SENP3

Summary

SENP3 (SUMO specific peptidase 3, HGNC:17862) is a protein-coding gene on chromosome 17p13, encoding Sentrin-specific protease 3 (Q9H4L4). Protease that releases SUMO2 and SUMO3 monomers from sumoylated substrates, but has only weak activity against SUMO1 conjugates.

The reversible posttranslational modification of proteins by the addition of small ubiquitin-like SUMO proteins (see SUMO1; MIM 601912) is required for numerous biologic processes. SUMO-specific proteases, such as SENP3, are responsible for the initial processing of SUMO precursors to generate a C-terminal diglycine motif required for the conjugation reaction. They also have isopeptidase activity for the removal of SUMO from high molecular mass SUMO conjugates (Di Bacco et al., 2006 [PubMed 16738315]).

Source: NCBI Gene 26168 — RefSeq curated summary.

At a glance

• GWAS associations: 4
• Clinical variants (ClinVar): 54 total
• Druggable target: yes
• MANE Select transcript: NM_015670

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:17862
Approved symbol	SENP3
Name	SUMO specific peptidase 3
Location	17p13
Locus type	gene with protein product
Status	Approved
Aliases	DKFZP586K0919, SSP3, DKFZp762A152, SMT3IP1, Ulp1
Ensembl gene	ENSG00000161956
Ensembl biotype	protein_coding
OMIM	612844
Entrez	26168

Gene structure

Transcript identifiers

Ensembl transcripts: 11 — 7 protein_coding, 3 retained_intron, 1 nonsense_mediated_decay

ENST00000321337, ENST00000580231, ENST00000580997, ENST00000581010, ENST00000581093, ENST00000582789, ENST00000583277, ENST00000610454, ENST00000619785, ENST00000937871, ENST00000937872

RefSeq mRNA: 1 — MANE Select: NM_015670 NM_015670

CCDS: CCDS73958

Canonical transcript exons

ENST00000321337 — 11 exons

Exon	Start	End
ENSE00001262254	7566927	7567004
ENSE00001353640	7561919	7562263
ENSE00003521139	7570883	7570933
ENSE00003552505	7570356	7570493
ENSE00003584892	7565717	7565764
ENSE00003624359	7565440	7565587
ENSE00003645563	7564959	7565070
ENSE00003645642	7563066	7563791
ENSE00003649030	7564625	7564864
ENSE00003650676	7570681	7570764
ENSE00003743884	7571373	7571969

Expression profiles

Bgee: expression breadth ubiquitous, 185 present calls, max score 96.94.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 9.2064 / max 132.9588, expressed in 1773 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
159260	8.8026	1763
159259	0.4038	192

Top tissues by expression

265 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
right hemisphere of cerebellum	UBERON:0014890	96.94	gold quality
right frontal lobe	UBERON:0002810	96.87	gold quality
cerebellar hemisphere	UBERON:0002245	96.60	gold quality
cerebellar cortex	UBERON:0002129	96.48	gold quality
mucosa of transverse colon	UBERON:0004991	96.47	gold quality
anterior cingulate cortex	UBERON:0009835	96.46	gold quality
ganglionic eminence	UBERON:0004023	96.34	gold quality
cingulate cortex	UBERON:0003027	96.27	gold quality
cortical plate	UBERON:0005343	95.98	gold quality
adenohypophysis	UBERON:0002196	95.40	gold quality
lower esophagus muscularis layer	UBERON:0035833	95.39	gold quality
metanephros cortex	UBERON:0010533	95.37	gold quality
lower esophagus	UBERON:0013473	95.37	gold quality
ventricular zone	UBERON:0003053	95.36	gold quality
muscle layer of sigmoid colon	UBERON:0035805	95.33	gold quality
right lung	UBERON:0002167	95.28	gold quality
right testis	UBERON:0004534	95.19	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	95.18	gold quality
left testis	UBERON:0004533	95.16	gold quality
body of pancreas	UBERON:0001150	94.97	gold quality
upper lobe of left lung	UBERON:0008952	94.62	gold quality
right lobe of thyroid gland	UBERON:0001119	94.60	gold quality
left lobe of thyroid gland	UBERON:0001120	94.40	gold quality
body of uterus	UBERON:0009853	94.37	gold quality
granulocyte	CL:0000094	94.30	gold quality
body of stomach	UBERON:0001161	94.30	gold quality
right adrenal gland cortex	UBERON:0035827	94.30	gold quality
transverse colon	UBERON:0001157	94.25	gold quality
tibial nerve	UBERON:0001323	94.23	gold quality
mucosa of stomach	UBERON:0001199	94.15	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	1.19

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

47 targeting SENP3, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-4768-5P	100.00	69.49	2861
HSA-MIR-6833-3P	100.00	70.63	3197
HSA-MIR-4481	100.00	66.42	1669
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-4692	100.00	67.32	2066
HSA-MIR-6758-5P	100.00	66.21	1470
HSA-MIR-6856-5P	100.00	65.47	1298
HSA-MIR-4514	99.99	67.10	1870
HSA-MIR-4745-5P	99.98	65.95	1028
HSA-MIR-3065-5P	99.97	71.56	3281
HSA-MIR-548AA	99.96	70.64	3753
HSA-MIR-548AP-3P	99.96	70.64	3753
HSA-MIR-548T-3P	99.96	70.64	3753
HSA-MIR-551B-5P	99.96	71.28	3493
HSA-MIR-548D-3P	99.87	70.67	4362
HSA-MIR-548BB-3P	99.86	70.58	4354
HSA-MIR-548AC	99.84	70.77	4351
HSA-MIR-548H-3P	99.84	70.80	4349
HSA-MIR-548Z	99.84	70.80	4349
HSA-MIR-4517	99.76	69.19	1867
HSA-MIR-494-3P	99.70	71.45	2795
HSA-MIR-4729	99.69	72.18	4233
HSA-MIR-561-3P	99.64	70.90	3647
HSA-MIR-510-3P	99.54	70.06	2965
HSA-MIR-7159-5P	99.53	72.12	2472
HSA-MIR-3128	99.50	67.85	1258
HSA-MIR-1207-5P	99.49	69.11	2983
HSA-MIR-6083	99.47	68.73	2393

Literature-anchored findings (GeneRIF, showing 40)

• These results define SENP3 as an essential factor for ribosome biogenesis and suggest that deconjugation of SUMO2 from NPM1 by SENP3 is critically involved in 28S rRNA maturation. (PMID:18259216)
• SMT3IP1 desumoylates nucleophosmin and might controls its physiological functions at both the nucleolus and other subcellular compartments. (PMID:18639523)
• Data describe a mitotic SUMO2/3 conjugation-deconjugation cycle of Borealin and further assign a regulatory function of RanBP2 and SENP3 in the mitotic SUMO pathway. (PMID:18946085)
• Nucleolar protein B23/nucleophosmin regulates the vertebrate SUMO pathway through SENP3 and SENP5 proteases. (PMID:19015314)
• SENP3 is a redox sensor that regulates HIF-1 transcriptional activity under oxidative stress through the de-SUMOylation of p300 (PMID:19680224)
• SENP3-mediated de-conjugation of SUMO2/3 from promyelocytic leukemia is correlated with accelerated cell proliferation under mild oxidative stress. (PMID:20181954)
• Results demonstrate that SENP1 is the most efficient SUMO protease acting on Elk-1, and that SENP3 has little effect on Elk-1. SENP2 has an intermediate effect, but its ability to activate Elk-1 is independent from its SUMO-deconjugating activity. (PMID:20337593)
• Hsp90/SENP3 association protects SENP3 from CHIP-mediated ubiquitination and subsequent degradation, but this effect of Hsp90 requires the presence of CHIP. (PMID:20924358)
• These results suggest that SMT3IP1 is a new regulator of the p53-Mdm2 pathway. (PMID:21316347)
• The shift of HIF-1 transactivation by reactive oxidative species is correlated with and dependent on the biphasic redox sensing of SENP3 that leads to the differential SENP3/p300 interaction and the consequent fluctuation in the p300 SUMOylation status. (PMID:22684029)
• Recruitment of the protein complex 5FMC to Zbp-89, a zinc-finger transcription factor, affects its sumoylation status and transactivation potential.[5FMC] (PMID:22872859)
• ROS induced SENP3 redistribution from the nucleoli to the nucleoplasm. (PMID:23467634)
• In a novel adaptive pathway to extreme cell stress, dynamic changes in SENP3 stability and regulation of Drp1 SUMOylation are crucial determinants of cell fate. (PMID:23524851)
• SENP3 is associated with MLL1/MLL2 complexes and catalyzes deSUMOylation of RbBP5. (PMID:24930734)
• SENP3, which is increased in gastric cancer cells, potentiates the transcriptional activity of FOXC2 through de-SUMOylation, in favor of the induction of specific mesenchymal gene expression in gastric cancer metastasis. (PMID:25216525)
• Evidence show that mTOR-mediated phosphorylation of SENP3 facilitates the interaction with NPM1, thereby promoting nucleolar targeting. (PMID:25288641)
• High SENP3 expression is associated with stomach neoplasms. (PMID:26511642)
• In early-onset pre-eclampsia, enhanced deSUMOylation of HIF1A by SENP3 may in part contribute to increased HIF1A activity and stability found in this pathology. (PMID:27016777)
• Our data identified SUMOylation as a previously undescribed post-translational modification of STAT3 and SENP3 as a critical positive modulator of tobacco- or cytokine-induced STAT3 activation. (PMID:27181202)
• The data demonstrate that SUMO2 conjugation and SENP3-driven deSUMOylation of PELP1 is instrumental for ordered progression of ribosome maturation, and they provide molecular insight into the dynamics of ribosome maturation. (PMID:27814492)
• Important role of SENP3 in lipid metabolism during the development of non-alcoholic fatty liver disease. (PMID:27853276)
• Data show that increasing dynamin-related protein 1 (Drp1) SUMOylation by knocking down SUMO1-sentrin-SMT3 specific protease 3 (SENP3) reduces both Drp1 binding to mitochondrial fission factor protein (Mff) and stress-induced cytochrome c release. (PMID:28262828)
• our findings for the first time specifically supported that SUMO-specific protease 3 might play an important role in the regulation of epithelial ovarian cancer progression and could serve as a potential biomarker for prognosis as well as provide a promising therapeutic target against epithelial ovarian cancer (PMID:28351334)
• SENP3 knockdown reduced cadmium-induced caspase 3 cleavage and cell death in PC12 cells, while SENP3 overexpression enhanced cell death. (PMID:28747609)
• SENP3 phosphorylation decreased its interaction with Topo II alpha, resulting in reduced SENP3 deSUMOylation activity on Topo II alpha. Furthermore, we observed mitotic arrest, increased chromosome instability, and promotion of tumorigenesis in cells expressing a nonphosphorylatable SENP3 mutant (PMID:29438989)
• we provide the first direct evidence that SENP3 upregulation pivotally contributes to myocardial ischemia reperfusion (MIR) injury in a Drp1-dependent manner, and suggest that SENP3 suppression may hold therapeutic promise for constraining MIR injury. (PMID:29576508)
• SENP3 expression level decreased in HBV-infected hepatocytes in various models including HepG2-NTCP cell lines and a humanized mouse model. Downregulation of SENP3 reduced HBV replication and boosted host protein translation. (PMID:30640896)
• we performed ischemia and ischemia-reperfusion experiments in the cardiomyocyte H9C2 cell line. Similar to whole hearts, ischemia induced a decrease in cytosolic SENP3. Furthermore, shRNA-mediated knockdown of SENP3 led to an increase in the rate of cell death upon reperfusion. (PMID:30973885)
• SUMO1-catalyzed SUMOylation and SENP3-mediated deSUMOylation of NLRP3 orchestrate the inflammasome activation. (PMID:31914638)
• SENP3 Suppresses Osteoclastogenesis by De-conjugating SUMO2/3 from IRF8 in Bone Marrow-Derived Monocytes. (PMID:32049023)
• High SENP3 Expression Promotes Cell Migration, Invasion, and Proliferation by Modulating DNA Methylation of E-Cadherin in Osteosarcoma. (PMID:33030103)
• Combined identification of ARID1A, CSMD1, and SENP3 as effective prognostic biomarkers for hepatocellular carcinoma. (PMID:33558447)
• SUMO proteases SENP3 and SENP5 spatiotemporally regulate the kinase activity of Aurora A. (PMID:34313310)
• Iron chelation promotes mitophagy through SENP3-mediated deSUMOylation of FIS1. (PMID:35275026)
• SUMO-specific protease SENP3 enhances MDM2-mediated ubiquitination of PARIS/ZNF746 in HeLa cells. (PMID:35623300)
• Crosstalk between SUMOylation and ubiquitylation controls DNA end resection by maintaining MRE11 homeostasis on chromatin. (PMID:36050397)
• SENP3 affects the expression of PYCR1 to promote bladder cancer proliferation and EMT transformation by deSUMOylation of STAT3. (PMID:36227136)
• Loss of SENP3 mediated the formation of nasal polyps in nasal mucosal inflammation by increasing alternative activated macrophage. (PMID:36840491)
• SUMO specific peptidase 3 halts pancreatic ductal adenocarcinoma metastasis via deSUMOylating DKC1. (PMID:37188742)
• SENP3 Promotes Mantle Cell Lymphoma Development through Regulating Wnt10a Expression. (PMID:38273178)

Cross-species orthologs

8 orthologs

Organism	Symbol	Gene ID
danio_rerio	senp3b	ENSDARG00000056741
danio_rerio	senp5	ENSDARG00000060646
danio_rerio	senp3a	ENSDARG00000095538
mus_musculus	Senp3	ENSMUSG00000005204
rattus_norvegicus	Senp3	ENSRNOG00000013746
drosophila_melanogaster	Ulp1	FBGN0027603
drosophila_melanogaster	CG32110	FBGN0052110
caenorhabditis_elegans		WBGENE00006736

Paralogs (3): SENP1 (ENSG00000079387), SENP5 (ENSG00000119231), SENP2 (ENSG00000163904)

Protein

Protein identifiers

Sentrin-specific protease 3 — Q9H4L4 (reviewed: Q9H4L4)

Alternative names: SUMO-1-specific protease 3, Sentrin/SUMO-specific protease SENP3

All UniProt accessions (6): A0A087WV50, A0A087WZ63, Q9H4L4, J3KSF5, J3QL36, J3QRE4

UniProt curated annotations — full annotation on UniProt →

Function. Protease that releases SUMO2 and SUMO3 monomers from sumoylated substrates, but has only weak activity against SUMO1 conjugates. Deconjugates SUMO2 from MEF2D, which increases its transcriptional activation capability. Deconjugates SUMO2 and SUMO3 from CDCA8. Redox sensor that, when redistributed into nucleoplasm, can act as an effector to enhance HIF1A transcriptional activity by desumoylating EP300. Required for rRNA processing through deconjugation of SUMO2 and SUMO3 from nucleophosmin, NPM1. Plays a role in the regulation of sumoylation status of ZNF148. Functions as a component of the Five Friends of Methylated CHTOP (5FMC) complex; the 5FMC complex is recruited to ZNF148 by methylated CHTOP, leading to desumoylation of ZNF148 and subsequent transactivation of ZNF148 target genes. Deconjugates SUMO2 from KAT5. Catalyzes desumoylation of MRE11.

Subunit / interactions. Component of some MLL1/MLL complex, at least composed of the core components KMT2A/MLL1, ASH2L, HCFC1/HCF1, WDR5 and RBBP5, as well as the facultative components BACC1, CHD8, E2F6, HSP70, INO80C, KANSL1, LAS1L, MAX, MCRS1, MGA, MYST1/MOF, PELP1, PHF20, PRP31, RING2, RUVB1/TIP49A, RUVB2/TIP49B, SENP3, TAF1, TAF4, TAF6, TAF7, TAF9 and TEX10. Interacts with EP300, NPM1 and CDCA8. Component of the 5FMC complex, at least composed of PELP1, LAS1L, TEX10, WDR18 and SENP3; the complex interacts with methylated CHTOP and ZNF148. Interacts with NOL9. Interacts with CCAR2.

Subcellular location. Nucleus. Nucleolus. Nucleoplasm. Cytoplasm.

Activity regulation. On oxidative stress, SENP3 degradation is blocked by inhibition of its ubiquitination, which stabilizes it as it accumulates in the nucleoplasm.

Similarity. Belongs to the peptidase C48 family.

RefSeq proteins (1): NP_056485* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR003653	Peptidase_C48_C	Domain
IPR038765	Papain-like_cys_pep_sf	Homologous_superfamily
IPR045577	SENP3_5_cons_dom	Domain

Pfam: PF02902, PF19722

Enzyme classification (BRENDA):

• EC 3.4.22.B72 — (BRENDA: organisms, substrates, inhibitors, Km, kcat entries)

UniProt features (29 total): modified residue 9, sequence conflict 7, region of interest 3, active site 3, short sequence motif 2, compositionally biased region 2, chain 1, sequence variant 1, mutagenesis site 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
9ME8	X-RAY DIFFRACTION	2.93

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9H4L4-F1	65.89	0.43

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (3): 532 (nucleophile); 465; 482

Post-translational modifications (9): 54, 73, 75, 169, 176, 181, 188, 212, 232

Mutagenesis-validated functional residues (1):

Position	Phenotype
532	loss of enzymatic activity.

Function

Pathways and Gene Ontology

Reactome pathways

4 pathways

ID	Pathway
R-HSA-6791226	Major pathway of rRNA processing in the nucleolus and cytosol
R-HSA-72312	rRNA processing
R-HSA-8868773	rRNA processing in the nucleus and cytosol
R-HSA-8953854	Metabolism of RNA

MSigDB gene sets: 160 (showing top): GOBP_REGULATION_OF_DOUBLE_STRAND_BREAK_REPAIR, GOBP_RIBOSOME_BIOGENESIS, GOBP_REGULATION_OF_DNA_RECOMBINATION, TGCGCANK_UNKNOWN, GOBP_NEGATIVE_REGULATION_OF_DNA_REPAIR, MORF_UBE2I, GOBP_NEGATIVE_REGULATION_OF_DNA_RECOMBINATION, GOBP_REGULATION_OF_DOUBLE_STRAND_BREAK_REPAIR_VIA_HOMOLOGOUS_RECOMBINATION, GOBP_PROTEIN_MODIFICATION_BY_SMALL_PROTEIN_REMOVAL, GOBP_REGULATION_OF_DNA_REPAIR, MONNIER_POSTRADIATION_TUMOR_ESCAPE_UP, GOBP_PEPTIDYL_LYSINE_MODIFICATION, GOBP_MATURATION_OF_5_8S_RRNA_FROM_TRICISTRONIC_RRNA_TRANSCRIPT_SSU_RRNA_5_8S_RRNA_LSU_RRNA, BLALOCK_ALZHEIMERS_DISEASE_UP, GOMF_CYSTEINE_TYPE_PEPTIDASE_ACTIVITY

GO Biological Process (3): proteolysis (GO:0006508), protein desumoylation (GO:0016926), negative regulation of double-strand break repair via homologous recombination (GO:2000042)

GO Molecular Function (6): cysteine-type deubiquitinase activity (GO:0004843), cysteine-type peptidase activity (GO:0008234), deSUMOylase activity (GO:0016929), protein binding (GO:0005515), peptidase activity (GO:0008233), hydrolase activity (GO:0016787)

GO Cellular Component (6): nucleus (GO:0005634), nucleoplasm (GO:0005654), nucleolus (GO:0005730), cytoplasm (GO:0005737), nuclear body (GO:0016604), MLL1 complex (GO:0071339)

Reactome top-level categories

Rollup of top-3 pathways:

Category	Pathways
rRNA processing in the nucleus and cytosol	1
Metabolism of RNA	1
rRNA processing	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cysteine-type peptidase activity	2
nuclear lumen	2
cellular anatomical structure	2
intracellular membraneless organelle	2
protein metabolic process	1
peptidyl-lysine modification	1
protein modification by small protein removal	1
double-strand break repair via homologous recombination	1
regulation of double-strand break repair via homologous recombination	1
negative regulation of DNA recombination	1
negative regulation of double-strand break repair	1
deubiquitinase activity	1
peptidase activity	1
ubiquitin-like protein peptidase activity	1
binding	1
hydrolase activity	1
catalytic activity, acting on a protein	1
catalytic activity	1
intracellular membrane-bounded organelle	1
intracellular anatomical structure	1
nucleoplasm	1
MLL1/2 complex	1

Protein interactions and networks

STRING

2276 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
SENP3	SUMO1	P55856	981
SENP3	SUMO2	P55855	944
SENP3	TEX10	Q9NXF1	909
SENP3	SENP8	Q96LD8	889
SENP3	NPM1	P06748	858
SENP3	RANGAP1	P46060	843
SENP3	LAS1L	Q9Y4W2	842
SENP3	PELP1	Q8IZL8	829
SENP3	GNL2	Q13823	799
SENP3	NEDD8	Q15843	796
SENP3	RPL37A	P12751	779
SENP3	UBE2I	P50550	768
SENP3	UBA2	Q9UBT2	744
SENP3	SAE1	Q9UBE0	697
SENP3	IPO5	O00410	694

IntAct

120 interactions, top by confidence:

A	B	Type	Score
PELP1	WDR18	psi-mi:“MI:0914”(association)	0.900
PELP1	WDR18	psi-mi:“MI:0915”(physical association)	0.900
PELP1	SENP3	psi-mi:“MI:0915”(physical association)	0.800
SENP3	PELP1	psi-mi:“MI:0915”(physical association)	0.800
PELP1	SENP3	psi-mi:“MI:0403”(colocalization)	0.800
SENP3	WDR18	psi-mi:“MI:0915”(physical association)	0.780
NPM1	SENP3	psi-mi:“MI:0915”(physical association)	0.780
SENP3	NPM1	psi-mi:“MI:0403”(colocalization)	0.780
WDR18	SENP3	psi-mi:“MI:0915”(physical association)	0.780
SENP3	NPM1	psi-mi:“MI:0914”(association)	0.780
PHF19	EED	psi-mi:“MI:0914”(association)	0.730
CFTR	ESYT2	psi-mi:“MI:2364”(proximity)	0.710
BOP1	NPM1	psi-mi:“MI:0403”(colocalization)	0.710
P4HA3	FAM171A2	psi-mi:“MI:0914”(association)	0.640
H2BC1	PPM1G	psi-mi:“MI:0914”(association)	0.640
NOL9	SENP3	psi-mi:“MI:0914”(association)	0.640
TEX10	SENP3	psi-mi:“MI:0915”(physical association)	0.620
NPM1	MPHOSPH10	psi-mi:“MI:0914”(association)	0.610
CEP19	SENP3	psi-mi:“MI:0915”(physical association)	0.560
WFS1	SENP3	psi-mi:“MI:0915”(physical association)	0.560
SENP3	SPRED1	psi-mi:“MI:0915”(physical association)	0.560

BioGRID (402): EP300 (Affinity Capture-Western), SENP3 (Affinity Capture-Western), SENP3 (Affinity Capture-Western), SENP3 (Affinity Capture-Western), SENP3 (Affinity Capture-RNA), SENP3 (Affinity Capture-MS), SENP3 (Two-hybrid), SENP3 (Affinity Capture-Western), CDCA8 (Biochemical Activity), SENP3 (Reconstituted Complex), SENP3 (Affinity Capture-MS), SENP3 (Affinity Capture-MS), SENP3 (Affinity Capture-MS), SENP3 (Affinity Capture-MS), SENP3 (Co-fractionation)

ESM2 similar proteins: A0A5N6H279, A4D2B8, D3ZML2, O76081, O91531, P03327, P0C678, P0C733, P79348, Q00731, Q09PK2, Q13670, Q1HVB5, Q1ZZU3, Q4KL35, Q4R1S1, Q52993, Q5JLA7, Q5JN07, Q5MFW3, Q63553, Q64902, Q6DN03, Q6NUI1, Q6P050, Q6SW81, Q86UQ5, Q8AZJ3, Q8BG31, Q8BVZ5, Q8CE90, Q8CEZ0, Q8K3M5, Q8LN49, Q8N5Z5, Q8TE04, Q8VDU5, Q8WTX9, Q8WXT5, Q9BTV7

Diamond homologs: A7MBJ2, D3ZF42, O42957, O65278, P59110, Q02724, Q09353, Q5R7K7, Q5RBB1, Q6NXL6, Q6P7W0, Q8BUH8, Q8GYL3, Q8WP32, Q91ZX6, Q94F30, Q96HI0, Q9BQF6, Q9EP97, Q9EQE1, Q9GZR1, Q9H4L4, Q9HC62, Q9P0U3, Q0WKV8, Q8RWN0, O13769, Q09275, Q8L7S0, Q2PS26, Q23238

SIGNOR signaling

1 interactions.

A	Effect	B	Mechanism
SENP3	“form complex”	“Rix1 complex”	binding

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 121 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Metalloprotease DUBs	5	17.7×	8e-04
RUNX1 interacts with co-factors whose precise effect on RUNX1 targets is not known	5	17.7×	8e-04
SPOP-mediated proteasomal degradation of PD-L1(CD274)	6	16.1×	3e-04
Maturation of DENV proteins	6	14.9×	4e-04
rRNA processing in the nucleus and cytosol	6	11.3×	1e-03
Regulation of PTEN stability and activity	5	10.8×	4e-03
Oxidative Stress Induced Senescence	10	10.7×	2e-05
rRNA processing	6	10.3×	1e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

54 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	53
Likely benign	1
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

2217 predictions. Top by Δscore:

Variant	Effect	Δscore
17:7564860:ACAG:A	donor_gain	1.0000
17:7564863:GA:G	donor_gain	1.0000
17:7564865:G:GG	donor_gain	1.0000
17:7564954:A:AG	acceptor_gain	1.0000
17:7564954:ACCAG:A	acceptor_gain	1.0000
17:7564955:C:G	acceptor_gain	1.0000
17:7564956:CA:C	acceptor_loss	1.0000
17:7564957:A:AG	acceptor_gain	1.0000
17:7564957:A:G	acceptor_loss	1.0000
17:7564957:AG:A	acceptor_gain	1.0000
17:7564958:G:GA	acceptor_gain	1.0000
17:7564958:GG:G	acceptor_gain	1.0000
17:7564958:GGC:G	acceptor_gain	1.0000
17:7564958:GGCA:G	acceptor_gain	1.0000
17:7564958:GGCAT:G	acceptor_gain	1.0000
17:7565019:T:TA	donor_gain	1.0000
17:7565020:A:AA	donor_gain	1.0000
17:7565068:CAGG:C	donor_loss	1.0000
17:7565069:AGGTG:A	donor_loss	1.0000
17:7565070:GGTGA:G	donor_loss	1.0000
17:7565071:G:T	donor_loss	1.0000
17:7565071:GTG:G	donor_loss	1.0000
17:7565072:T:A	donor_loss	1.0000
17:7565428:T:TA	acceptor_gain	1.0000
17:7565585:CAGG:C	donor_loss	1.0000
17:7565586:AGG:A	donor_loss	1.0000
17:7565588:G:GC	donor_loss	1.0000
17:7565588:GTGAG:G	donor_loss	1.0000
17:7565589:T:G	donor_loss	1.0000
17:7570466:GC:G	donor_gain	1.0000

AlphaMissense

3734 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
17:7564988:G:C	G329R	1.000
17:7564989:G:A	G329D	1.000
17:7564989:G:T	G329V	1.000
17:7565031:T:C	L343P	1.000
17:7565042:T:A	F347I	1.000
17:7565042:T:C	F347L	1.000
17:7565044:C:A	F347L	1.000
17:7565044:C:G	F347L	1.000
17:7565055:T:C	F351S	1.000
17:7565508:T:C	F379S	1.000
17:7565528:C:G	H386D	1.000
17:7565535:T:A	L388Q	1.000
17:7565535:T:C	L388P	1.000
17:7565535:T:G	L388R	1.000
17:7565546:G:C	D392H	1.000
17:7565546:G:T	D392Y	1.000
17:7565547:A:G	D392G	1.000
17:7565547:A:T	D392V	1.000
17:7565550:T:C	L393S	1.000
17:7565559:T:C	L396S	1.000
17:7565559:T:G	L396W	1.000
17:7565573:T:A	W401R	1.000
17:7565573:T:C	W401R	1.000
17:7565574:G:C	W401S	1.000
17:7565574:G:T	W401L	1.000
17:7565575:G:C	W401C	1.000
17:7565575:G:T	W401C	1.000
17:7565577:T:A	L402H	1.000
17:7565577:T:C	L402P	1.000
17:7565580:A:T	N403I	1.000

dbSNP variants (sampled 300 via entrez): RS1000276181 (17:7568422 CCT>C), RS1000775375 (17:7561826 G>A), RS1000840931 (17:7562723 G>A,T), RS1000879861 (17:7567083 C>T), RS1000922056 (17:7568074 C>G), RS1001145102 (17:7560714 C>A,T), RS1001312228 (17:7561698 T>C), RS1001560026 (17:7564141 T>G), RS1001791393 (17:7569548 C>T), RS1001855119 (17:7565206 G>A,T), RS1001906859 (17:7562482 C>T), RS1002029068 (17:7570801 G>A), RS1002286481 (17:7562001 CGGCGGCGGTGGCGCTGGT>C,CGGCGGCGGTGGCGCTGGTGGCGGCGGTGGCGCTGGT), RS1002562833 (17:7565824 T>A), RS1002627047 (17:7572410 G>A,C,T)

Disease associations

OMIM: gene MIM:612844 | disease phenotypes:

GenCC curated gene-disease

Mondo (1): myoepithelial tumor (MONDO:0002380)

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

4 associations (top):

Study	Trait	p-value
GCST001724_1	IgM levels	4.000000e-07
GCST010002_119	Refractive error	3.000000e-22
GCST010703_158	Brain morphology (MOSTest)	3.000000e-09
GCST012020_476	Serum metabolite levels	5.000000e-11

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0004346	neuroimaging measurement

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D009208	Myoepithelioma	C04.557.435.585

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL5291568 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

PharmGKB clinical annotations

1 annotations.

Variant	Type	Level	Drugs	Phenotypes
rs11552708	Efficacy	3	methylphenidate	Attention Deficit Disorder with Hyperactivity

ChEMBL bioactivities

7 potent at pChembl≥5 of 7 total, top 7 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
5.70	IC50	2000	nM	CHEMBL5287963
5.57	IC50	2700	nM	CHEMBL5175111
5.47	IC50	3400	nM	CHEMBL5269877
5.46	IC50	3500	nM	CHEMBL5276705
5.34	IC50	4600	nM	CHEMBL5278967
5.33	IC50	4700	nM	CHEMBL5290662
5.32	IC50	4800	nM	CHEMBL5266367

PubChem BioAssay actives

7 with measured affinity, of 7 total; 7 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
24186038	1926194: Inhibition of SENP3 (unknown origin)	ic50	2.0000	uM
3-amino-4-[[4-[4-[(2-amino-6-sulfonaphthalen-1-yl)diazenyl]-3-methylphenyl]-2-methylphenyl]diazenyl]naphthalene-2,7-disulfonic acid	1926194: Inhibition of SENP3 (unknown origin)	ic50	2.7000	uM
171343867	1926194: Inhibition of SENP3 (unknown origin)	ic50	3.4000	uM
5-[(2-aminonaphthalen-1-yl)diazenyl]-2-[(E)-2-[4-[(2-aminonaphthalen-1-yl)diazenyl]-2-sulfophenyl]ethenyl]benzenesulfonic acid	1926194: Inhibition of SENP3 (unknown origin)	ic50	3.5000	uM
5-[(4-aminonaphthalen-1-yl)diazenyl]-2-[(E)-2-[4-[(4-aminonaphthalen-1-yl)diazenyl]-2-sulfophenyl]ethenyl]benzenesulfonic acid	1926194: Inhibition of SENP3 (unknown origin)	ic50	4.6000	uM
4-amino-3-[(2-methylphenyl)diazenyl]naphthalene-1-sulfonic acid	1926194: Inhibition of SENP3 (unknown origin)	ic50	4.7000	uM
171351460	1926194: Inhibition of SENP3 (unknown origin)	ic50	4.8000	uM

CTD chemical–gene interactions

32 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
cobaltous chloride	decreases expression	2
Valproic Acid	decreases expression	2
aristolochic acid I	increases expression	1
FR900359	increases phosphorylation	1
bisphenol A	decreases expression	1
perfluorooctanoic acid	decreases expression	1
perfluorooctane sulfonic acid	decreases expression	1
CGP 52608	affects binding, increases reaction	1
perfluoro-n-nonanoic acid	decreases expression	1
perfluorohexanesulfonic acid	decreases expression	1
palbociclib	increases phosphorylation, affects binding, decreases reaction	1
licochalcone B	increases expression	1
bisphenol S	decreases methylation	1
(+)-JQ1 compound	decreases expression	1
2,3,5-trichloro-6-phenyl-(1,4)benzoquinone	decreases expression	1
Bortezomib	decreases expression	1
Resveratrol	affects cotreatment, increases expression	1
Air Pollutants	increases abundance, affects expression	1
Azacitidine	increases expression	1
Caffeine	decreases phosphorylation	1
Doxorubicin	decreases expression	1
Enzyme Inhibitors	decreases activity, increases O-linked glycosylation	1
Ozone	affects expression, increases abundance	1
Plant Extracts	affects cotreatment, increases expression	1
Quercetin	decreases phosphorylation	1
Smoke	decreases expression	1
Dronabinol	decreases expression	1
Thiram	increases expression	1
Tobacco Smoke Pollution	increases expression	1
Asbestos, Crocidolite	affects methylation	1

ChEMBL screening assays

1 unique, capped per target: 1 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL5229278	Binding	Inhibition of SENP3 (unknown origin)	Recent research and development of inhibitors targeting sentrin-specific protease 1 for the treatment of cancers. — Eur J Med Chem

Cellosaurus cell lines

2 cell lines: 2 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_TK59	HAP1 SENP3 (-) 1	Cancer cell line	Male
CVCL_TK60	HAP1 SENP3 (-) 2	Cancer cell line	Male

Clinical trials (associated diseases)

5 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT03600649	PHASE1	UNKNOWN	Clinical Trial of SP-2577 (Seclidemstat) in Patients With Relapsed or Refractory Ewing or Ewing-related Sarcomas
NCT05266196	PHASE1/PHASE2	UNKNOWN	A Rollover Protocol to Allow for Continued Access to the LSD1 Inhibitor Seclidemstat (SP-2577)
NCT06239272	PHASE1/PHASE2	RECRUITING	NRSTS2021, A Risk Adapted Study Evaluating Maintenance Pazopanib, Limited Margin, Dose-Escalated Radiation Therapy and Selinexor in Non-Rhabdomyosarcoma Soft Tissue Sarcoma (NRSTS)
NCT06625190	PHASE1/PHASE2	RECRUITING	Alpha/Beta T and B Cell Depletion With Zoledronic Acid for Solid Tumors
NCT06244420	Not specified	COMPLETED	Malignant Myoepithelioma of Bone and Soft Tissues: Diagnostic Imaging and Histology in Relation to Prognosis