SGO2

Summary

SGO2 (shugoshin 2, HGNC:30812) is a protein-coding gene on chromosome 2q33.1, encoding Shugoshin 2 (Q562F6). Cooperates with PPP2CA to protect centromeric cohesin from separase-mediated cleavage in oocytes specifically during meiosis I.

Predicted to be involved in meiotic sister chromatid cohesion. Predicted to act upstream of or within several processes, including meiotic nuclear division; meiotic sister chromatid cohesion; and positive regulation of maintenance of meiotic sister chromatid cohesion, centromeric. Located in chromosome, centromeric region and nuclear body. Part of mitotic cohesin complex.

Source: NCBI Gene 151246 — RefSeq curated summary.

At a glance

• Gene–disease (curated): Perrault syndrome (Limited, GenCC)
• GWAS associations: 1
• Clinical variants (ClinVar): 31 total — 1 pathogenic
• MANE Select transcript: NM_152524

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:30812
Approved symbol	SGO2
Name	shugoshin 2
Location	2q33.1
Locus type	gene with protein product
Status	Approved
Aliases	TRIPIN, FLJ25211
Ensembl gene	ENSG00000163535
Ensembl biotype	protein_coding
OMIM	612425
Entrez	151246

Gene structure

Transcript identifiers

Ensembl transcripts: 9 — 6 protein_coding, 2 protein_coding_CDS_not_defined, 1 retained_intron

ENST00000357799, ENST00000409203, ENST00000418045, ENST00000460534, ENST00000469840, ENST00000488636, ENST00000921538, ENST00000921539, ENST00000921540

RefSeq mRNA: 3 — MANE Select: NM_152524 NM_001160033, NM_001160046, NM_152524

CCDS: CCDS42796

Canonical transcript exons

ENST00000357799 — 9 exons

Exon	Start	End
ENSE00001075748	200575311	200575461
ENSE00001180723	200583449	200584096
ENSE00001180745	200569663	200569892
ENSE00001180760	200534996	200535171
ENSE00001260001	200532974	200533108
ENSE00001420297	200571050	200573977
ENSE00001929875	200526207	200526252
ENSE00003545378	200542579	200542664
ENSE00003635126	200536065	200536142

Expression profiles

Bgee: expression breadth ubiquitous, 225 present calls, max score 97.94.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 10.7410 / max 175.6751, expressed in 1536 samples.

FANTOM5 promoters (3 alternative TSS)

Promoter ID	TPM avg	Samples expressed
24554	10.2570	1501
24553	0.4760	296
24552	0.0080	1

Top tissues by expression

248 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
oocyte	CL:0000023	97.94	gold quality
secondary oocyte	CL:0000655	97.69	gold quality
sperm	CL:0000019	91.88	gold quality
ventricular zone	UBERON:0003053	91.70	gold quality
thymus	UBERON:0002370	90.56	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	89.01	gold quality
parietal pleura	UBERON:0002400	88.63	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	88.16	gold quality
ganglionic eminence	UBERON:0004023	85.12	gold quality
testis	UBERON:0000473	84.76	gold quality
buccal mucosa cell	CL:0002336	84.49	gold quality
left testis	UBERON:0004533	84.21	gold quality
right testis	UBERON:0004534	84.06	gold quality
bone marrow	UBERON:0002371	80.16	gold quality
trabecular bone tissue	UBERON:0002483	79.51	gold quality
germinal epithelium of ovary	UBERON:0001304	79.19	gold quality
pancreatic ductal cell	CL:0002079	77.52	gold quality
stromal cell of endometrium	CL:0002255	76.59	gold quality
visceral pleura	UBERON:0002401	76.59	gold quality
tibia	UBERON:0000979	76.23	gold quality
amniotic fluid	UBERON:0000173	75.33	gold quality
adrenal tissue	UBERON:0018303	75.16	gold quality
bone marrow cell	CL:0002092	74.69	gold quality
lymph node	UBERON:0000029	74.33	gold quality
calcaneal tendon	UBERON:0003701	74.04	gold quality
ileal mucosa	UBERON:0000331	73.91	gold quality
vermiform appendix	UBERON:0001154	73.88	gold quality
oral cavity	UBERON:0000167	73.61	gold quality
caecum	UBERON:0001153	72.80	gold quality
endometrium	UBERON:0001295	72.60	gold quality

Single-cell (SCXA)

Detected in 7 experiment(s), a significant marker in 6.

Experiment	Marker?	Max mean expression
E-MTAB-7249	yes	272.20
E-MTAB-10018	yes	238.21
E-MTAB-8530	yes	156.32
E-GEOD-99795	yes	150.86
E-MTAB-6678	yes	9.15
E-ANND-3	yes	5.70
E-MTAB-6911	no	194.68

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

37 targeting SGO2, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-5193	100.00	67.26	1744
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-6077	99.99	68.04	2299
HSA-MIR-548AA	99.96	70.64	3753
HSA-MIR-548AP-3P	99.96	70.64	3753
HSA-MIR-548T-3P	99.96	70.64	3753
HSA-MIR-570-3P	99.96	72.41	4910
HSA-MIR-545-3P	99.95	70.74	2783
HSA-MIR-381-3P	99.93	71.87	2854
HSA-MIR-300	99.92	71.76	2856
HSA-MIR-548D-3P	99.87	70.67	4362
HSA-MIR-548BB-3P	99.86	70.58	4354
HSA-MIR-369-3P	99.85	70.52	2264
HSA-MIR-548AC	99.84	70.77	4351
HSA-MIR-548H-3P	99.84	70.80	4349
HSA-MIR-548Z	99.84	70.80	4349
HSA-MIR-5002-5P	99.76	70.84	1763
HSA-MIR-5580-3P	99.70	69.41	2052
HSA-MIR-561-3P	99.64	70.90	3647
HSA-MIR-1251-3P	99.64	67.21	1408
HSA-MIR-4753-5P	99.54	68.51	1356
HSA-MIR-12132	99.47	68.90	1341
HSA-MIR-4652-3P	99.33	70.02	2742
HSA-MIR-145-3P	99.33	67.66	764
HSA-MIR-7515	99.31	68.22	1795
HSA-MIR-888-5P	99.30	70.15	1855
HSA-MIR-5589-3P	99.29	68.30	1443
HSA-MIR-6731-5P	99.28	67.42	2375
HSA-MIR-8085	99.28	67.56	2362

Literature-anchored findings (GeneRIF, showing 10)

• identified the phosphorylation of hSgo2 by Aurora B at the N-terminal coiled-coil region and the middle region, and showed that these phosphorylations separately promote binding of hSgo2 to PP2A and MCAK (PMID:20889715)
• Sgol2’s ability to protect cohesin depends on its interaction with PP2A, as is its ability to silence the SAC, with the latter being mediated by direct binding to Mad2 (PMID:24192037)
• Results from a study on gene expression variability markers in early-stage human embryos shows that SGO2 is a putative expression variability marker for the 3-day, 8-cell embryo stage. (PMID:26288249)
• In mouse, Sgol2a encoding shugoshin-like 2a is necessary during meiosis in both sexes to maintain the integrity of the cohesin complex that tethers sister chromatids. Human SGO2 has not previously been implicated in any disorder, but in this case of POI and perhaps others, it is a candidate for unexplained infertility (PMID:27629923)
• Molecular chaperone SET-assisted eviction of linker histones and Shugoshins is a fundamental step in mammalian mitotic progression. (PMID:28781233)
• The SET localizes at the inner centromere by interacting directly with SGO2, with SET levels declining at increased distances between kinetochore pairs, leading to establishment of chromosome bi-orientation. (PMID:31527146)
• results identify an unexpected function of SGO2 in mitotically dividing cells and a mechanism of separase regulation that is independent of securin but still supervised by the spindle assembly checkpoint (PMID:32322060)
• High SGO2 Expression Predicts Poor Overall Survival: A Potential Therapeutic Target for Hepatocellular Carcinoma. (PMID:34200261)
• Shugosin 2 is a biomarker for pathological grading and survival prediction in patients with gliomas. (PMID:34535705)
• SGOL2 promotes prostate cancer progression by inhibiting RAB1A ubiquitination. (PMID:36566018)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	sgo2	ENSDARG00000092651
mus_musculus	Sgo2a	ENSMUSG00000026039
mus_musculus	Sgo2b	ENSMUSG00000094443
rattus_norvegicus	Sgo2	ENSRNOG00000027035

Paralogs (1): SGO1 (ENSG00000129810)

Protein

Protein identifiers

Shugoshin 2 — Q562F6 (reviewed: Q562F6)

Alternative names: Shugoshin-2, Shugoshin-like 2, Tripin

All UniProt accessions (2): C9JW92, Q562F6

UniProt curated annotations — full annotation on UniProt →

Function. Cooperates with PPP2CA to protect centromeric cohesin from separase-mediated cleavage in oocytes specifically during meiosis I. Has a crucial role in protecting REC8 at centromeres from cleavage by separase. During meiosis, protects centromeric cohesion complexes until metaphase II/anaphase II transition, preventing premature release of meiosis-specific REC8 cohesin complexes from anaphase I centromeres. Is thus essential for an accurate gametogenesis. May act by targeting PPP2CA to centromeres, thus leading to cohesin dephosphorylation. Essential for recruiting KIF2C to the inner centromere and for correcting defective kinetochore attachments. Involved in centromeric enrichment of AUKRB in prometaphase.

Subunit / interactions. Part of an astrin (SPAG5) -kinastrin (SKAP) complex containing KNSTRN, SPAG5, PLK1, DYNLL1 and SGO2. Interacts with CDCA8. Directly interacts with PPP2CA.

Subcellular location. Nucleus. Chromosome. Centromere. Kinetochore.

Miscellaneous. Shugoshin is Japanese for guardian spirit (as it is known to be a protector of centromeric cohesin).

Similarity. Belongs to the shugoshin family.

Isoforms (3)

UniProt ID	Names	Canonical?
Q562F6-1	1	yes
Q562F6-2	2
Q562F6-3	3

RefSeq proteins (3): NP_001153505, NP_001153518, NP_689737* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR038889	Shugoshin1/2	Family

UniProt features (37 total): compositionally biased region 9, region of interest 7, sequence conflict 7, sequence variant 6, coiled-coil region 3, splice variant 3, chain 1, modified residue 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q562F6-F1	42.94	0.06

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (1): 1144

Function

Pathways and Gene Ontology

Reactome pathways

18 pathways

ID	Pathway
R-HSA-141444	Amplification of signal from unattached kinetochores via a MAD2 inhibitory signal
R-HSA-2467813	Separation of Sister Chromatids
R-HSA-2500257	Resolution of Sister Chromatid Cohesion
R-HSA-5663220	RHO GTPases Activate Formins
R-HSA-68877	Mitotic Prometaphase
R-HSA-9648025	EML4 and NUDC in mitotic spindle formation
R-HSA-141424	Amplification of signal from the kinetochores
R-HSA-162582	Signal Transduction
R-HSA-1640170	Cell Cycle
R-HSA-194315	Signaling by Rho GTPases
R-HSA-195258	RHO GTPase Effectors
R-HSA-2555396	Mitotic Metaphase and Anaphase
R-HSA-68882	Mitotic Anaphase
R-HSA-68886	M Phase
R-HSA-69278	Cell Cycle, Mitotic
R-HSA-69618	Mitotic Spindle Checkpoint
R-HSA-69620	Cell Cycle Checkpoints
R-HSA-9716542	Signaling by Rho GTPases, Miro GTPases and RHOBTB3

MSigDB gene sets: 242 (showing top): GSE45365_NK_CELL_VS_CD8A_DC_MCMV_INFECTION_DN, GSE18804_BRAIN_VS_COLON_TUMORAL_MACROPHAGE_DN, GSE18804_SPLEEN_MACROPHAGE_VS_TUMORAL_MACROPHAGE_UP, GSE45365_NK_CELL_VS_CD8_TCELL_UP, GOBP_MEIOTIC_CHROMOSOME_SEGREGATION, GOBP_CHROMOSOME_ORGANIZATION, RODRIGUES_THYROID_CARCINOMA_ANAPLASTIC_UP, HORIUCHI_WTAP_TARGETS_DN, RODRIGUES_THYROID_CARCINOMA_POORLY_DIFFERENTIATED_UP, IVANOVA_HEMATOPOIESIS_MATURE_CELL, WEI_MYCN_TARGETS_WITH_E_BOX, GOBP_ORGANELLE_FISSION, FISCHER_G2_M_CELL_CYCLE, GOBP_SISTER_CHROMATID_COHESION, DODD_NASOPHARYNGEAL_CARCINOMA_UP

GO Biological Process (4): chromosome segregation (GO:0007059), meiotic sister chromatid cohesion (GO:0051177), cell division (GO:0051301), meiotic cell cycle (GO:0051321)

GO Molecular Function (1): protein binding (GO:0005515)

GO Cellular Component (8): chromosome, centromeric region (GO:0000775), kinetochore (GO:0000776), nucleoplasm (GO:0005654), cytosol (GO:0005829), nuclear body (GO:0016604), mitotic cohesin complex (GO:0030892), nucleus (GO:0005634), chromosome (GO:0005694)

Reactome top-level categories

Rollup of top-13 pathways:

Category	Pathways
Mitotic Prometaphase	2
M Phase	2
Cell Cycle	2
Amplification of signal from the kinetochores	1
Mitotic Anaphase	1
RHO GTPase Effectors	1
Mitotic Spindle Checkpoint	1
Signaling by Rho GTPases, Miro GTPases and RHOBTB3	1
Signaling by Rho GTPases	1
Mitotic Metaphase and Anaphase	1
Cell Cycle, Mitotic	1
Cell Cycle Checkpoints	1
Signal Transduction	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
intracellular membraneless organelle	3
cellular anatomical structure	2
cell cycle process	1
sister chromatid cohesion	1
cellular process	1
cell cycle	1
sexual reproduction	1
reproductive process	1
meiotic nuclear division	1
binding	1
chromosomal region	1
condensed chromosome, centromeric region	1
supramolecular complex	1
nuclear lumen	1
cytoplasm	1
nucleoplasm	1
cohesin complex	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

1140 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
SGO2	SGO1	Q5FBB7	966
SGO2	REC8	O95072	957
SGO2	CDCA8	Q53HL2	922
SGO2	KIF2C	Q99661	888
SGO2	RAD21	O60216	885
SGO2	BUB1	O43683	831
SGO2	STAG2	Q8N3U4	816
SGO2	ESPL1	Q14674	802
SGO2	PPP2R1A	P30153	800
SGO2	AURKB	Q96GD4	798
SGO2	PLK1	P53350	757
SGO2	CDCA5	Q96FF9	702
SGO2	STAG3	Q9UJ98	648
SGO2	SMC3	Q9UQE7	635
SGO2	CDC20	Q12834	626

IntAct

60 interactions, top by confidence:

A	B	Type	Score
MAD2L1BP	MAD2L1	psi-mi:“MI:0914”(association)	0.960
PPP2R2D	YEATS4	psi-mi:“MI:0914”(association)	0.730
SGO2	MAD2L1	psi-mi:“MI:0915”(physical association)	0.730
MAD2L1	SGO2	psi-mi:“MI:0915”(physical association)	0.730
SGO2	MAD2L1	psi-mi:“MI:0407”(direct interaction)	0.730
PPP2R5A	SGO2	psi-mi:“MI:0915”(physical association)	0.610
SGO2	PPP2CA	psi-mi:“MI:0915”(physical association)	0.560
SGO2	PPP2R5D	psi-mi:“MI:0915”(physical association)	0.550
IER2	KPNA3	psi-mi:“MI:0914”(association)	0.530
CASQ2	PES1	psi-mi:“MI:0914”(association)	0.530
WDR83	SH2B2	psi-mi:“MI:0914”(association)	0.530
PPP2R5A	AXIN1	psi-mi:“MI:0914”(association)	0.530
CDCA8	SGO2	psi-mi:“MI:0407”(direct interaction)	0.510
CDCA8	SGO2	psi-mi:“MI:0914”(association)	0.510
MAD2L1BP	SGO2	psi-mi:“MI:0915”(physical association)	0.500
SGO2	PPP1CA	psi-mi:“MI:0914”(association)	0.460
SGO2	H2BC21	psi-mi:“MI:0915”(physical association)	0.400
Sgo2a	RPL36A	psi-mi:“MI:0915”(physical association)	0.400
SGO2	SGO2	psi-mi:“MI:0915”(physical association)	0.400
SGO2	PPM1A	psi-mi:“MI:0915”(physical association)	0.400

BioGRID (121): SGOL2 (Affinity Capture-MS), GNB2 (Affinity Capture-MS), HEPHL1 (Affinity Capture-MS), HIST1H2BJ (Affinity Capture-MS), PPP2R1B (Affinity Capture-MS), PKP1 (Affinity Capture-MS), EIF1AX (Affinity Capture-MS), LYPLA2 (Affinity Capture-MS), SERPINB5 (Affinity Capture-MS), ARL8B (Affinity Capture-MS), PPP2CA (Affinity Capture-MS), PREP (Affinity Capture-MS), SELENBP1 (Affinity Capture-MS), LYG2 (Affinity Capture-MS), PADI3 (Affinity Capture-MS)

ESM2 similar proteins: A0A0P0XCU3, A1YFC1, A1YGK6, A2T7F2, A6NJ88, B7SY83, D3YU32, F1QU13, F4HXQ7, F6QRE9, P0C2Y1, P18748, P18752, P48786, Q0DVU4, Q0P6D6, Q13342, Q2EI21, Q32L62, Q3V0C1, Q3V3Q4, Q4V8E9, Q562F6, Q5H9K5, Q5VWK0, Q5XHX6, Q5XPK0, Q6AZ54, Q6K5K2, Q8C9M2, Q8K4E0, Q8N3K9, Q8N660, Q8NDZ0, Q8TCU4, Q8WWL7, Q921B4, Q923B3, Q96JA4, Q96M34

Diamond homologs: Q562F6, Q7TSY8

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 66 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Signaling by GSK3beta mutants	6	89.6×	2e-09
CTNNB1 S33 mutants aren’t phosphorylated	6	89.6×	2e-09
CTNNB1 S37 mutants aren’t phosphorylated	6	89.6×	2e-09
CTNNB1 S45 mutants aren’t phosphorylated	6	89.6×	2e-09
CTNNB1 T41 mutants aren’t phosphorylated	6	89.6×	2e-09
Beta-catenin phosphorylation cascade	6	79.0×	3e-09
Platelet sensitization by LDL	5	65.9×	3e-07
Signaling by WNT in cancer	5	58.9×	4e-07

GO biological processes:

GO term	Partners	Fold	FDR
mRNA splicing, via spliceosome	7	11.1×	1e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

31 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	0
Uncertain significance	10
Likely benign	4
Benign	3

Top pathogenic / likely-pathogenic (1)

Variant ID	HGVS	Classification
375672	NM_152524.6(SGO2):c.1453_1454del (p.Glu485fs)	Pathogenic

SpliceAI

1359 predictions. Top by Δscore:

Variant	Effect	Δscore
2:200526250:GAG:G	donor_gain	1.0000
2:200526253:GT:G	donor_loss	1.0000
2:200532967:A:AG	acceptor_gain	1.0000
2:200532968:C:G	acceptor_gain	1.0000
2:200532972:A:AG	acceptor_gain	1.0000
2:200532972:AGT:A	acceptor_gain	1.0000
2:200532973:G:GC	acceptor_gain	1.0000
2:200532973:GT:G	acceptor_gain	1.0000
2:200532973:GTG:G	acceptor_gain	1.0000
2:200532973:GTGAT:G	acceptor_gain	1.0000
2:200533019:GAAT:G	donor_gain	1.0000
2:200533061:C:CG	donor_gain	1.0000
2:200533061:C:G	donor_gain	1.0000
2:200533109:G:GG	donor_gain	1.0000
2:200534994:A:AG	acceptor_gain	1.0000
2:200534995:G:GG	acceptor_gain	1.0000
2:200534995:GATA:G	acceptor_gain	1.0000
2:200535115:G:GT	donor_gain	1.0000
2:200535160:C:G	donor_gain	1.0000
2:200535167:ACTTG:A	donor_gain	1.0000
2:200535170:TGG:T	donor_loss	1.0000
2:200535172:G:GG	donor_gain	1.0000
2:200535173:T:G	donor_loss	1.0000
2:200536057:A:AG	acceptor_gain	1.0000
2:200536057:AT:A	acceptor_gain	1.0000
2:200536058:T:G	acceptor_gain	1.0000
2:200536063:A:AG	acceptor_gain	1.0000
2:200536064:G:GA	acceptor_gain	1.0000
2:200536140:GAG:G	donor_gain	1.0000
2:200536141:AGG:A	donor_loss	1.0000

AlphaMissense

8549 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
2:200535052:G:C	A64P	0.998
2:200535046:G:C	A62P	0.997
2:200535161:T:C	L100P	0.997
2:200535044:T:C	L61S	0.996
2:200536075:T:C	L107P	0.996
2:200535040:G:C	A60P	0.995
2:200535128:T:C	L89P	0.995
2:200535056:T:C	L65P	0.994
2:200535149:T:C	L96P	0.994
2:200536116:G:C	A121P	0.994
2:200533091:T:C	I39T	0.992
2:200535152:G:C	R97P	0.992
2:200535155:T:C	L98P	0.991
2:200535033:C:A	N57K	0.990
2:200535033:C:G	N57K	0.990
2:200535036:C:A	N58K	0.990
2:200535036:C:G	N58K	0.990
2:200535047:C:A	A62D	0.990
2:200535080:G:C	R73P	0.990
2:200535039:G:C	R59S	0.989
2:200535039:G:T	R59S	0.989
2:200535023:T:C	L54S	0.988
2:200535027:G:C	K55N	0.987
2:200535027:G:T	K55N	0.987
2:200533095:A:C	K40N	0.986
2:200533095:A:T	K40N	0.986
2:200536128:A:C	S125R	0.986
2:200536130:C:A	S125R	0.986
2:200536130:C:G	S125R	0.986
2:200533091:T:A	I39K	0.985

dbSNP variants (sampled 300 via entrez): RS1000022653 (2:200530454 G>C), RS1000042646 (2:200543687 A>G,T), RS1000189418 (2:200526187 AGCCGCAGCCGCTGCTGCTC>A), RS1000224508 (2:200550347 A>C), RS1000469027 (2:200555291 T>C), RS1000492236 (2:200537043 T>C), RS1000509584 (2:200556249 A>C,T), RS1000518420 (2:200542878 T>C), RS1000663108 (2:200565082 T>G), RS1000807133 (2:200557172 G>A), RS1000905201 (2:200550170 G>A), RS1000957019 (2:200550466 G>A), RS1000959451 (2:200582390 ATCT>A), RS1000977370 (2:200578330 A>G,T), RS1001046437 (2:200530150 A>G)

Disease associations

OMIM: gene MIM:612425 | disease phenotypes:

GenCC curated gene-disease

Disease	Classification	Inheritance
Perrault syndrome	Limited	Autosomal recessive

Mondo (2): primary ovarian failure (MONDO:0005387), Perrault syndrome (MONDO:0017312)

Orphanet (1): NON RARE IN EUROPE: Primary ovarian failure (Orphanet:619)

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST003254_6	Urinary albumin-to-creatinine ratio in non-diabetics	9.000000e-06

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0007778	urinary albumin to creatinine ratio

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D016649	Primary Ovarian Insufficiency	C12.050.351.500.056.630.750; C12.100.250.056.630.750; C19.391.630.750

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

67 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects expression, decreases expression, decreases methylation	4
bisphenol A	decreases expression, increases expression	3
Cyclosporine	decreases expression	3
Air Pollutants	decreases expression, increases abundance	2
Benzo(a)pyrene	affects methylation, decreases expression	2
Rotenone	decreases expression, increases expression	2
7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	decreases expression	2
Aflatoxin B1	affects expression, decreases methylation	2
Particulate Matter	decreases expression, increases abundance	2
aristolochic acid I	decreases expression	1
FR900359	decreases phosphorylation	1
dicrotophos	decreases expression	1
triphenyl phosphate	affects expression	1
pirinixic acid	affects binding, increases activity, increases expression	1
androstane-3,17-dione	increases expression	1
beta-lapachone	decreases expression	1
methylparaben	decreases expression	1
o,p’-DDT	decreases expression	1
sulforaphane	increases expression	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
sodium arsenite	increases expression	1
potassium chromate(VI)	affects cotreatment, decreases expression	1
2,3-bis(3’-hydroxybenzyl)butyrolactone	increases expression, affects cotreatment	1
diallyl trisulfide	decreases expression	1
beta-methylcholine	affects expression	1
epigallocatechin gallate	affects cotreatment, decreases expression	1
perfluorooctane sulfonic acid	decreases expression	1
deguelin	increases expression	1
abrine	decreases expression	1
pyrachlostrobin	increases expression	1

Clinical trials (associated diseases)

75 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00417066	PHASE4	COMPLETED	Flexible GnRH Antagonist vs Flare up GnRH Agonist Protocol in Poor Responders
NCT00732693	PHASE4	COMPLETED	Evaluation of Physiologic and Standard Sex Steroid Replacement Regimens in Women With Premature Ovarian Failure
NCT00837616	PHASE4	COMPLETED	Estrogen Dosing in Turner Syndrome: Pharmacology and Metabolism
NCT01853501	PHASE4	UNKNOWN	Effects of ADSC Therapy in Women With POF
NCT02783937	PHASE4	COMPLETED	Filgrastim for Premature Ovarian Insufficiency
NCT03535480	PHASE4	UNKNOWN	Autologous Bone Marrow Stem Cell Ovarian Transplantation to Restore Ovarian Function in Premature Ovarian Failure
NCT00140998	PHASE3	COMPLETED	Estrogen Treatment (Oral vs. Patches) in Turner Syndrome
NCT00001951	PHASE2	COMPLETED	Hormone Replacement in Young Women With Premature Ovarian Failure
NCT00370019	PHASE2	WITHDRAWN	Effects of an Estrogen Replacement Therapy Skin Patch on Ovulation in Women With Premature Ovarian Failure
NCT00429494	PHASE2	COMPLETED	GnRH Analogue for Ovarian Function Preservation in Hematopoietic Stem Cell Transplantation Patients
NCT03816852	PHASE2	SUSPENDED	The Safety and Efficiency Study of Mesenchymal Stem Cell (19#iSCLife®-POI) in Premature Ovarian Insufficiency
NCT04536467	PHASE2	UNKNOWN	Prevention of Chemotherapy-Induced Ovarian Failure With Goserelin in Premenopausal Lymphoma Patients
NCT06117982	PHASE2	COMPLETED	The Impact of Granulocyte Colony Stimulating Factor on Premature Ovarian Insufficiency
NCT02912104	PHASE1	COMPLETED	A Therapeutic Trial of Human Amniotic Epithelial Cells Transplantation for Primary Ovarian Failure
NCT03178695	PHASE1	COMPLETED	Inovium Ovarian Rejuvenation Trials
NCT04815213	PHASE1	ACTIVE_NOT_RECRUITING	The Use of Expandeded Mesenchymal Stromal Cells (MSC) in Premature Ovarian Failure (POF) in Adult Humans
NCT05138367	PHASE1	COMPLETED	Effects of UCA-PSCs in Women With POF
NCT06132542	PHASE1	UNKNOWN	Autologous ADMSC Transplantation in Patients With POI
NCT00948857	PHASE2/PHASE3	TERMINATED	Dehydroepiandrosterone (DHEA) Treatment and Premature Ovarian Failure (POF)
NCT04031456	PHASE2/PHASE3	RECRUITING	Autologous PRP Infusion May Restore Ovarian Function and May Promote Folliculogenesis in POI Patients
NCT02043743	PHASE1/PHASE2	UNKNOWN	Autologous Stem Cells Transplantation in Patients With Idiopathic and Drug Induced Premature Ovarian Failure
NCT02062931	PHASE1/PHASE2	UNKNOWN	Autologous Mesenchymal Stem Cells Transplantation In Women With Premature Ovarian Failure
NCT02151890	PHASE1/PHASE2	COMPLETED	Pregnancy After Stem Cell Transplantation in Premature Ovarian Failure
NCT02372474	PHASE1/PHASE2	COMPLETED	It is a Real The First Baby Of Autologous Stem Cell Therapy in Premature Ovarian Failure
NCT02603744	PHASE1/PHASE2	UNKNOWN	Autologous Adipose Derived Mesenchymal Stromal Cells Transplantation in Women With Premature Ovarian Failure (POF)
NCT02644447	PHASE1/PHASE2	COMPLETED	Transplantation of HUC-MSCs With Injectable Collagen Scaffold for POF
NCT03069209	PHASE1/PHASE2	UNKNOWN	Autologous Bone Marrow-Derived Stem Cell Transplantation in Patients With Premature Ovarian Failure (POF)
NCT03985462	PHASE1/PHASE2	WITHDRAWN	Very Small Embryonic-like Stem Cells for Ovary
NCT04009473	PHASE1/PHASE2	UNKNOWN	Stem Cell Therapy and Growth Factor Ovarian in Vitro Activation
NCT04071574	PHASE1/PHASE2	COMPLETED	Comparative Study on the Efficacy of Ovarian Stimulation Protocols on the Success Rate of ICSI in Female Infertility
NCT04922398	PHASE1/PHASE2	UNKNOWN	Ovarian Injection of PRP (Platelet -Rich Plasma) Vs Normal Saline in Premature Ovarian Insufficiency
NCT05462379	PHASE1/PHASE2	ACTIVE_NOT_RECRUITING	Autologous Heterotopic Fresh Ovarian Graft in Woman With LACC Eligible for Pelvic Radiotherapy Treatment.
NCT06202547	PHASE1/PHASE2	UNKNOWN	Intra-ovarian Injection of MSC-EVs in Idiopathic Premature Ovarian Failure
NCT01129947	EARLY_PHASE1	WITHDRAWN	The Use of DHEA in Women With Premature Ovarian Failure
NCT05522634	EARLY_PHASE1	UNKNOWN	A Clinical Study of Chinese Herbal Compound TJAOA101 in the Treatment of Premature Ovarian Insufficiency
NCT07308327	EARLY_PHASE1	ACTIVE_NOT_RECRUITING	The Influence of Gut Microbiota on Ovarian Function: A Single-center, Randomized,Double Blind, Parallel-controlled, Exploratory Clinical Trial
NCT00001275	Not specified	COMPLETED	Ovarian Follicle Function in Patients With Primary Ovarian Failure
NCT00001306	Not specified	COMPLETED	Steroid Therapy in Autoimmune Premature Ovarian Failure
NCT00006156	Not specified	COMPLETED	Feasibility Study for Development of an Early Test for Ovarian Failure
NCT00119925	Not specified	UNKNOWN	‘SPRING’-Study: Subfertility Guidelines: Patient Related Implementation in the Netherlands Among Gynaecologists