory failure: a case report]. (PMID:33762497)
• Cardiac Involvement in LAMA2-Related Muscular Dystrophy and SELENON-Related Congenital Myopathy: A Case Series. (PMID:39177608)

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Selenon	ENSMUSG00000050989
rattus_norvegicus	Selenon	ENSRNOG00000017078

Paralogs (2): BEND2 (ENSG00000177324), HOATZ (ENSG00000183644)

Protein

Protein identifiers

Selenoprotein N — Q9NZV5 (reviewed: Q9NZV5)

All UniProt accessions (3): A0A804HLD6, Q9NZV5, H9KV50

UniProt curated annotations — full annotation on UniProt →

Function. Plays an important role in cell protection against oxidative stress and in the regulation of redox-related calcium homeostasis. Regulates the calcium level of the ER by protecting the calcium pump ATP2A2 against the oxidoreductase ERO1A-mediated oxidative damage. Within the ER, ERO1A activity increases the concentration of H(2)O(2), which attacks the luminal thiols in ATP2A2 and thus leads to cysteinyl sulfenic acid formation (-SOH) and SEPN1 reduces the SOH back to free thiol (-SH), thus restoring ATP2A2 activity. Acts as a modulator of ryanodine receptor (RyR) activity: protects RyR from oxidation due to increased oxidative stress, or directly controls the RyR redox state, regulating the RyR-mediated calcium mobilization required for normal muscle development and differentiation. Essential for muscle regeneration and satellite cell maintenance in skeletal muscle.

Subunit / interactions. Interacts with RYR1, RYR2 and RYR3.

Subcellular location. Endoplasmic reticulum membrane.

Tissue specificity. Isoform 1 and isoform 2 are expressed in skeletal muscle, brain, lung and placenta. Isoform 2 is also expressed in heart, diaphragm and stomach.

Post-translational modifications. N-glycosylated.

Disease relevance. Congenital myopathy 3 with rigid spine (CMYO3) [MIM:602771] An autosomal recessive, slowly progressive muscular disorder apparent from birth or early childhood and characterized by hypotonia, proximal muscle weakness, poor axial muscle strength, scoliosis and neck weakness, and a variable degree of spinal rigidity. Most patients remain ambulatory. Early ventilatory insufficiency may lead to death by respiratory failure. Additional features may include facial muscle weakness, amyotrophy, joint contractures, distal hyperlaxity, pulmonary hypertension with secondary cardiac dysfunction, and insulin resistance in patients with a low BMI. Skeletal muscle biopsy typically shows multiminicores and other abnormal non-specific myopathic findings. The disease is caused by variants affecting the gene represented in this entry.

Domain organisation. The N-terminus (first 61 amino acids) contains an endoplasmic reticulum addressing and retention targeting signal.

Miscellaneous. The UGA codons present in position 127 and 462 are either a selenocysteine or a real stop codon. The UGA codon present in position 428 is either a selenocysteine or a real stop codon.

Isoforms (2)

UniProt ID	Names	Canonical?
Q9NZV5-1	1	yes
Q9NZV5-2	2

RefSeq proteins (2): NP_065184, NP_996809* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR002048	EF_hand_dom	Domain

UniProt features (27 total): sequence variant 13, glycosylation site 5, non-standard amino acid 2, signal peptide 1, chain 1, splice variant 1, domain 1, sequence conflict 1, region of interest 1, compositionally biased region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

No AlphaFold model available for Q9NZV5 — AlphaFold DB does not currently provide models for proteins above ~3000 aa.

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Glycosylation sites (5): 505, 531, 126, 190, 483

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 425 (showing top): GOBP_RESPONSE_TO_NITROGEN_COMPOUND, GOBP_CARBOHYDRATE_TRANSPORT, GOBP_RESPIRATORY_GASEOUS_EXCHANGE_BY_RESPIRATORY_SYSTEM, GOBP_MUSCLE_TISSUE_DEVELOPMENT, GOBP_SKELETAL_MUSCLE_TISSUE_REGENERATION, GOBP_COLLAGEN_FIBRIL_ORGANIZATION, GOBP_MEMBRANE_BIOGENESIS, GOBP_RESPONSE_TO_ENDOPLASMIC_RETICULUM_STRESS, GOBP_GROWTH, GOBP_STRIATED_MUSCLE_CELL_DIFFERENTIATION, GOBP_RESPIRATORY_SYSTEM_PROCESS, GOBP_REGENERATION, GOBP_ORGANOPHOSPHATE_METABOLIC_PROCESS, GOBP_MULTICELLULAR_ORGANISMAL_MOVEMENT, GOBP_MUSCLE_CELL_PROLIFERATION

GO Biological Process (35): diaphragm contraction (GO:0002086), energy reserve metabolic process (GO:0006112), mitochondrial calcium ion transmembrane transport (GO:0006851), mitochondrion organization (GO:0007005), transforming growth factor beta receptor signaling pathway (GO:0007179), gene expression (GO:0010467), skeletal muscle satellite cell differentiation (GO:0014816), skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834), positive regulation of skeletal muscle cell proliferation (GO:0014858), response to muscle activity involved in regulation of muscle adaptation (GO:0014873), L-ascorbic acid transmembrane transport (GO:0015882), L-ascorbic acid metabolic process (GO:0019852), membrane to membrane docking (GO:0022614), collagen fibril organization (GO:0030199), multicellular organismal response to stress (GO:0033555), cellular response to oxidative stress (GO:0034599), response to endoplasmic reticulum stress (GO:0034976), membrane biogenesis (GO:0044091), cell redox homeostasis (GO:0045454), ATP metabolic process (GO:0046034), lung alveolus development (GO:0048286), skeletal muscle fiber development (GO:0048741), calcium ion homeostasis (GO:0055074), regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314), membrane organization (GO:0061024), calcium ion import (GO:0070509), cellular response to caffeine (GO:0071313), positive regulation of response to oxidative stress (GO:1902884), obsolete mitochondrion-endoplasmic reticulum membrane tethering (GO:1990456), respiratory system process (GO:0003016), generation of precursor metabolites and energy (GO:0006091), calcium ion transport (GO:0006816), skeletal muscle tissue development (GO:0007519), skeletal muscle tissue regeneration (GO:0043403), muscle structure development (GO:0061061)

GO Molecular Function (3): calcium ion binding (GO:0005509), oxidoreductase activity (GO:0016491), protein binding (GO:0005515)

GO Cellular Component (6): endoplasmic reticulum membrane (GO:0005789), mitochondrial membrane (GO:0031966), mitochondria-associated endoplasmic reticulum membrane contact site (GO:0044233), mitochondrion (GO:0005739), endoplasmic reticulum (GO:0005783), membrane (GO:0016020)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
organelle membrane	2
cytoplasm	2
intracellular membrane-bounded organelle	2
involuntary skeletal muscle contraction	1
respiratory system process	1
energy derivation by oxidation of organic compounds	1
calcium ion transmembrane transport	1
organelle organization	1
cellular response to transforming growth factor beta stimulus	1
transforming growth factor beta receptor superfamily signaling pathway	1
macromolecule biosynthetic process	1
skeletal muscle cell differentiation	1
skeletal muscle tissue regeneration	1
maintenance of cell number	1
positive regulation of cell population proliferation	1
skeletal muscle cell proliferation	1
regulation of skeletal muscle cell proliferation	1
response to muscle activity	1
regulation of muscle adaptation	1
monosaccharide transmembrane transport	1
vitamin transmembrane transport	1
carboxylic acid transmembrane transport	1
monosaccharide metabolic process	1
carboxylic acid metabolic process	1
lactone metabolic process	1
membrane docking	1
extracellular matrix organization	1
response to stress	1
multicellular organismal process	1
response to oxidative stress	1
cellular response to chemical stress	1
cellular response to stress	1
cellular component biogenesis	1
cellular homeostasis	1
purine ribonucleotide metabolic process	1
purine ribonucleoside triphosphate metabolic process	1
metal ion binding	1
catalytic activity	1
binding	1
nuclear outer membrane-endoplasmic reticulum membrane network	1

Protein interactions and networks

STRING

616 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
SELENON	SELENOK	Q9Y6D0	914
SELENON	SELENOO	Q9BVL4	904
SELENON	SELENOT	P62341	894
SELENON	SELENOF	O60613	872
SELENON	SELENOS	Q9BQE4	872
SELENON	SECISBP2	Q96T21	861
SELENON	SELENOM	Q8WWX9	857
SELENON	RYR1	P21817	847
SELENON	SEPHS2	Q99611	804
SELENON	MSRB1	Q9NZV6	798
SELENON	SELENOH	Q8IZQ5	796
SELENON	MYOT	Q9UBF9	788
SELENON	SELENOI	Q9C0D9	787
SELENON	SELENOW	P63302	786
SELENON	SELENOV	P59797	776

IntAct

93 interactions, top by confidence:

A	B	Type	Score
B3GNT3	PGRMC1	psi-mi:“MI:0914”(association)	0.670
IFT57	IFT56	psi-mi:“MI:0914”(association)	0.640
TRDN	TMEM223	psi-mi:“MI:0914”(association)	0.640
FBXO2	TMEM131L	psi-mi:“MI:0914”(association)	0.530
PBXIP1	GOLIM4	psi-mi:“MI:0914”(association)	0.530
EMILIN3	ZZEF1	psi-mi:“MI:0914”(association)	0.530
LACRT	PLXNA2	psi-mi:“MI:0914”(association)	0.530
PEX19	FAM20B	psi-mi:“MI:0914”(association)	0.530
WDR5B	TCP1	psi-mi:“MI:0914”(association)	0.530
CNPY3	SELENOT	psi-mi:“MI:0914”(association)	0.530
SLC39A4	TMEM120B	psi-mi:“MI:0914”(association)	0.530
NCEH1	CLGN	psi-mi:“MI:0914”(association)	0.530
PBXIP1	KCNN4	psi-mi:“MI:0914”(association)	0.530
OS9	AGRN	psi-mi:“MI:0914”(association)	0.530
PEX19	MYO1D	psi-mi:“MI:0914”(association)	0.530
ABHD14A	TMEM259	psi-mi:“MI:0914”(association)	0.530
GPIHBP1	ADAM10	psi-mi:“MI:0914”(association)	0.530
SCGB2A1	SLC27A2	psi-mi:“MI:0914”(association)	0.530
ST8SIA5	SELENON	psi-mi:“MI:0915”(physical association)	0.500
SELENON	ABL1	psi-mi:“MI:0915”(physical association)	0.400
SRC	SELENON	psi-mi:“MI:0915”(physical association)	0.400
SELENON	FYN	psi-mi:“MI:0915”(physical association)	0.400
SELENON	GRB2	psi-mi:“MI:0915”(physical association)	0.400
SELENON	NCK1	psi-mi:“MI:0915”(physical association)	0.400

BioGRID (91): SEPN1 (Affinity Capture-MS), SEPN1 (Affinity Capture-MS), SEPN1 (Affinity Capture-MS), SEPN1 (Affinity Capture-MS), SEPN1 (Affinity Capture-MS), SEPN1 (Affinity Capture-MS), SEPN1 (Affinity Capture-MS), SEPN1 (Affinity Capture-MS), SEPN1 (Affinity Capture-MS), SEPN1 (Affinity Capture-MS), SEPN1 (Affinity Capture-MS), SEPN1 (Affinity Capture-MS), SEPN1 (Affinity Capture-MS), SEPN1 (Affinity Capture-MS), SEPN1 (Affinity Capture-MS)

ESM2 similar proteins: A0JPE1, A4D0V7, D3Z2R5, O43916, P97259, Q08834, Q09328, Q1RLQ5, Q3TUA9, Q4V8A9, Q58CX7, Q5F349, Q5FVL3, Q5HZP7, Q5NDE4, Q5NDE5, Q5NDE7, Q5NDE8, Q5R634, Q5R9Q9, Q5RJQ0, Q5T7M9, Q5U3W1, Q5VUD6, Q640M6, Q68CR1, Q6DBY9, Q6DCL6, Q6Q2W4, Q80TS8, Q8C1F4, Q8C3I9, Q8N6G5, Q8NBP0, Q8NHY0, Q8R4G6, Q8R553, Q8WTR4, Q92179, Q95JJ0

Diamond homologs: D3Z2R5, Q01H84, Q3Y4E2, Q9NZV5

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

817 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	62
Likely pathogenic	20
Uncertain significance	316
Likely benign	260
Benign	60

Top pathogenic / likely-pathogenic (30)

Variant ID	HGVS	Classification
1075320	NM_206926.2(SELENON):c.1212_1215del (p.Asp404fs)	Pathogenic
1076253	NM_206926.2(SELENON):c.984dup (p.Pro329fs)	Pathogenic
1323573	NM_206926.2(SELENON):c.344_345del (p.Pro115fs)	Pathogenic
1411446	NM_206926.2(SELENON):c.18_46del (p.Gly7fs)	Pathogenic
1420223	NM_206926.2(SELENON):c.470G>A (p.Trp157Ter)	Pathogenic
1445921	NM_206926.2(SELENON):c.8_9insTGCCGGGCCG (p.Arg5fs)	Pathogenic
1451790	NM_206926.2(SELENON):c.598_599insC (p.Tyr200fs)	Pathogenic
1453339	NM_206926.2(SELENON):c.160G>T (p.Glu54Ter)	Pathogenic
1704255	NM_206926.2(SELENON):c.671del (p.Met224fs)	Pathogenic
193429	NM_206926.2(SELENON):c.44_72dup (p.Arg25fs)	Pathogenic
193432	NM_206926.2(SELENON):c.13_22dup (p.Gln8fs)	Pathogenic
2001607	NM_206926.2(SELENON):c.861dup (p.Asp288fs)	Pathogenic
2094929	NM_206926.2(SELENON):c.1180-1G>T	Pathogenic
2113172	NM_206926.2(SELENON):c.-21_183+6del	Pathogenic
2159320	NM_206926.2(SELENON):c.1087C>T (p.Gln363Ter)	Pathogenic
2412662	NM_206926.2(SELENON):c.69_76dup (p.Arg26fs)	Pathogenic
2412672	NM_206926.2(SELENON):c.1074del (p.Glu360fs)	Pathogenic
2418838	NM_206926.2(SELENON):c.-30_64del (p.Met1fs)	Pathogenic
2499519	NM_206926.2(SELENON):c.1066del (p.Leu356fs)	Pathogenic
280366	NM_206926.2(SELENON):c.988C>T (p.Gln330Ter)	Pathogenic
280493	NM_206926.2(SELENON):c.895_898del (p.Val299fs)	Pathogenic
2862485	NM_206926.2(SELENON):c.788_879dup (p.Asp294fs)	Pathogenic
2863453	NM_206926.2(SELENON):c.-10_135del (p.Met1fs)	Pathogenic
3024392	NM_206926.2(SELENON):c.1180-13G>A	Pathogenic
3247693	NC_000001.10:g.(?26126650)(26126749_?)del	Pathogenic
3366830	NM_206926.2(SELENON):c.4_5insCCCG (p.Gly2fs)	Pathogenic
3380903	NM_206926.2(SELENON):c.967del (p.Val323fs)	Pathogenic
3731302	NM_206926.2(SELENON):c.301+2T>C	Pathogenic
4056466	Single allele	Pathogenic
419984	NM_206926.2(SELENON):c.581_587dup (p.Met196fs)	Pathogenic

SpliceAI

2103 predictions. Top by Δscore:

Variant	Effect	Δscore
1:25805273:GGG:G	donor_gain	1.0000
1:25805274:GG:G	donor_gain	1.0000
1:25805274:GGG:G	donor_gain	1.0000
1:25805275:GG:G	donor_gain	1.0000
1:25809149:CGGT:C	donor_loss	1.0000
1:25809151:G:C	donor_loss	1.0000
1:25809152:T:A	donor_loss	1.0000
1:25811442:T:TA	acceptor_gain	1.0000
1:25811448:TCCCA:T	acceptor_loss	1.0000
1:25811449:CCCAG:C	acceptor_loss	1.0000
1:25811450:CCAG:C	acceptor_loss	1.0000
1:25811452:A:AG	acceptor_gain	1.0000
1:25811452:A:T	acceptor_loss	1.0000
1:25811453:G:A	acceptor_loss	1.0000
1:25811453:G:GG	acceptor_gain	1.0000
1:25811532:CCAGG:C	donor_loss	1.0000
1:25811535:GG:G	donor_loss	1.0000
1:25811676:T:TA	acceptor_gain	1.0000
1:25811683:T:A	acceptor_gain	1.0000
1:25811728:T:TA	acceptor_gain	1.0000
1:25811857:T:TA	donor_gain	1.0000
1:25811859:GCCAT:G	donor_gain	1.0000
1:25811876:GAAG:G	donor_gain	1.0000
1:25813878:CA:C	acceptor_loss	1.0000
1:25813879:A:AG	acceptor_gain	1.0000
1:25813879:A:AT	acceptor_loss	1.0000
1:25813879:AG:A	acceptor_gain	1.0000
1:25813880:G:GA	acceptor_gain	1.0000
1:25813880:GG:G	acceptor_gain	1.0000
1:25813880:GGTT:G	acceptor_gain	1.0000

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000261431 (1:25804494 G>A), RS1000428299 (1:25810144 G>A,C,T), RS1001116390 (1:25803500 A>G), RS1001504099 (1:25815594 A>C), RS1001735806 (1:25805643 TTTCCCACACACTATGATGATTAC>T,TTTCCCACACACTATGATGATTACTTCCCACACACTATGATGATTAC), RS1001924903 (1:25813076 A>G), RS1002061101 (1:25807365 C>T), RS1002157189 (1:25814367 G>A), RS1002317801 (1:25808942 G>A,T), RS1002771044 (1:25817125 G>A), RS1002791498 (1:25802131 C>T), RS1002811396 (1:25799621 T>C,G), RS1002845386 (1:25801893 A>C,G), RS1002863838 (1:25806810 A>C,G), RS1003041718 (1:25817687 A>G)

Disease associations

OMIM: gene MIM:606210 | disease phenotypes: MIM:602771, MIM:255310

GenCC curated gene-disease

Disease	Classification	Inheritance
rigid spine muscular dystrophy 1	Definitive	Autosomal recessive
SELENON-related myopathy	Definitive	Autosomal recessive
congenital myopathy 4A, autosomal dominant	Strong	Autosomal recessive
congenital fiber-type disproportion myopathy	Supportive	Autosomal dominant
desmin-related myopathy with Mallory body-like inclusions	Supportive	Autosomal recessive
rigid spine syndrome	Supportive	Autosomal recessive

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
SELENON-related myopathy	Definitive	AR

Mondo (8): rigid spine muscular dystrophy 1 (MONDO:0011271), congenital myopathy 4A, autosomal dominant (MONDO:0800341), congenital fiber-type disproportion myopathy (MONDO:0009711), cleft lip/palate (MONDO:0016044), muscular dystrophy (MONDO:0020121), SELENON-related myopathy (MONDO:0100100), desmin-related myopathy with Mallory body-like inclusions (MONDO:0019398), rigid spine syndrome (MONDO:0019951)

Orphanet (3): Congenital fiber-type disproportion myopathy (Orphanet:2020), Cleft lip/palate (Orphanet:199306), Muscular dystrophy (Orphanet:98473)

HPO phenotypes

114 total (30 of 114 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000218	High palate
HP:0000276	Long face
HP:0000303	Mandibular prognathia
HP:0000308	Microretrognathia
HP:0000347	Micrognathia
HP:0000467	Neck muscle weakness
HP:0000602	Ophthalmoplegia
HP:0000678	Dental crowding
HP:0000767	Pectus excavatum
HP:0001249	Intellectual disability
HP:0001252	Hypotonia
HP:0001263	Global developmental delay
HP:0001265	Hyporeflexia
HP:0001270	Motor delay
HP:0001284	Areflexia
HP:0001290	Generalized hypotonia
HP:0001315	Reduced tendon reflexes
HP:0001371	Flexion contracture
HP:0001374	Congenital hip dislocation
HP:0001385	Hip dysplasia
HP:0001508	Failure to thrive
HP:0001547	Abnormal rib cage morphology
HP:0001558	Decreased fetal movement
HP:0001561	Polyhydramnios
HP:0001609	Hoarse voice
HP:0001611	Hypernasal speech
HP:0001620	Abnormally high-pitched voice
HP:0001627	Abnormal heart morphology
HP:0001634	Mitral valve prolapse

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST012490_18	Femur bone mineral density x serum urate levels interaction	4.000000e-13
GCST012490_589	Femur bone mineral density x serum urate levels interaction	9.000000e-11

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0004531	urate measurement

MeSH disease descriptors (2)

Descriptor	Name	Tree numbers
D009136	Muscular Dystrophies	C05.651.534.500; C10.668.491.175.500; C16.320.577
C535683	Rigid spine syndrome (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

26 total (human), top 26 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	increases abundance, affects expression, decreases expression, affects cotreatment	3
aristolochic acid I	decreases expression	1
FR900359	increases phosphorylation	1
dicrotophos	increases expression	1
methylmercuric chloride	decreases expression	1
bisphenol A	decreases methylation	1
manganese chloride	affects cotreatment, decreases expression, increases abundance	1
potassium chromate(VI)	affects cotreatment, increases expression	1
epigallocatechin gallate	affects cotreatment, increases expression	1
CGP 52608	affects binding, increases reaction	1
(+)-JQ1 compound	decreases expression	1
4-(4-((5-(4,5-dimethyl-2-nitrophenyl)-2-furanyl)methylene)-4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)benzoic acid	decreases expression	1
Acetaminophen	increases expression	1
Arsenic	increases abundance, affects cotreatment, decreases expression	1
Caffeine	decreases phosphorylation	1
Estradiol	affects expression	1
Hydrogen Peroxide	affects expression	1
Lead	affects methylation	1
Manganese	affects cotreatment, decreases expression, increases abundance	1
Smoke	decreases expression	1
Thiram	decreases expression	1
Tunicamycin	decreases expression	1
Aflatoxin B1	increases methylation	1
Cadmium Chloride	decreases expression	1
Acrylamide	decreases expression	1
Particulate Matter	increases expression	1

Cellosaurus cell lines

15 cell lines: 11 transformed cell line, 2 finite cell line, 2 induced pluripotent stem cell

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_A2PW	GM27120	Transformed cell line	Male
CVCL_AZ47	GM23651	Finite cell line	Male
CVCL_AZ51	GM24369	Transformed cell line	Male
CVCL_AZ55	GM24467	Finite cell line	Female
CVCL_BW03	GM23674	Transformed cell line	Male
CVCL_D6WL	GM29106	Induced pluripotent stem cell	Male
CVCL_F0Z7	GM29372	Induced pluripotent stem cell	Female
CVCL_WP05	GM27104	Transformed cell line	Female
CVCL_WP06	GM27105	Transformed cell line	Female
CVCL_WP07	GM27106	Transformed cell line	Male

Clinical trials (associated diseases)

216 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT04234971	PHASE4	RECRUITING	Cost Effectiveness in Alveolar Bone Grafting in Patients With Cleft Lip and Palate
NCT04771156	PHASE4	RECRUITING	Ketorolac in Palatoplasty
NCT01882400	PHASE4	COMPLETED	Assessment of Response to Treatment of Osteoporosis With Oral Bisphosphonates in Patients With Muscular Dystrophy
NCT03766217	PHASE3	COMPLETED	Bone Tissue Engineering With Dental Pulp Stem Cells for Alveolar Cleft Repair
NCT06284434	PHASE3	RECRUITING	Liposomal Bupivacaine Use in Alveolar Bone Graft Patients
NCT01254019	PHASE3	COMPLETED	A Clinical Study to Assess the Efficacy and Safety of GSK2402968 in Subjects With Duchenne Muscular Dystrophy
NCT01480245	PHASE3	TERMINATED	Open Label Study of GSK2402968 in Subjects With Duchenne Muscular Dystrophy
NCT01803412	PHASE3	TERMINATED	A Study of the Safety, Tolerability & Efficacy of Long-term Administration of Drisapersen in US & Canadian Subjects
NCT01826487	PHASE3	COMPLETED	Phase 3 Study of Ataluren in Participants With Nonsense Mutation Duchenne Muscular Dystrophy (nmDMD)
NCT01890798	PHASE3	WITHDRAWN	Drisapersen Duchenne Muscular Dystrophy (DMD) Treatment Protocol
NCT02090959	PHASE3	TERMINATED	An Extension Study of Ataluren (PTC124) in Participants With Nonsense Mutation Dystrophinopathy
NCT02432885	PHASE3	COMPLETED	Myocardial Fibrosis Progression in Duchenne and Becker Muscular Dystrophy - ACE Inhibitor Therapy Trial
NCT03179631	PHASE3	COMPLETED	Long-Term Outcomes of Ataluren in Duchenne Muscular Dystrophy
NCT05126758	PHASE3	ACTIVE_NOT_RECRUITING	A Study of Deramiocel (CAP-1002) in Ambulatory and Non-Ambulatory Patients With Duchenne Muscular Dystrophy
NCT07587242	PHASE3	NOT_YET_RECRUITING	A Phase 3 Study to Evaluate the Safety and Efficacy of AOC 1044 (Also Referred to as Delpacibart Zotadirsen) in Participants With DMD With Gene Mutations Amenable to Exon 44 Skipping
NCT07608432	PHASE3	RECRUITING	Efficacy, Safety, and Tolerability of Zeleciment Rostudirsen (DYNE-251) Administered Intravenously Every 4 Weeks in Ambulatory Participants With Duchenne Muscular Dystrophy (FORZETTO)
NCT00930124	PHASE2	COMPLETED	Cleft Orthognathic Surgery Versus Distraction Osteogenesis - Which is Better?
NCT01153932	PHASE2	COMPLETED	Phase II Doubleblind Exploratory Study of GSK2402968 in Ambulant Subjects With Duchenne Muscular Dystrophy
NCT01462292	PHASE2	COMPLETED	A Clinical Study to Assess Two Doses of GSK2402968 in Subjects With Duchenne Muscular Dystrophy (DMD)
NCT01910649	PHASE2	TERMINATED	A Phase I/II, Open Label, Escalating Dose, Pilot Study to Assess Effect, Safety, Tolerability and PK of Multiple SC Doses of Drisapersen in Patients With Duchenne Muscular Dystrophy and to Assess the Potential for IV Dosing as an Alternative Route of Administration
NCT03406780	PHASE2	COMPLETED	A Study of CAP-1002 in Ambulatory and Non-Ambulatory Patients With Duchenne Muscular Dystrophy
NCT05479981	PHASE2	COMPLETED	Extension of AOC 1001-CS1 (MARINA) Study in Adult Myotonic Dystrophy Type 1 (DM1) Patients
NCT06290713	PHASE2	RECRUITING	Vasodilator and Exercise Study for DMD (VASO-REx)
NCT06547216	PHASE2	ACTIVE_NOT_RECRUITING	Phase 2 Open-label Extension Study of AOC 1020 in Participants With Facioscapulohumeral Muscular Dystrophy (FSHD)
NCT07287189	PHASE2	RECRUITING	Phase 2 Study of SAT-3247 in Pediatric Ambulatory Patients
NCT00494195	PHASE1	COMPLETED	Gene Transfer Therapy for Treating Children and Adults With Limb Girdle Muscular Dystrophy Type 2D (LGMD2D)
NCT00674843	PHASE1	UNKNOWN	The Efficacy of Using Far Infrared Radiation to Manage Muscular Dystrophies
NCT00873782	PHASE1	COMPLETED	Safety Study of Transvenous Limb Perfusion in Human Muscular Dystrophy
NCT01128855	PHASE1	COMPLETED	A Double-blind, Escalating Dose, Randomized, Placebo-controlled Study Assessing PK, Safety, Tolerability in Non-ambulant DMD Subjects
NCT02241928	PHASE1	WITHDRAWN	Stem Cell Therapy in Muscular Dystrophy
NCT03627494	PHASE1	COMPLETED	First Time in Human (FTIH) Study to Evaluate the Safety, Pharmacokinetics, and Pharmacodynamics of Single and Repeat Doses of GSK3439171A in Healthy Subjects and to Assess Food Effect
NCT05492734	PHASE1	COMPLETED	A Study to Assess the Feasibility of Non-invasive Dried Blood Sampling
NCT05730842	PHASE1	COMPLETED	Absorption, Metabolism, Excretion and Absolute Bioavailability of EDG-5506 in Healthy Volunteers
NCT04745247	Not specified	UNKNOWN	Stimulate the Face to Improve Tactile Acuity on the Hand
NCT01403402	Not specified	RECRUITING	Congenital Muscle Disease Study of Patient and Family Reported Medical Information
NCT04478981	Not specified	COMPLETED	The Natural History of Patients With Mutations in SEPN1 (SELENON) or LAMA2
NCT06132750	Not specified	RECRUITING	A 5-year Natural History Study in LAMA2-related Muscular Dystrophy and SELENON-related Myopathy.
NCT00272883	Not specified	RECRUITING	Molecular and Genetic Studies of Congenital Myopathies
NCT06791369	Not specified	NOT_YET_RECRUITING	The Prevalence of RYR1-related Disease
NCT06408337	PHASE1/PHASE2	RECRUITING	Phase I-IIa, to Evaluate the Safety, Feasibility, and Efficacy of the Use of BIOCLEFT in the Treatment of Cleft Palate.