SH2B1

Summary

SH2B1 (SH2B adaptor protein 1, HGNC:30417) is a protein-coding gene on chromosome 16p11.2, encoding SH2B adapter protein 1 (Q9NRF2). Adapter protein for several members of the tyrosine kinase receptor family.

This gene encodes a member of the SH2-domain containing mediators family. The encoded protein mediates activation of various kinases and may function in cytokine and growth factor receptor signaling and cellular transformation. Alternatively spliced transcript variants have been described.

Source: NCBI Gene 25970 — RefSeq curated summary.

At a glance

• Gene–disease (curated): severe early-onset obesity-insulin resistance syndrome due to SH2B1 deficiency (Moderate, GenCC)
• GWAS associations: 60
• Clinical variants (ClinVar): 432 total — 1 pathogenic
• Phenotypes (HPO): 78
• Dosage sensitivity (ClinGen): haploinsufficiency little evidence, triplosensitivity no evidence
• MANE Select transcript: NM_001387430

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:30417
Approved symbol	SH2B1
Name	SH2B adaptor protein 1
Location	16p11.2
Locus type	gene with protein product
Status	Approved
Aliases	FLJ30542, SH2B
Ensembl gene	ENSG00000178188
Ensembl biotype	protein_coding
OMIM	608937
Entrez	25970

Gene structure

Transcript identifiers

Ensembl transcripts: 20 — 17 protein_coding, 2 retained_intron, 1 protein_coding_CDS_not_defined

ENST00000322610, ENST00000337120, ENST00000359285, ENST00000395532, ENST00000538342, ENST00000545570, ENST00000561629, ENST00000563591, ENST00000563674, ENST00000566176, ENST00000566209, ENST00000567536, ENST00000568868, ENST00000569471, ENST00000569651, ENST00000618521, ENST00000684370, ENST00000707128, ENST00000893539, ENST00000942394

RefSeq mRNA: 9 — MANE Select: NM_001387430 NM_001145795, NM_001145796, NM_001145797, NM_001145812, NM_001308293, NM_001308294, NM_001387404, NM_001387430, NM_015503

CCDS: CCDS32424, CCDS53996, CCDS53997, CCDS76851

Canonical transcript exons

ENST00000684370 — 8 exons

Exon	Start	End
ENSE00001243796	28872190	28872401
ENSE00001243802	28871780	28871983
ENSE00001243817	28869006	28869097
ENSE00001243823	28867331	28867432
ENSE00001405545	28872534	28872705
ENSE00001806778	28873447	28874205
ENSE00003635244	28869208	28869383
ENSE00003917157	28863843	28867033

Expression profiles

Bgee: expression breadth ubiquitous, 253 present calls, max score 97.58.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 22.0482 / max 169.5902, expressed in 1804 samples.

FANTOM5 promoters (10 alternative TSS)

Promoter ID	TPM avg	Samples expressed
153416	9.7071	1766
153415	3.6823	1544
153417	2.6869	1078
153409	1.9818	1101
207823	1.4815	986
153411	0.7500	426
153413	0.7423	273
153412	0.6088	162
153410	0.3201	144
153414	0.0875	38

Top tissues by expression

284 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
right hemisphere of cerebellum	UBERON:0014890	97.58	gold quality
cerebellar hemisphere	UBERON:0002245	97.25	gold quality
cerebellar cortex	UBERON:0002129	97.15	gold quality
mucosa of transverse colon	UBERON:0004991	97.11	gold quality
right lobe of thyroid gland	UBERON:0001119	96.91	gold quality
right uterine tube	UBERON:0001302	96.76	gold quality
apex of heart	UBERON:0002098	96.72	gold quality
left lobe of thyroid gland	UBERON:0001120	96.58	gold quality
metanephros cortex	UBERON:0010533	96.54	gold quality
adenohypophysis	UBERON:0002196	96.53	gold quality
right ovary	UBERON:0002118	96.14	gold quality
transverse colon	UBERON:0001157	96.09	gold quality
left ovary	UBERON:0002119	96.06	gold quality
right frontal lobe	UBERON:0002810	96.02	gold quality
endocervix	UBERON:0000458	95.81	gold quality
body of uterus	UBERON:0009853	95.77	gold quality
small intestine Peyer’s patch	UBERON:0003454	95.75	gold quality
pituitary gland	UBERON:0000007	95.39	gold quality
thyroid gland	UBERON:0002046	95.39	gold quality
muscle layer of sigmoid colon	UBERON:0035805	95.38	gold quality
cerebellum	UBERON:0002037	95.37	gold quality
body of stomach	UBERON:0001161	95.22	gold quality
right adrenal gland	UBERON:0001233	95.22	gold quality
granulocyte	CL:0000094	95.16	gold quality
right adrenal gland cortex	UBERON:0035827	95.15	gold quality
lower esophagus mucosa	UBERON:0035834	95.10	gold quality
left adrenal gland cortex	UBERON:0035825	95.09	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	94.91	gold quality
left adrenal gland	UBERON:0001234	94.90	gold quality
minor salivary gland	UBERON:0001830	94.83	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	5.58
E-MTAB-2983	no	184.64

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

43 targeting SH2B1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4283	100.00	66.42	2097
HSA-MIR-6798-5P	100.00	65.77	699
HSA-MIR-196A-1-3P	99.99	72.15	2772
HSA-MIR-6870-5P	99.99	68.55	2115
HSA-MIR-4723-5P	99.97	68.70	2034
HSA-MIR-5698	99.97	68.49	2029
HSA-MIR-7111-5P	99.97	68.48	2062
HSA-MIR-185-3P	99.95	67.01	1743
HSA-MIR-4525	99.94	64.38	675
HSA-MIR-5010-5P	99.94	64.11	705
HSA-MIR-3529-3P	99.90	73.55	3045
HSA-MIR-4492	99.87	68.25	3611
HSA-MIR-4447	99.85	67.81	2900
HSA-MIR-4728-5P	99.85	69.39	4718
HSA-MIR-6785-5P	99.82	68.68	4428
HSA-MIR-6756-5P	99.82	67.97	2466
HSA-MIR-149-3P	99.72	68.22	3963
HSA-MIR-6883-5P	99.69	68.05	3785
HSA-MIR-6766-5P	99.68	67.70	2325
HSA-MIR-6762-3P	99.66	66.94	1188
HSA-MIR-142-3P	99.62	71.30	974
HSA-MIR-762	99.58	66.61	1994
HSA-MIR-4472	99.56	66.08	1478
HSA-MIR-136-5P	99.50	67.26	1153
HSA-MIR-4489	99.50	65.56	785
HSA-MIR-1275	99.47	67.90	2749
HSA-MIR-4498	99.47	67.42	2360
HSA-MIR-4505	99.27	67.81	2678
HSA-MIR-6744-3P	99.22	64.41	972
HSA-MIR-5787	99.22	67.86	2628

Functional genomics

ClinGen dosage: haploinsufficiency 1 (little evidence), triplosensitivity 0 (no evidence). ClinGen Gene Dosage Map

Literature-anchored findings (GeneRIF, showing 40)

• SH2-B or APS homodimerization and SH2-B/APS heterodimerization thus provide direct mechanisms for activating and inhibiting Janus kinase 2 (PMID:15767667)
• overexpression of SH2B1beta, by enhancing phosphorylation/activation of RET transducers, potentiates the cellular differentiation and the neoplastic transformation thereby induced, and counteracts the action of RET inhibitors. (PMID:17471236)
• SH2B1beta functions as an adapter protein that cross-links actin filaments, leading to modulation of cellular responses in response to JAK2 activation. (PMID:19342444)
• Deletions of the 16p11.2 SH2B1-containing region were identified in 31 patients with developmental delay and obesity. (PMID:20808231)
• Adapter protein SH2B1beta binds filamin A to regulate prolactin-dependent cytoskeletal reorganization and cell motility (PMID:21566085)
• Meta-analysis of 4992 subjects revealed seven SNPs near four loci, including NEGR1, TMEM18, SH2B1 /ATP2A1 and MC4R, showing significant association at 0.005 (PMID:21750520)
• Our results suggest that there is a visceral fat area (VFA)-specific genetic factor and that a polymorphism in the SH2B1 gene influences the risk of visceral fat accumulation. (PMID:21796141)
• Variability at the SH2B1 obesity locus is associated with myocardial infarction in type 2 diabetic patients and with reduced insulin-stimulated nitric oxide synthase activity in human endothelial cells. (PMID:21907990)
• With the current study we were able to replicate and confirm that the SH2B1 gene locus is significantly associated with complex obesity in a Caucasian population. (PMID:22248999)
• Our study supports earlier reports of SH2B1 to be of importance in insulin sensitivity and, in addition, suggests potential roles of NEGR1 and MTCH2. (PMID:22443470)
• High SH2B1 expression was associated with lymph node metastasis, and recurrence in non-small cell lung cancer. (PMID:22901222)
• The known, obesity related, sh2b1 gene single nucleotide polymorphisms rs4788102 and rs7498665 are associated with plasma triglyceride levels. (PMID:22942098)
• Demonstration of the additive effect of four polymorphisms on the LRP5, LEPR, near MC4R and SH2B1 genes on metabolic syndrome risk. (PMID:23054017)
• Data show the synthetic effect of SNPs on the indices of adiposity and risk of obesity in Chinese girls, but failed to replicate the effect of five separate variants of SEC16B rs10913469, SH2B1 rs4788102, PCSK1 rs6235, KCTD15 rs29941 and BAT2 rs2844479. (PMID:23121087)
• SH2B1 plays a critical role in the control of human food intake and body weight and is implicated in maladaptive human behavior. (PMID:23160192)
• Studies indicate that insulin receptor (IR) and IGF Type 1 Receptor (IGFR) have been identified as important partners of Grb10/14 and SH2B1/B2 adaptors. (PMID:23190452)
• The rare coding mutation betaThr656Ile/gammaPro674Ser (g.9483C/T) in SH2B1 was exclusively detected in overweight or obese individuals. (PMID:23270367)
• The obesity risk alleles of non-synonymous SNPs at SH2B1 and APOB48R have no strong effect on weight loss-related phenotypes in overweight children after a 1-year lifestyle intervention. (PMID:23519644)
• Common variants near BDNF and SH2B1 show nominal evidence of association with snacking behavior in European populations. (PMID:23640704)
• rare missense mutations of FTO and SH2B1 did not confer risks of obesity in Chinese Han children in our cohort (PMID:23825611)
• Data (from in excess of six genetic association studies) suggest that an SNP in SH2B1 (rs4788102) is not associated with abnormal glucose homeostasis in obese subjects of European ancestry. [META-ANALYSIS] (PMID:24103803)
• This study highlighted the importance of two candidate genes, SH2B1 and FAIM2, in the risk of overweight/obesity. (PMID:24621099)
• SH2B1 can enhance neurite outgrowth and accelerate the maturation of human induced neurons under defined conditions. (PMID:24736401)
• 4 novel variants in SH2B1 were identified in individuals with obesity and insulin resistance. (PMID:24971614)
• We report evidence that the 16p11.2 deletion may influence specific obesity-associated disinhibited eating behaviors (PMID:25234362)
• The rs7359397 (SH2B1) was associated with the body weight, body mass index, and truncal fat mass reduction. (PMID:25471250)
• Mutation analysis has demonstrated that variation in the SH2B1 gene is frequent in both lean and obese groups, with distinctive variations being present on either side of the weight spectrum. (PMID:26031769)
• that SH2B1 is a key positive mediator of pathological cardiac hypertrophy (PMID:26077624)
• Results identified SH2B as a functional target of miR-361 which down-regulation suppresses lung cancer progression and metastasis through regulation of SH2B1. (PMID:27164951)
• SH2B1 polymorphisms are associated with HbA1c, largely independent of BMI, in European American young adults. (PMID:27530450)
• This study is the first to show that neuronal SH2B1, a key protein in insulin signaling, may have a role in the accumulation of Abeta42 in an animal model of Alzheimer’s Disease. (PMID:27802221)
• SH2B1 fine-tunes global-local chromatin states. (PMID:28039048)
• Chromosome microarray analysis was performed on both twins and their parents. An identical 244 kb microdeletion on 16p11.2 including 9 Refseq genes, including SH2B1, was identified in the twins. (PMID:28544142)
• SH2B1 and RABEP1 genetic variants are associated with worsening of LDL and glucose parameters in patients treated with psychotropic drugs (PMID:28694205)
• The high-resolution structure of the SH2 domain of SH2B1 further reveals conformationally plastic protein loops that may contribute to the ability of the protein to recognize dissimilar ligands. Together, numerous hydrophobic and electrostatic interactions, in addition to backbone conformational flexibility, permit the recognition of diverse peptides by SH2B1. (PMID:29127727)
• Data reported that SH2B1 expression levels were significantly upregulated and positively associated with EMT markers and poor patient survival in lung adenocarcinoma (LADC) specimens. Further results reveal that SH2B1 has a major role in LADC progression and that SH2B1 is a critical activator of Wnt/beta-catenin signaling. (PMID:29380446)
• The increased expression of genes in leptin (JAK/STAT or AKT) signaling implies that the main mode of action for human SH2B1 mutations might affect leptin signaling rather than insulin signaling. (PMID:29631267)
• Hsa_circ_0136666 promotes the proliferation and invasion of colorectal cancer through miR-136/SH2B1 axis. (PMID:30370521)
• Copy number variations in SH2B1 gene is associated with distal syndromes with intellectual disability. (PMID:30518945)
• These studies demonstrate that the PH domain plays a crucial role in how SH2B1 controls energy balance and glucose homeostasis. (PMID:31439647)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	sh2b1	ENSDARG00000057679
mus_musculus	Sh2b1	ENSMUSG00000030733
rattus_norvegicus	Sh2b1	ENSRNOG00000049181
drosophila_melanogaster	Lnk	FBGN0028717

Paralogs (2): SH2B3 (ENSG00000111252), SH2B2 (ENSG00000160999)

Protein

Protein identifiers

SH2B adapter protein 1 — Q9NRF2 (reviewed: Q9NRF2)

Alternative names: Pro-rich, PH and SH2 domain-containing signaling mediator, SH2 domain-containing protein 1B

All UniProt accessions (9): Q9NRF2, B4DLN5, F5GXU7, H3BMY3, H3BPB4, H3BPZ4, H3BTK4, H3BUN7, H3BVF6

UniProt curated annotations — full annotation on UniProt →

Function. Adapter protein for several members of the tyrosine kinase receptor family. Involved in multiple signaling pathways mediated by Janus kinase (JAK) and receptor tyrosine kinases, including the receptors of insulin (INS), insulin-like growth factor 1 (IGF1), nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), glial cell line-derived neurotrophic factor (GDNF), platelet-derived growth factor (PDGF) and fibroblast growth factors (FGFs). In growth hormone (GH) signaling, autophosphorylated (‘Tyr-813’) JAK2 recruits SH2B1, which in turn is phosphorylated by JAK2 on tyrosine residues. These phosphotyrosines form potential binding sites for other signaling proteins. GH also promotes serine/threonine phosphorylation of SH2B1 and these phosphorylated residues may serve to recruit other proteins to the GHR-JAK2-SH2B1 complexes, such as RAC1. In leptin (LEP) signaling, binds to and potentiates the activation of JAK2 by globally enhancing downstream pathways. In response to leptin, binds simultaneously to both, JAK2 and IRS1 or IRS2, thus mediating formation of a complex of JAK2, SH2B1 and IRS1 or IRS2. Mediates tyrosine phosphorylation of IRS1 and IRS2, resulting in activation of the PI 3-kinase pathway. Acts as a positive regulator of NGF-mediated activation of the Akt/Forkhead pathway; prolongs NGF-induced phosphorylation of AKT1 on ‘Ser-473’ and AKT1 enzymatic activity. Enhances the kinase activity of the cytokine receptor-associated tyrosine kinase JAK2 and of other receptor tyrosine kinases, such as FGFR3 and NTRK1. For JAK2, the mechanism seems to involve dimerization of both, SH2B1 and JAK2. Enhances RET phosphorylation and kinase activity. Isoforms seem to be differentially involved in IGF1 and PDGF-induced mitogenesis.

Subunit / interactions. Self-associates. Homopentamer. Forms a heteromultimeric complex with SH2B2. Interacts with SH2B2. Isoform 1 interacts via its SH2 domain with JAK2. Isoform 2 interacts via its SH2 domain and its N-terminus with JAK2; the SH2 domain is required for the major interaction with JAK2 phosphorylated on tyrosine residues; the N-terminus provides a low-affinity binding to JAK2 independent of JAK2 phosphorylation. Isoform 3 interacts via its SH2 domain with JAK2. Isoform 1 interacts via its SH2 domain with INSR; the interaction requires receptor activation. Isoform 3 interacts via its SH2 domain with INSR; the interaction requires receptor activation and requires INSR phosphorylation at ‘Tyr-1185’. Isoform 1 interacts with IGF1R; the interaction requires receptor activation. Isoform 2 interacts with PRKAR1A/RET (PTC2) fusion protein; the interaction requires RET ‘Tyr-905’ and Tyr-981’. Isoform 2 interacts via its SH2 domain with FGFR3; the interaction requires FGFR3 ‘Tyr-724’ and ‘Tyr-760’. Isoform 2 interacts with RET; the interaction requires RET kinase activity and RET ‘Tyr-981’. Isoform 2 interacts with RAC1. Isoform 2 interacts with PDGFRA and/or PDGFRB; the interaction requires receptor activation. Interacts with IRS1 and IRS2. Isoform 3 is probably part of a complex consisting of INSR, IRS1 and SH2B1. Probably part of a ternary complex consisting of SH2B1, JAK2 and IRS1 or IRS2. May interact with FCER1G. Interacts (via SH2 domain) with NTRK1 (phosphorylated). Interacts with IRS1 and IRS2.

Subcellular location. Cytoplasm. Membrane. Nucleus.

Tissue specificity. Widely expressed with highest levels in skeletal muscle and ovary.

Post-translational modifications. Phosphorylated on tyrosine residues in response to receptor kinase stimulation. Phosphorylated by RET.

Similarity. Belongs to the SH2B adapter family.

Isoforms (3)

UniProt ID	Names	Canonical?
Q9NRF2-1	1, Alpha	yes
Q9NRF2-2	2, Beta
Q9NRF2-3	3, Gamma

RefSeq proteins (9): NP_001139267, NP_001139268, NP_001139269, NP_001139284, NP_001295222, NP_001295223, NP_001374333, NP_001374359, NP_056318 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000980	SH2	Domain
IPR001849	PH_domain	Domain
IPR011993	PH-like_dom_sf	Homologous_superfamily
IPR015012	Phe_ZIP	Domain
IPR030523	SH2B	Family
IPR035057	SH2B1_SH2	Domain
IPR036290	Phe_ZIP_sf	Homologous_superfamily
IPR036860	SH2_dom_sf	Homologous_superfamily

Pfam: PF00017, PF00169, PF08916

UniProt features (58 total): region of interest 13, mutagenesis site 9, compositionally biased region 8, strand 8, modified residue 7, helix 4, domain 2, splice variant 2, sequence variant 2, sequence conflict 2, chain 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
5W3R	X-RAY DIFFRACTION	1.39

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9NRF2-F1	58.94	0.23

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (7): 88, 96, 270, 417, 420, 439, 494

Mutagenesis-validated functional residues (9):

Position	Phenotype
29	abolishes self-association and interaction with insr and igf1r.
34	abolishes self-association and interaction with insr and igf1r.
38	abolishes self-association and interaction with insr and igf1r.
41	abolishes self-association and interaction with insr and igf1r.
42	abolishes self-association and interaction with insr and igf1r.
48	abolishes self-association and interaction with insr and igf1r.
68	abolishes self-association and interaction with insr and igf1r.
72	abolishes self-association and interaction with insr and igf1r.
555	abolishes self-association and interaction with insr and igf1r.

Function

Pathways and Gene Ontology

Reactome pathways

5 pathways

ID	Pathway
R-HSA-983231	Factors involved in megakaryocyte development and platelet production
R-HSA-1170546	Prolactin receptor signaling
R-HSA-2586552	Signaling by Leptin
R-HSA-982772	Growth hormone receptor signaling
R-HSA-109582	Hemostasis

MSigDB gene sets: 389 (showing top): MORF_RAGE, GOBP_SMAD_PROTEIN_SIGNAL_TRANSDUCTION, GOBP_POSITIVE_REGULATION_OF_MITOTIC_NUCLEAR_DIVISION, GCM_MAP4K4, FLECHNER_PBL_KIDNEY_TRANSPLANT_REJECTED_VS_OK_UP, GCM_GSPT1, REACTOME_CYTOKINE_SIGNALING_IN_IMMUNE_SYSTEM, GOBP_REGULATION_OF_NUCLEAR_DIVISION, MORF_ATRX, GOBP_POSITIVE_REGULATION_OF_ORGANELLE_ORGANIZATION, GOBP_ORGANELLE_FISSION, MORF_PPP5C, GOBP_REGULATION_OF_TRANSMEMBRANE_RECEPTOR_PROTEIN_SERINE_THREONINE_KINASE_SIGNALING_PATHWAY, MORF_FANCG, chr16p11

GO Biological Process (8): lamellipodium assembly (GO:0030032), intracellular signal transduction (GO:0035556), positive regulation of mitotic nuclear division (GO:0045840), cell motility (GO:0048870), positive regulation of SMAD protein signal transduction (GO:0060391), regulation of DNA biosynthetic process (GO:2000278), signal transduction (GO:0007165), cell surface receptor protein tyrosine kinase signaling pathway (GO:0007169)

GO Molecular Function (3): transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068), protein binding (GO:0005515), signaling adaptor activity (GO:0035591)

GO Cellular Component (5): nucleus (GO:0005634), cytosol (GO:0005829), plasma membrane (GO:0005886), cytoplasm (GO:0005737), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-3 pathways:

Category	Pathways
Cytokine Signaling in Immune system	2
Hemostasis	1
Signal Transduction	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	3
intracellular anatomical structure	2
cellular process	2
lamellipodium organization	1
plasma membrane bounded cell projection assembly	1
signal transduction	1
regulation of mitotic nuclear division	1
positive regulation of nuclear division	1
positive regulation of cell cycle process	1
mitotic nuclear division	1
regulation of SMAD protein signal transduction	1
SMAD protein signal transduction	1
positive regulation of transmembrane receptor protein serine/threonine kinase signaling pathway	1
positive regulation of intracellular signal transduction	1
regulation of macromolecule biosynthetic process	1
regulation of DNA metabolic process	1
DNA biosynthetic process	1
cell communication	1
signaling	1
regulation of cellular process	1
cellular response to stimulus	1
enzyme-linked receptor protein signaling pathway	1
cell surface receptor protein tyrosine kinase signaling pathway	1
signaling receptor complex adaptor activity	1
receptor tyrosine kinase binding	1
binding	1
protein-macromolecule adaptor activity	1
intracellular membrane-bounded organelle	1
cytoplasm	1
membrane	1
cell periphery	1

Protein interactions and networks

STRING

1034 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
SH2B1	JAK2	O60674	932
SH2B1	KCTD15	Q96SI1	917
SH2B1	TMEM18	Q96B42	904
SH2B1	GNPDA2	Q8TDQ7	903
SH2B1	NEGR1	Q7Z3B1	887
SH2B1	LEP	P41159	879
SH2B1	MTCH2	Q9Y6C9	870
SH2B1	MC4R	P32245	867
SH2B1	FTO	Q9C0B1	867
SH2B1	NTRK1	P04629	826
SH2B1	GRB2	P29354	798
SH2B1	SEC16B	Q96JE7	770
SH2B1	LEPR	P48357	748
SH2B1	PCSK1	P29120	746
SH2B1	ATXN2L	Q8WWM7	725

IntAct

35 interactions, top by confidence:

A	B	Type	Score
EGFR	SH2B1	psi-mi:“MI:0915”(physical association)	0.770
SH2B1	EGFR	psi-mi:“MI:0407”(direct interaction)	0.770
SH2B1	JAK2	psi-mi:“MI:0914”(association)	0.530
SH2B1	INSR	psi-mi:“MI:0914”(association)	0.480
SH2B1	INSR	psi-mi:“MI:0915”(physical association)	0.480
SH2B1	Stat3	psi-mi:“MI:0915”(physical association)	0.470
SH2B1	Stat3	psi-mi:“MI:2364”(proximity)	0.470
CRK	SH2B1	psi-mi:“MI:0407”(direct interaction)	0.440
SH2B1	MET	psi-mi:“MI:0407”(direct interaction)	0.440
SH2B1	Stat3	psi-mi:“MI:0915”(physical association)	0.400
Stat3	SH2B1	psi-mi:“MI:0915”(physical association)	0.400
STAT3	SH2B1	psi-mi:“MI:0915”(physical association)	0.400
KIAA0319	SH2B1	psi-mi:“MI:0915”(physical association)	0.370
RHBG	SH2B1	psi-mi:“MI:0915”(physical association)	0.370
Ntrk2	SH2B1	psi-mi:“MI:0915”(physical association)	0.370
ALK	SH2B1	psi-mi:“MI:0915”(physical association)	0.370
SH2B1	Fgfr1	psi-mi:“MI:0914”(association)	0.350
MEF2A	REV3L	psi-mi:“MI:0914”(association)	0.350
CALM1	MYO1C	psi-mi:“MI:0914”(association)	0.350
CALM2	MYO1C	psi-mi:“MI:0914”(association)	0.350

BioGRID (54): SH2B1 (Two-hybrid), CSAD (Two-hybrid), SH2B1 (Two-hybrid), SH2B1 (PCA), SH2B1 (Affinity Capture-MS), SH2B1 (Affinity Capture-MS), SH2B1 (Affinity Capture-RNA), IRS1 (Affinity Capture-Western), IRS2 (Affinity Capture-Western), SH2B1 (Affinity Capture-Western), SH2B1 (Affinity Capture-Western), SH2B1 (Affinity Capture-Western), SH2B1 (Two-hybrid), FGFR3 (Affinity Capture-Western), SH2B1 (Two-hybrid)

ESM2 similar proteins: A3KNX5, A6NI15, A7YWL5, B0BN13, D3ZLB7, E9Q9M8, O02761, O35906, O70240, O94983, O97930, P01102, P11939, P13346, P23050, P53539, P70298, P70595, P70660, P97303, Q15742, Q28C89, Q3U1J1, Q5EBA3, Q61122, Q61127, Q62722, Q62912, Q62985, Q6NW59, Q80Y50, Q86UZ6, Q8CD60, Q8HZP6, Q90ZL1, Q91ZM2, Q92886, Q96JB3, Q99NA2, Q9BE45

Diamond homologs: O09039, O14492, O45539, O70142, O88834, P00519, P00520, P00521, P00522, P09760, P10447, P29353, P32577, P41239, P41240, P41241, P41242, P41243, P42679, P42684, P50745, P98077, P98083, Q08CX2, Q0IIE2, Q0VBZ0, Q5M824, Q5R7W7, Q62270, Q62985, Q6S5L8, Q8AY68, Q8BMC3, Q8IPW2, Q91ZM2, Q9H3Y6, Q9JID9, Q9JLM9, Q9NRF2, Q9UQQ2

SIGNOR signaling

8 interactions.

A	Effect	B	Mechanism
NTRK1	up-regulates	SH2B1	binding
CD22	“up-regulates activity”	SH2B1	binding
SH2B1	“down-regulates activity”	SYK	dephosphorylation
SH2B1	“down-regulates activity”	BLNK	dephosphorylation
SH2B1	“down-regulates activity”	CD79A	dephosphorylation
SH2B1	“down-regulates activity”	CD79B	dephosphorylation
LEPR	“up-regulates activity”	SH2B1	binding
SH2B1	“up-regulates activity”	JAK2	binding

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 22 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Signaling by Receptor Tyrosine Kinases	7	21.3×	6e-06
Diseases of signal transduction by growth factor receptors and second messengers	5	16.7×	6e-04

GO biological processes:

GO term	Partners	Fold	FDR
positive regulation of cell migration	5	16.2×	3e-04

Disease & clinical

Clinical variants and AI predictions

ClinVar

432 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	0
Uncertain significance	272
Likely benign	128
Benign	9

Top pathogenic / likely-pathogenic (1)

Variant ID	HGVS	Classification
3243421	NC_000016.9:g.(?28488837)(29001333_?)del	Pathogenic

SpliceAI

1914 predictions. Top by Δscore:

Variant	Effect	Δscore
16:28863751:GGAA:G	donor_gain	1.0000
16:28863752:GAA:G	donor_gain	1.0000
16:28863752:GAAG:G	donor_gain	1.0000
16:28863755:G:GG	donor_gain	1.0000
16:28869002:GTAG:G	acceptor_loss	1.0000
16:28869003:TAGGT:T	acceptor_loss	1.0000
16:28869004:A:T	acceptor_loss	1.0000
16:28869095:AGGG:A	donor_loss	1.0000
16:28869096:GG:G	donor_gain	1.0000
16:28869097:GG:G	donor_gain	1.0000
16:28869097:GGTG:G	donor_loss	1.0000
16:28869098:G:GG	donor_gain	1.0000
16:28869098:GTGA:G	donor_loss	1.0000
16:28869099:T:A	donor_loss	1.0000
16:28869203:TGCA:T	acceptor_loss	1.0000
16:28869204:GCAG:G	acceptor_loss	1.0000
16:28869205:CA:C	acceptor_loss	1.0000
16:28869206:A:AG	acceptor_gain	1.0000
16:28869207:G:GG	acceptor_gain	1.0000
16:28869207:G:GT	acceptor_loss	1.0000
16:28869207:GACC:G	acceptor_gain	1.0000
16:28869207:GACCC:G	acceptor_gain	1.0000
16:28869382:GG:G	donor_gain	1.0000
16:28869383:GG:G	donor_gain	1.0000
16:28871925:G:T	donor_gain	1.0000
16:28872185:T:A	acceptor_gain	1.0000
16:28872323:C:CA	acceptor_gain	1.0000
16:28872402:G:GA	donor_loss	1.0000
16:28872403:T:A	donor_loss	1.0000
16:28872533:GC:G	acceptor_gain	1.0000

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000012161 (16:28853672 C>A,G), RS1000092706 (16:28859635 G>A), RS1000185540 (16:28861298 A>C,G), RS1000363752 (16:28847907 C>T), RS1000647738 (16:28855448 T>C), RS1000832517 (16:28871085 T>C), RS1000935149 (16:28864162 T>C), RS1001018419 (16:28855902 ACCTCGTGATCCGCCTGCCTCGG>A), RS1001057143 (16:28865673 C>G), RS1001075839 (16:28850729 C>T), RS1001133325 (16:28858730 G>A,C), RS1001228665 (16:28868920 C>A,G,T), RS1001303902 (16:28870933 C>A,T), RS1001374917 (16:28851390 C>T), RS1001558767 (16:28869848 C>A,G)

Disease associations

OMIM: gene MIM:608937 | disease phenotypes: MIM:601003, MIM:613444

GenCC curated gene-disease

Disease	Classification	Inheritance
severe early-onset obesity-insulin resistance syndrome due to SH2B1 deficiency	Moderate	Autosomal dominant

Mondo (5): severe early-onset obesity-insulin resistance syndrome due to SH2B1 deficiency (MONDO:0017994), Brody myopathy (MONDO:0010977), obesity disorder (MONDO:0011122), primary ovarian failure (MONDO:0005387), distal 16p11.2 microdeletion syndrome (MONDO:0013267)

Orphanet (6): Severe early-onset obesity-insulin resistance syndrome due to SH2B1 deficiency (Orphanet:329249), Brody myopathy (Orphanet:53347), Obesity due to melanocortin 4 receptor deficiency (Orphanet:71529), Distal 16p11.2 microdeletion syndrome (Orphanet:261222), NON RARE IN EUROPE: Non rare obesity (Orphanet:521399), NON RARE IN EUROPE: Primary ovarian failure (Orphanet:619)

HPO phenotypes

78 total (30 of 78 shown, HPO-id order):

HPO	Term
HP:0000003	Multicystic kidney dysplasia
HP:0000076	Vesicoureteral reflux
HP:0000077	Abnormality of the kidney
HP:0000093	Proteinuria
HP:0000104	Renal agenesis
HP:0000160	Narrow mouth
HP:0000175	Cleft palate
HP:0000256	Macrocephaly
HP:0000294	Low anterior hairline
HP:0000300	Oval face
HP:0000316	Hypertelorism
HP:0000337	Broad forehead
HP:0000347	Micrognathia
HP:0000405	Conductive hearing impairment
HP:0000407	Sensorineural hearing impairment
HP:0000426	Prominent nasal bridge
HP:0000510	Rod-cone dystrophy
HP:0000556	Retinal dystrophy
HP:0000708	Atypical behavior
HP:0000717	Autism
HP:0000718	Aggressive behavior
HP:0000729	Autistic behavior
HP:0000733	Motor stereotypy
HP:0000750	Delayed speech and language development
HP:0000776	Congenital diaphragmatic hernia
HP:0000842	Hyperinsulinemia
HP:0000902	Rib fusion
HP:0001161	Hand polydactyly
HP:0001166	Arachnodactyly
HP:0001249	Intellectual disability

GWAS associations

60 associations (top):

Study	Trait	p-value
GCST000296_2	Body mass index	3.000000e-10
GCST000298_3	Body mass index	5.000000e-11
GCST000299_2	Weight	1.000000e-09
GCST000830_13	Body mass index	2.000000e-20
GCST000879_2	Crohn’s disease	2.000000e-11
GCST001953_11	Obesity	3.000000e-13
GCST001953_36	Obesity	7.000000e-09
GCST001953_56	Obesity	5.000000e-12
GCST002598_62	Educational attainment	1.000000e-06
GCST003435_17	Body fat percentage	7.000000e-07
GCST003435_2	Body fat percentage	8.000000e-08
GCST003435_30	Body fat percentage	7.000000e-09
GCST003435_36	Body fat percentage	5.000000e-06
GCST004029_31	Angiotensin-converting enzyme inhibitor intolerance	3.000000e-08
GCST004065_36	Waist circumference	5.000000e-15
GCST004065_42	Waist circumference	1.000000e-22
GCST004065_46	Waist circumference	3.000000e-12
GCST004131_83	Inflammatory bowel disease	2.000000e-12
GCST004132_69	Crohn’s disease	3.000000e-10
GCST004364_11	Intelligence	4.000000e-08
GCST004364_31	Intelligence	1.000000e-08
GCST004557_110	Body mass index	9.000000e-10
GCST004557_211	Body mass index	3.000000e-08
GCST004557_243	Body mass index	2.000000e-15
GCST004558_106	Body mass index (joint analysis main effects and physical activity interaction)	2.000000e-07
GCST004558_163	Body mass index (joint analysis main effects and physical activity interaction)	9.000000e-15
GCST004558_179	Body mass index (joint analysis main effects and physical activity interaction)	2.000000e-09
GCST004558_29	Body mass index (joint analysis main effects and physical activity interaction)	1.000000e-16
GCST004559_107	Body mass index in physically active individuals	2.000000e-13
GCST004559_137	Body mass index in physically active individuals	1.000000e-09

EFO canonical traits (17, from GWAS)

EFO ID	Trait name
EFO:0004340	body mass index
EFO:0004338	body weight
EFO:0004784	self reported educational attainment
EFO:0007800	body fat percentage
EFO:0005325	response to angiotensin-converting enzyme inhibitor
EFO:0004337	intelligence
EFO:0008002	physical activity measurement
EFO:0004305	erythrocyte count
EFO:0004682	QT interval
EFO:0006941	grip strength measurement
EFO:0004341	body fat distribution
EFO:0008579	risk-taking behaviour
EFO:0008111	diet measurement
EFO:0004346	neuroimaging measurement
EFO:0009819	comparative body size at age 10, self-reported
EFO:0004527	mean corpuscular hemoglobin
EFO:0010701	mean reticulocyte volume

MeSH disease descriptors (2)

Descriptor	Name	Tree numbers
D016649	Primary Ovarian Insufficiency	C12.050.351.500.056.630.750; C12.100.250.056.630.750; C19.391.630.750
C536607	Brody myopathy (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

PharmGKB clinical annotations

1 annotations.

Variant	Type	Level	Drugs	Phenotypes
rs3888190	Toxicity	3	amisulpride;aripiprazole;clozapine;lithium;mirtazapine;olanzapine;paliperidone;quetiapine;risperidone;valproic acid	Bipolar Disorder;Depressive Disorder;Psychotic Disorder;Schizoaffective disorder

PharmGKB variants

1 variants.

Variant	Genes	Level	Score	#Clin annots	Drugs
rs192613545	SH2B1		0.00	0

CTD chemical–gene interactions

21 total (human), top 21 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
alpha-pinene	affects cotreatment, increases oxidation, increases abundance	1
butyraldehyde	decreases expression	1
methacrylaldehyde	increases abundance, affects cotreatment, increases oxidation	1
di-n-butylphosphoric acid	affects expression	1
2-palmitoylglycerol	increases expression	1
Leflunomide	decreases expression	1
Acrolein	increases abundance, affects cotreatment, increases oxidation	1
Air Pollutants	affects cotreatment, increases abundance, increases oxidation	1
Arsenic	affects methylation	1
Caffeine	affects phosphorylation	1
Carcinogens	decreases expression	1
Copper	increases expression, affects binding	1
Ozone	affects cotreatment, increases oxidation, increases abundance	1
Potassium Dichromate	increases expression	1
Smoke	decreases expression	1
Thiosemicarbazones	affects binding, increases expression	1
Urethane	increases expression	1
Valproic Acid	increases methylation	1
Okadaic Acid	decreases expression	1
Copper Sulfate	decreases expression	1
Volatile Organic Compounds	affects cotreatment, increases oxidation	1

Clinical trials (associated diseases)

300 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00076362	PHASE4	COMPLETED	Pediatric Hypothalamic Obesity
NCT00079547	PHASE4	COMPLETED	The Safety and Effectiveness of Low and High Carbohydrate Diets
NCT00115063	PHASE4	TERMINATED	LOSS- Louisiana Obese Subjects Study
NCT00134303	PHASE4	COMPLETED	Trial Comparing Metformin Versus Placebo in Non Alcoholic Steatohepatitis (NASH) Patients Receiving Bariatric Surgery for Obesity
NCT00143936	PHASE4	COMPLETED	The Safety and Efficacy of Low and High Carbohydrate Diets
NCT00143962	PHASE4	COMPLETED	Comparison of Two Approaches to Weight Loss Follow-Up Study
NCT00152360	PHASE4	COMPLETED	The Effect of Xenical on Weight and Risk Factors
NCT00176306	PHASE4	COMPLETED	Levofloxacin Pharmacokinetics (PK) in the Severely Obese
NCT00203450	PHASE4	COMPLETED	Zonegran for the Treatment of Weight Gain Associated With Psychotropic Medication Use: A Placebo-Controlled Trial
NCT00205504	PHASE4	COMPLETED	Oral Contraceptives in the Metabolic Syndrome
NCT00229229	PHASE4	TERMINATED	Comparison of 4 Diets in the Management of Overweight Patients With Vascular Disease
NCT00234988	PHASE4	COMPLETED	A Phase IV, Multi-Center, Open-Label Trial of Sibutramine in Combination With a Hypocaloric Diet in Obese and Overweight Thai Subjects.
NCT00264589	PHASE4	COMPLETED	Exercise Training and Cardiovascular Function in Obesity and in Type 2 Diabetes
NCT00288873	PHASE4	COMPLETED	Characterization of Hyperparathyroidism and Vitamin D Deficiency in Obesity
NCT00298857	PHASE4	TERMINATED	A Pharmacokinetic Study to Compare the Dosing of Valproic Acid in Subjects With Different Body Weights
NCT00315146	PHASE4	COMPLETED	Optimizing Body Composition for Function in Older Adults
NCT00319202	PHASE4	TERMINATED	Clinical Trial to Assess the Effects of Candesartan on the Carbohydrate Metabolism of Obese Subjects
NCT00327912	PHASE4	UNKNOWN	Laparoscopic Roux-en-Y Gastric Bypass Versus Laparoscopic Biliopancreatic Diversion (BPD)- Duodenal Switch for Superobesity
NCT00352287	PHASE4	COMPLETED	Study to Determine the Effects of Human Growth Hormone and Pioglitazone in Overweight, Prediabetic Adults
NCT00353054	PHASE4	COMPLETED	Effect of Calcium/Vitamin D Supplementation on Body Weight and Fat Loss.
NCT00390637	PHASE4	COMPLETED	Diet, Obesity and Genes (DiOGenes)
NCT00415688	PHASE4	COMPLETED	Lifestyle Modification for Obesity-Related Type 2 Diabetes
NCT00433641	PHASE4	COMPLETED	Weight Loss in Response to Sibutramine (MERIDIA) is Influenced by the Inherited Genes
NCT00440375	PHASE4	COMPLETED	Effects of Rosiglitazone on Bone in Postmenopausal Diabetic Women
NCT00453557	PHASE4	COMPLETED	Mechanism of Growth Hormone Effects on Adipose Tissue
NCT00456885	PHASE4	COMPLETED	The Effect of Exenatide on Weight and Hunger in Obese, Healthy Women
NCT00463112	PHASE4	COMPLETED	Effect of Diet Plus Sibutramine on Hormonal and Metabolic Features in Overweight and Obese Women With PCOS
NCT00512187	PHASE4	COMPLETED	Moderate Weight Loss Makes Obese Patients With Severe Chronic Plaque Psoriasis Responsive to Sub-Optimal Dose of Cyclosporine: an Investigator Blinded, Controlled, Randomized Clinical Trial
NCT00516919	PHASE4	COMPLETED	Study of Behavioral Weight Loss Therapy for Obesity and Binge Eating in Monolingual Hispanic Persons
NCT00522470	PHASE4	COMPLETED	Effects of Rosiglitazone on Serum Ghrelin and Peptide YY Levels
NCT00537810	PHASE4	COMPLETED	Treatment of Binge Eating in Obese Patients in Primary Care
NCT00538486	PHASE4	COMPLETED	A Randomized, Double-Blind, Active Control Trial Comparing Effects of Telmisartan, Candesartan and Amlodipine, Alone or Plus Metformin, on Non-Diabetic, Obese Hypertensive Patients
NCT00584389	PHASE4	TERMINATED	The Effect of Rimonabant on Energy Expenditure, Fat Metabolism and Body Composition
NCT00585182	PHASE4	COMPLETED	Study to Evaluate Weight-based Enoxaparin Dosing in Obese Medical Patients at Risk for DVT
NCT00632840	PHASE4	COMPLETED	Pharmacological Regulation of Fat Transport in Metabolic Syndrome
NCT00636142	PHASE4	COMPLETED	Effects of Infliximab on Insulin Sensitivity and Beta Cell Function in Insulin Resistant Human Obesity
NCT00675987	PHASE4	COMPLETED	A Randomized Clinical Trial To Study Losartan On Endothelial Dysfunction and Insulin Resistance In Obese Patients
NCT00694811	PHASE4	COMPLETED	Effects of Re-Feeding Duration on Weight Maintenance After Weight Loss With Very-Low-Energy Diets (VLEDs)
NCT00699413	PHASE4	TERMINATED	Supplements for Controlling Resistance to Insulin
NCT00729963	PHASE4	COMPLETED	Sibutramine Versus Continuous Positive Airway Pressure (CPAP)in Obstructive Sleep Apnea (OSA) Patients